Starting /dee2/code/volunteer_pipeline.sh SRR12690150 current disk space = 3056108793856 free memory = 1578787380 SRR12690150 SRAfilesize 629c7bb730918f6c04a84a9931a5c77d SRR12690150.sra SRR12690150.sra file validated SRR12690150 is paired end SRR12690150 is conventional basespace SRR12690150 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690150_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5135 37.0 37.0 37.0 37.0 37.0 2 36.4105 37.0 37.0 37.0 37.0 37.0 3 36.5305 37.0 37.0 37.0 37.0 37.0 4 36.5725 37.0 37.0 37.0 37.0 37.0 5 36.611 37.0 37.0 37.0 37.0 37.0 6 36.5435 37.0 37.0 37.0 37.0 37.0 7 36.5345 37.0 37.0 37.0 37.0 37.0 8 36.5305 37.0 37.0 37.0 37.0 37.0 9 36.6235 37.0 37.0 37.0 37.0 37.0 10-14 36.5603 37.0 37.0 37.0 37.0 37.0 15-19 36.557 37.0 37.0 37.0 37.0 37.0 20-24 36.5402 37.0 37.0 37.0 37.0 37.0 25-29 36.4747 37.0 37.0 37.0 37.0 37.0 30-34 36.4613 37.0 37.0 37.0 37.0 37.0 35-39 36.448699999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.405199999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.44619999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.416700000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.34009999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.37500000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.326299999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.336299999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.295899999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2228 37.0 37.0 37.0 37.0 37.0 85-89 36.245400000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.25940000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.17210000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.153099999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1983 37.0 37.0 37.0 37.0 37.0 110-114 36.1053 37.0 37.0 37.0 37.0 37.0 115-119 36.0709 37.0 37.0 37.0 37.0 37.0 120-124 36.068099999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.0266 37.0 37.0 37.0 37.0 37.0 130-134 35.97260000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.9202 37.0 37.0 37.0 37.0 37.0 140-144 35.7694 37.0 37.0 37.0 37.0 37.0 145-149 35.562599999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.45125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 4.0 27 9.0 28 9.0 29 21.0 30 15.0 31 33.0 32 57.0 33 87.0 34 122.0 35 315.0 36 3015.0 37 311.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.35 13.350000000000001 6.4750000000000005 37.824999999999996 2 19.188376753507015 11.923847695390782 35.445891783567134 33.44188376753507 3 16.525000000000002 15.6 27.275 40.6 4 22.2 23.7 23.400000000000002 30.7 5 22.85 28.625 24.825 23.7 6 21.075 31.874999999999996 24.099999999999998 22.95 7 17.125 26.775 39.275 16.825000000000003 8 18.0 26.224999999999998 31.95 23.825 9 18.4 23.7 35.475 22.425 10-14 20.335 28.98 27.589999999999996 23.095 15-19 20.255000000000003 27.29 28.37 24.085 20-24 20.62 27.939999999999998 27.644999999999996 23.794999999999998 25-29 20.79 28.189999999999998 27.115000000000002 23.905 30-34 20.335 28.015 27.35 24.3 35-39 20.59 27.544999999999998 27.92 23.945 40-44 20.47 27.52 28.26 23.75 45-49 20.785 27.765 27.279999999999998 24.169999999999998 50-54 21.029999999999998 27.21 27.565 24.195 55-59 20.64 28.185 27.134999999999998 24.04 60-64 20.775 27.794999999999998 27.43 