Starting /dee2/code/volunteer_pipeline.sh SRR12690151 current disk space = 3056277762048 free memory = 1578164820 SRR12690151 SRAfilesize ae58ea419a152b00046e463f79a9b263 SRR12690151.sra SRR12690151.sra file validated SRR12690151 is paired end SRR12690151 is conventional basespace SRR12690151 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690151_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.635 37.0 37.0 37.0 37.0 37.0 2 36.268 37.0 37.0 37.0 37.0 37.0 3 36.52 37.0 37.0 37.0 37.0 37.0 4 36.577 37.0 37.0 37.0 37.0 37.0 5 36.656 37.0 37.0 37.0 37.0 37.0 6 36.664 37.0 37.0 37.0 37.0 37.0 7 36.549 37.0 37.0 37.0 37.0 37.0 8 36.6485 37.0 37.0 37.0 37.0 37.0 9 36.5635 37.0 37.0 37.0 37.0 37.0 10-14 36.6366 37.0 37.0 37.0 37.0 37.0 15-19 36.6327 37.0 37.0 37.0 37.0 37.0 20-24 36.5641 37.0 37.0 37.0 37.0 37.0 25-29 36.5364 37.0 37.0 37.0 37.0 37.0 30-34 36.5369 37.0 37.0 37.0 37.0 37.0 35-39 36.514599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4834 37.0 37.0 37.0 37.0 37.0 45-49 36.4731 37.0 37.0 37.0 37.0 37.0 50-54 36.4289 37.0 37.0 37.0 37.0 37.0 55-59 36.41 37.0 37.0 37.0 37.0 37.0 60-64 36.4137 37.0 37.0 37.0 37.0 37.0 65-69 36.368100000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.371900000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.3917 37.0 37.0 37.0 37.0 37.0 80-84 36.2093 37.0 37.0 37.0 37.0 37.0 85-89 36.2534 37.0 37.0 37.0 37.0 37.0 90-94 36.2652 37.0 37.0 37.0 37.0 37.0 95-99 36.226000000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.179700000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1529 37.0 37.0 37.0 37.0 37.0 110-114 36.1871 37.0 37.0 37.0 37.0 37.0 115-119 36.135200000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0628 37.0 37.0 37.0 37.0 37.0 125-129 36.0379 37.0 37.0 37.0 37.0 37.0 130-134 36.0052 37.0 37.0 37.0 37.0 37.0 135-139 36.0447 37.0 37.0 37.0 37.0 37.0 140-144 35.8753 37.0 37.0 37.0 37.0 37.0 145-149 35.8043 37.0 37.0 37.0 37.0 37.0 150-151 35.54075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 3.0 26 6.0 27 3.0 28 9.0 29 12.0 30 24.0 31 37.0 32 48.0 33 55.0 34 99.0 35 308.0 36 3043.0 37 350.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.65 11.825 6.950000000000001 40.575 2 19.10507792860734 13.59979889391654 37.129210658622426 30.165912518853695 3 17.325 16.325 28.625 37.724999999999994 4 21.825 23.7 24.224999999999998 30.25 5 23.425 31.025000000000002 24.65 20.9 6 21.325 33.925 23.200000000000003 21.55 7 16.325 26.1 41.0 16.575 8 18.275 26.075 31.574999999999996 24.075 9 18.65 22.925 34.55 23.875 10-14 20.05 29.525000000000002 27.22 23.205000000000002 15-19 20.3 28.1 26.995 24.605 20-24 20.115 27.87 28.015 24.0 25-29 19.89 28.044999999999998 27.975 24.09 30-34 19.945 28.199999999999996 27.98 23.875 35-39 20.064999999999998 28.04 27.744999999999997 24.15 40-44 19.950000000000003 29.044999999999998 27.42 23.585 45-49 20.465 27.525 27.935 24.075 50-54 20.165 27.534999999999997 27.985 24.315 55-59 20.07 27.82 27.939999999999998 24.169999999999998 60-64 20.305 28.165000000000003 27.544999999999998 23.985 65-69 20.485 28.1 27.755000000000003 23.66 70-74 20.43 28.395 27.665 23.51 75-79 20.169999999999998 27.744999999999997 28.42 23.665 80-84 19.78 29.080000000000002 27.575 23.565 85-89 20.09 28.58 27.54 23.79 90-94 20.62 27.950000000000003 27.685 23.745 95-99 20.395 28.384999999999998 27.245 23.974999999999998 100-104 20.8 28.49 27.395000000000003 23.315 105-109 20.955 27.845 27.555000000000003 23.645 110-114 20.97 27.88 27.224999999999998 23.925 115-119 20.669999999999998 27.725 28.165000000000003 23.44 120-124 21.145 28.565 26.810000000000002 23.48 125-129 21.310000000000002 28.275 27.435 22.98 130-134 21.105 28.465 26.955000000000002 23.474999999999998 135-139 20.71 28.52 26.71 24.060000000000002 140-144 20.775 28.305000000000003 27.395000000000003 23.525 145-149 21.505 27.63 27.515 23.35 150-151 20.2125 27.9125 27.55 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 1.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 3.5 26 6.0 27 9.5 28 10.5 29 12.5 30 14.5 31 21.0 32 28.5 33 34.5 34 56.0 35 79.0 36 88.5 37 99.0 38 124.0 39 153.0 40 173.0 41 198.0 42 219.5 43 231.5 44 248.0 45 256.5 46 273.0 47 268.0 48 226.5 49 215.0 50 193.5 51 155.5 52 128.5 53 106.0 54 86.0 55 64.5 56 55.0 57 43.0 58 32.5 59 27.0 60 21.5 61 14.5 62 8.0 63 4.5 64 2.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 91.54814004376368 83.675 2 7.631291028446389 13.950000000000001 3 0.6838074398249453 1.875 4 0.13676148796498905 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.0125000000000002 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.6624999999999996 0.0 0.0 0.0 0.0 118-119 2.975 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.8875 0.0 0.0 0.0 0.0 124-125 4.237500000000001 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 5.074999999999999 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 5.875 0.0 0.0 0.0 0.0 134-135 6.225 0.0 0.0 0.0 0.0 136-137 6.7 0.0 0.0 0.0 0.0 138-139 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTATAT 10 0.006830828 145.0 1 >>END_MODULE SRR12690151 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690151_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.23 37.0 37.0 37.0 37.0 37.0 2 35.953 37.0 37.0 37.0 37.0 37.0 3 36.009 37.0 37.0 37.0 37.0 37.0 4 36.304 37.0 37.0 37.0 37.0 37.0 5 36.263 37.0 37.0 37.0 37.0 37.0 6 36.0935 37.0 37.0 37.0 37.0 37.0 7 36.3175 37.0 37.0 37.0 37.0 37.0 8 36.3585 37.0 37.0 37.0 37.0 37.0 9 36.344 37.0 37.0 37.0 37.0 37.0 10-14 36.2603 37.0 37.0 37.0 37.0 37.0 15-19 36.2407 37.0 37.0 37.0 37.0 37.0 20-24 36.1946 37.0 37.0 37.0 37.0 37.0 25-29 36.146699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.1857 37.0 37.0 37.0 37.0 37.0 35-39 36.1391 37.0 37.0 37.0 37.0 37.0 40-44 36.0708 37.0 37.0 37.0 37.0 37.0 45-49 36.126999999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.0313 37.0 37.0 37.0 37.0 37.0 55-59 35.98 37.0 37.0 37.0 37.0 37.0 60-64 35.9519 37.0 37.0 37.0 37.0 37.0 65-69 36.0053 37.0 37.0 37.0 37.0 37.0 70-74 35.8644 37.0 37.0 37.0 37.0 37.0 75-79 35.883500000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.8878 37.0 37.0 37.0 37.0 37.0 85-89 35.9288 37.0 37.0 37.0 37.0 37.0 90-94 35.8163 37.0 37.0 37.0 37.0 37.0 95-99 35.7957 37.0 37.0 37.0 37.0 37.0 100-104 35.7973 37.0 37.0 37.0 37.0 37.0 105-109 35.7934 37.0 37.0 37.0 37.0 37.0 110-114 35.69939999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.6726 37.0 37.0 37.0 37.0 37.0 120-124 35.5982 37.0 37.0 37.0 37.0 37.0 125-129 35.5783 37.0 37.0 37.0 37.0 37.0 130-134 35.425 37.0 37.0 37.0 37.0 37.0 135-139 35.41459999999999 37.0 37.0 37.0 34.6 37.0 140-144 35.314499999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.1582 37.0 37.0 37.0 29.8 37.0 150-151 34.6315 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 3.0 15 1.0 16 1.0 17 1.0 18 1.0 19 2.0 20 0.0 21 1.0 22 3.0 23 1.0 24 5.0 25 4.0 26 9.0 27 13.0 28 18.0 29 21.0 30 27.0 31 43.0 32 81.0 33 91.0 34 244.0 35 581.0 36 2613.0 37 233.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.875 24.0 10.0 27.125 2 25.324999999999996 28.325 29.549999999999997 16.8 3 21.025 27.575 31.7 19.7 4 23.474999999999998 36.0 22.7 17.825 5 25.55 36.775000000000006 22.025 15.65 6 20.5 38.824999999999996 22.8 17.875 7 20.0 23.925 36.775000000000006 19.3 8 20.4 25.5 29.025000000000002 25.074999999999996 9 21.8 25.05 29.849999999999998 23.3 10-14 23.555 28.965000000000003 26.52 20.96 15-19 23.225 28.325 27.52 20.93 20-24 22.655 28.610000000000003 27.21 21.525 25-29 22.52 28.549999999999997 27.884999999999998 21.044999999999998 30-34 22.825 27.26 28.494999999999997 21.42 35-39 22.67 28.395 27.465 21.47 40-44 22.7 28.01 28.08 21.21 45-49 22.564999999999998 28.115000000000002 28.055000000000003 21.265 50-54 22.615 28.050000000000004 27.655 21.68 55-59 22.79 27.77 27.944999999999997 21.495 60-64 22.765 27.834999999999997 28.134999999999998 21.265 65-69 22.314999999999998 27.544999999999998 28.055000000000003 22.085 70-74 23.01 28.37 27.855 20.765 75-79 22.75 28.384999999999998 27.525 21.34 80-84 23.165 27.57 27.51 21.755 85-89 23.61 27.955000000000002 27.250000000000004 21.185000000000002 