24.0 65-69 21.45 28.060000000000002 26.625 23.865 70-74 21.41 27.42 27.07 24.099999999999998 75-79 20.53 27.98 27.755000000000003 23.735 80-84 21.26 27.74 27.169999999999998 23.830000000000002 85-89 21.425 27.11 27.63 23.835 90-94 21.535 27.195000000000004 27.339999999999996 23.93 95-99 21.685 27.800000000000004 27.13 23.385 100-104 21.59 28.199999999999996 26.97 23.24 105-109 21.17 27.455000000000002 27.279999999999998 24.095 110-114 21.515 27.73 27.474999999999998 23.28 115-119 21.15 27.735 26.945000000000004 24.169999999999998 120-124 21.4 27.935 26.86 23.805 125-129 21.785 27.305 26.72 24.19 130-134 21.279999999999998 28.04 27.389999999999997 23.29 135-139 22.12 27.36 26.33 24.19 140-144 21.245 27.92 26.87 23.965 145-149 21.67 26.825 27.04 24.465 150-151 21.45 27.287499999999998 26.625 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 1.5 26 3.5 27 3.5 28 4.5 29 7.5 30 8.0 31 11.0 32 19.0 33 34.5 34 45.5 35 49.0 36 67.0 37 97.5 38 119.0 39 133.5 40 163.0 41 204.5 42 227.0 43 231.5 44 259.5 45 264.0 46 251.5 47 261.5 48 246.0 49 214.0 50 197.5 51 175.5 52 141.5 53 118.5 54 99.0 55 82.5 56 72.5 57 55.0 58 30.0 59 23.5 60 24.0 61 14.5 62 11.5 63 9.0 64 3.5 65 1.5 66 2.5 67 4.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.3 #Duplication Level Percentage of deduplicated Percentage of total 1 91.6210295728368 83.65 2 7.420591456736035 13.55 3 0.7667031763417306 2.1 4 0.19167579408543264 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.975 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.6624999999999996 0.0 0.0 0.0 0.0 122-123 4.175 0.0 0.0 0.0 0.0 124-125 4.6375 0.0 0.0 0.0 0.0 126-127 5.050000000000001 0.0 0.0 0.0 0.0 128-129 5.7375 0.0 0.0 0.0 0.0 130-131 6.0875 0.0 0.0 0.0 0.0 132-133 6.5 0.0 0.0 0.0 0.0 134-135 6.95 0.0 0.0 0.0 0.0 136-137 7.387499999999999 0.0 0.0 0.0 0.0 138-139 7.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCAG 10 0.006830828 145.0 8 AGGACTG 10 0.006830828 145.0 5 GGACTGC 10 0.006830828 145.0 6 TGACAGG 10 0.006830828 145.0 1 ACAGGAC 10 0.006830828 145.0 3 >>END_MODULE SRR12690150 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690150_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1365 37.0 37.0 37.0 37.0 37.0 2 35.828 37.0 37.0 37.0 37.0 37.0 3 35.861 37.0 37.0 37.0 37.0 37.0 4 36.028 37.0 37.0 37.0 37.0 37.0 5 36.0795 37.0 37.0 37.0 37.0 37.0 6 36.12 37.0 37.0 37.0 37.0 37.0 7 36.0525 37.0 37.0 37.0 37.0 37.0 8 36.2025 37.0 37.0 37.0 37.0 37.0 9 36.106 37.0 37.0 37.0 37.0 37.0 10-14 36.1649 37.0 37.0 37.0 37.0 37.0 15-19 36.136 37.0 37.0 37.0 37.0 37.0 20-24 36.0514 37.0 37.0 37.0 37.0 37.0 25-29 36.0655 37.0 37.0 37.0 37.0 37.0 30-34 36.0287 37.0 37.0 37.0 37.0 37.0 35-39 35.9683 37.0 37.0 37.0 37.0 37.0 40-44 35.9138 37.0 37.0 37.0 37.0 37.0 45-49 35.9533 37.0 37.0 37.0 37.0 37.0 50-54 35.8937 37.0 37.0 37.0 37.0 37.0 55-59 35.9388 37.0 37.0 37.0 37.0 37.0 60-64 35.886900000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.825599999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.693400000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.6929 37.0 37.0 37.0 37.0 37.0 80-84 35.723299999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.765 37.0 37.0 37.0 37.0 37.0 90-94 35.652 37.0 37.0 37.0 37.0 37.0 95-99 35.73120000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.710300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.672000000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.594 37.0 37.0 37.0 37.0 37.0 115-119 35.5114 37.0 37.0 37.0 37.0 37.0 120-124 35.477599999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.452200000000005 37.0 37.0 37.0 34.6 37.0 130-134 35.3096 37.0 37.0 37.0 32.2 37.0 135-139 35.307599999999994 37.0 37.0 37.0 34.6 37.0 140-144 35.1984 37.0 37.0 37.0 29.8 37.0 145-149 35.092 37.0 37.0 37.0 27.4 37.0 150-151 34.537499999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 3.0 15 2.0 16 3.0 17 1.0 18 2.0 19 4.0 20 3.0 21 2.0 22 7.0 23 4.0 24 10.0 25 6.0 26 13.0 27 9.0 28 29.0 29 25.0 30 31.0 31 48.0 32 49.0 33 120.0 34 227.0 35 571.0 36 2590.0 37 235.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.775 25.874999999999996 10.0 25.35 2 28.425 28.65 26.85 16.075 3 20.375 30.275000000000002 29.799999999999997 19.55 4 23.275000000000002 34.475 23.275000000000002 18.975 5 24.575 36.5 21.025 17.9 6 21.175 40.400000000000006 21.075 17.349999999999998 7 20.3 25.2 35.675000000000004 18.825 8 21.85 28.175 26.525 23.45 9 21.925 25.75 29.15 23.175 10-14 23.05 30.185000000000002 24.995 21.77 15-19 23.075000000000003 28.794999999999998 26.5 21.63 20-24 23.07 29.060000000000002 26.43 21.44 25-29 22.41 27.77 28.04 21.78 30-34 22.564999999999998 28.23 27.744999999999997 21.46 35-39 22.85 28.24 26.995 21.915000000000003 40-44 22.689999999999998 28.165000000000003 27.495000000000005 21.65 45-49 22.82 27.439999999999998 28.294999999999998 21.445 50-54 22.75 28.32 26.865 22.065 55-59 23.215 27.35 27.57 21.865000000000002 60-64 23.044999999999998 27.500000000000004 27.455000000000002 22.0 65-69 23.45 27.85 26.400000000000002 22.3 70-74 22.759999999999998 28.060000000000002 26.96 22.220000000000002 75-79 23.575 28.53 26.295 21.6 80-84 23.265 28.134999999999998 26.72 21.88 85-89 23.455000000000002 28.01 26.865 21.67 90-94 24.265 27.715 26.715 21.305 95-99 23.65 27.775 26.655 21.92 100-104 24.104999999999997 28.025 26.125 21.745 105-109 23.73 27.825 26.985 21.46 110-114 24.625 27.555000000000003 26.765 21.055 115-119 24.905 28.444999999999997 25.615 21.035 120-124 24.765 27.91 26.56 20.765 125-129 24.63 27.93 26.44 21.0 130-134 24.63 27.750000000000004 27.095000000000002 20.525 135-139 25.295 27.67 26.215 20.82 140-144 25.385 28.4 26.27 19.945 145-149 25.564999999999998 27.529999999999998 26.41 20.495 150-151 26.474999999999998 26.887499999999996 26.825 19.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 0.0 22 1.0 23 2.0 24 2.5 25 3.5 26 4.0 27 2.5 28 1.5 29 5.0 30 8.5 31 12.5 32 21.5 33 27.5 34 36.5 35 50.0 36 71.5 37 100.0 38 133.0 39 174.0 40 195.0 41 198.0 42 229.5 43 262.5 44 279.0 45 265.0 46 259.5 47 265.0 48 248.0 49 221.0 50 177.0 51 144.5 52 115.5 53 94.5 54 81.5 55 67.0 56 52.5 57 41.0 58 34.5 59 26.0 60 16.5 61 13.5 62 11.5 63 9.0 64 5.5 65 2.5 66 1.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.76568112738326 83.025 2 6.825089803813208 12.35 3 0.9394860458690245 2.55 4 0.33158331030671456 1.2 5 0.027631942525559547 0.125 6 0.027631942525559547 0.15 7 0.027631942525559547 0.17500000000000002 8 0.027631942525559547 0.2 9 0.027631942525559547 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.975 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.6624999999999996 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.7125000000000004 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.6875 0.0 0.0 0.0 0.0 126-127 5.1 0.0 0.0 0.0 0.0 128-129 5.7875 0.0 0.0 0.0 0.0 130-131 6.1375 0.0 0.0 0.0 0.0 132-133 6.5625 0.0 0.0 0.0 0.0 134-135 7.0625 0.0 0.0 0.0 0.0 136-137 7.512499999999999 0.0 0.0 0.0 0.0 138-139 7.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAAT 10 0.006830828 145.0 2 ACCACTA 10 0.006830828 145.0 7 GTACCAG 15 1.1411342E-4 145.0 145 ACGCAAA 10 0.006830828 145.0 1 CCACTAG 10 0.006830828 145.0 8 CACTAGG 10 0.006830828 145.0 9 CAAACCA 10 0.006830828 145.0 4 CGCAAAC 10 0.006830828 145.0 2 >>END_MODULE Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra Read 978459 spots for SRR12690150.sra Written 978459 spots for SRR12690150.sra Read 978447 spots for SRR12690150.sra Written 978447 spots for SRR12690150.sra SRR ids: ['SRR12690150.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0zvvvya7 SRR12690150.sra spots: 19568952 blocks: [[1, 978447], [978448, 1956894], [1956895, 2935341], [2935342, 3913788], [3913789, 4892235], [4892236, 5870682], [5870683, 6849129], [6849130, 7827576], [7827577, 8806023], [8806024, 9784470], [9784471, 10762917], [10762918, 11741364], [11741365, 12719811], [12719812, 13698258], [13698259, 14676705], [14676706, 15655152], [15655153, 16633599], [16633600, 17612046], [17612047, 18590493], [18590494, 19568952]] SRR12690150 file size 6628685 SRR12690150 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690150 SRR12690150_1.fastq SRR12690150_2.fastq Input file: SRR12690150_1.fastq Paired file: SRR12690150_2.fastq trimmed: SRR12690150-trimmed-pair1.fastq, SRR12690150-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:21:46 2025 >> started Mon Feb 10 20:22:08 2025 >> done (22.230s) 19568952 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 12456 ( 0.06%) empty read pairs filtered out after trimming by size control 19556467 (99.94%) read pairs available; of these: 2289987 (11.71%) trimmed read pairs available after processing 17266480 (88.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 9 0.00% 23 17 0.00% 24 10 0.00% 25 8 0.00% 26 19 0.00% 27 11 0.00% 28 28 0.00% 29 18 0.00% 30 24 0.00% 31 26 0.00% 32 35 0.00% 33 33 0.00% 34 25 0.00% 35 37 0.00% 36 20 0.00% 37 25 0.00% 38 27 0.00% 39 27 0.00% 40 36 0.00% 41 39 0.00% 42 35 0.00% 43 41 0.00% 44 43 0.00% 45 41 0.00% 46 56 0.00% 47 67 0.00% 48 58 0.00% 49 77 0.00% 50 75 0.00% 51 108 0.00% 52 90 0.00% 53 114 0.00% 54 100 0.00% 55 135 0.00% 56 160 0.00% 57 181 0.00% 58 201 0.00% 59 238 0.00% 60 247 0.00% 61 323 0.00% 62 352 0.00% 63 361 0.00% 64 444 0.00% 65 481 0.00% 66 573 0.00% 67 634 0.00% 68 707 0.00% 69 825 0.00% 70 871 0.00% 71 1058 0.01% 72 1196 0.01% 73 1272 0.01% 74 1461 0.01% 75 1683 0.01% 76 1820 0.01% 77 2052 0.01% 78 2357 0.01% 79 2587 0.01% 80 2882 0.01% 81 3202 0.02% 82 3784 0.02% 83 4069 0.02% 84 4512 0.02% 85 4994 0.03% 86 5617 0.03% 87 6054 0.03% 88 6667 0.03% 89 6884 0.04% 90 7904 0.04% 91 8350 0.04% 92 8810 0.05% 93 9928 0.05% 94 10807 0.06% 95 11588 0.06% 96 12309 0.06% 97 13146 0.07% 98 13982 0.07% 99 15043 0.08% 100 15757 0.08% 101 16360 0.08% 102 17203 0.09% 103 18511 0.09% 104 19473 0.10% 105 20667 0.11% 106 21168 0.11% 107 22307 0.11% 108 22858 0.12% 109 24191 0.12% 110 24546 0.13% 111 25982 0.13% 112 27136 0.14% 113 27907 0.14% 114 29167 0.15% 115 30403 0.16% 116 31445 0.16% 117 32907 0.17% 118 33697 0.17% 119 34928 0.18% 120 36509 0.19% 121 36778 0.19% 122 37884 0.19% 123 39931 0.20% 124 41078 0.21% 125 41250 0.21% 126 42667 0.22% 127 43923 0.22% 128 44533 0.23% 129 45796 0.23% 130 46418 0.24% 131 47257 0.24% 132 48646 0.25% 133 50016 0.26% 134 50596 0.26% 135 52544 0.27% 136 52925 0.27% 137 53283 0.27% 138 54480 0.28% 139 56626 0.29% 140 57041 0.29% 141 57719 0.30% 142 59847 0.31% 143 60489 0.31% 144 62390 0.32% 145 62560 0.32% 146 63383 0.32% 147 64042 0.33% 148 66155 0.34% 149 64914 0.33% 150 67547 0.35% 151 17266480 88.29% 19556467 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=21 prefix-density=0.64 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=25.31 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.2 sequence=GAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTGTG criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=22 prefix-density=0.91 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=31.94 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=1.8 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12690150 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:23:26 Started mapping on | Feb 10 20:23:26 Finished on | Feb 10 20:25:30 Mapping speed, Million of reads per hour | 567.77 Number of input reads | 19556467 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18454574 Uniquely mapped reads % | 94.37% Average mapped length | 295.26 Number of splices: Total | 18635487 Number of splices: Annotated (sjdb) | 18259735 Number of splices: GT/AG | 18262537 Number of splices: GC/AG | 303567 Number of splices: AT/AC | 10691 Number of splices: Non-canonical | 58692 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.16 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455972 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 110603 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.53% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 645921 645921 645921 N_multimapping 455972 455972 455972 N_noFeature 527618 18176068 603541 N_ambiguous 329018 1091 125870 UnstrandedReadsAssigned:17597938 PositiveStrandReadsAssigned:277415 NegativeStrandReadsAssigned:17725163 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690150 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690150-trimmed-pair1.fastq SRR12690150-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,556,467 reads, 17,737,934 reads pseudoaligned [quant] estimated average fragment length: 251.253 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 991 rounds 52401 SRR12690150.ke.tsv 34699 SRR12690150.se.tsv 87100 total ==> SRR12690150.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.75 581 14.6473 Potri.005G024800.1.v4.1 1035 784.747 371 21.0691 Potri.004G059700.1.v4.1 961 710.901 17 1.06572 Potri.007G009000.2.v4.1 1416 1165.75 0 0 Potri.003G141000.2.v4.1 2943 2692.75 990.203 16.3882 Potri.016G087400.1.v4.1 270 85.8099 896 465.342 Potri.015G069301.1.v4.1 564 327.529 0 0 Potri.010G195200.1.v4.1 1773 1522.75 16 0.468268 Potri.012G127500.1.v4.1 977 726.819 401 24.5878 ==> SRR12690150.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 276 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 10 SRR12690150 completed mapping pipeline successfully