90-94 23.255 28.07 27.55 21.125 95-99 23.485 27.48 28.139999999999997 20.895 100-104 23.549999999999997 27.644999999999996 27.389999999999997 21.415 105-109 23.28 27.894999999999996 27.725 21.099999999999998 110-114 23.595 27.805000000000003 27.955000000000002 20.645 115-119 23.580000000000002 28.51 27.134999999999998 20.775 120-124 24.65 27.6 27.384999999999998 20.365 125-129 24.575 28.07 27.250000000000004 20.105 130-134 25.069999999999997 27.83 27.060000000000002 20.04 135-139 24.875 27.744999999999997 27.034999999999997 20.345 140-144 25.355 27.165 27.400000000000002 20.080000000000002 145-149 25.27 28.09 26.99 19.650000000000002 150-151 26.487500000000004 27.6125 26.337500000000002 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 2.5 11 2.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 3.0 23 3.0 24 1.5 25 2.5 26 4.0 27 5.5 28 7.0 29 11.5 30 15.5 31 23.0 32 28.5 33 34.0 34 56.5 35 70.5 36 87.0 37 114.0 38 145.5 39 181.0 40 194.0 41 210.5 42 225.0 43 235.0 44 277.0 45 292.0 46 266.0 47 239.5 48 207.0 49 202.0 50 179.5 51 125.0 52 101.5 53 90.0 54 81.0 55 66.0 56 50.0 57 44.5 58 34.0 59 19.0 60 17.0 61 16.5 62 6.5 63 1.5 64 2.0 65 2.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.49052978314576 83.325 2 7.466373867691463 13.600000000000001 3 0.8509470216854241 2.325 4 0.1372495196266813 0.5 5 0.05489980785067252 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCATTAGTTTCGCTTCCGTTATTTTTATCAAATCAAAAGGAGAAAAAAA 5 0.125 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.0125000000000002 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.975 0.0 0.0 0.0 0.0 112-113 2.15 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.65 0.0 0.0 0.0 0.0 118-119 2.975 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.875 0.0 0.0 0.0 0.0 124-125 4.237500000000001 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 5.074999999999999 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 5.875 0.0 0.0 0.0 0.0 134-135 6.2375 0.0 0.0 0.0 0.0 136-137 6.725 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra Read 1154035 spots for SRR12690151.sra Written 1154035 spots for SRR12690151.sra Read 1154023 spots for SRR12690151.sra Written 1154023 spots for SRR12690151.sra SRR ids: ['SRR12690151.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ingi7v_ SRR12690151.sra spots: 23080472 blocks: [[1, 1154023], [1154024, 2308046], [2308047, 3462069], [3462070, 4616092], [4616093, 5770115], [5770116, 6924138], [6924139, 8078161], [8078162, 9232184], [9232185, 10386207], [10386208, 11540230], [11540231, 12694253], [12694254, 13848276], [13848277, 15002299], [15002300, 16156322], [16156323, 17310345], [17310346, 18464368], [18464369, 19618391], [19618392, 20772414], [20772415, 21926437], [21926438, 23080472]] SRR12690151 file size 7822053 SRR12690151 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690151 SRR12690151_1.fastq SRR12690151_2.fastq Input file: SRR12690151_1.fastq Paired file: SRR12690151_2.fastq trimmed: SRR12690151-trimmed-pair1.fastq, SRR12690151-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:08:27 2025 >> started Mon Feb 10 20:09:02 2025 >> done (35.215s) 23080472 read pairs processed; of these: 46 ( 0.00%) short read pairs filtered out after trimming by size control 2355 ( 0.01%) empty read pairs filtered out after trimming by size control 23078071 (99.99%) read pairs available; of these: 2574672 (11.16%) trimmed read pairs available after processing 20503399 (88.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 3 0.00% 21 7 0.00% 22 6 0.00% 23 8 0.00% 24 10 0.00% 25 9 0.00% 26 11 0.00% 27 12 0.00% 28 14 0.00% 29 19 0.00% 30 26 0.00% 31 12 0.00% 32 21 0.00% 33 22 0.00% 34 23 0.00% 35 25 0.00% 36 24 0.00% 37 32 0.00% 38 26 0.00% 39 31 0.00% 40 33 0.00% 41 41 0.00% 42 52 0.00% 43 48 0.00% 44 44 0.00% 45 51 0.00% 46 47 0.00% 47 79 0.00% 48 83 0.00% 49 91 0.00% 50 112 0.00% 51 128 0.00% 52 112 0.00% 53 141 0.00% 54 151 0.00% 55 127 0.00% 56 178 0.00% 57 204 0.00% 58 211 0.00% 59 217 0.00% 60 342 0.00% 61 312 0.00% 62 403 0.00% 63 424 0.00% 64 473 0.00% 65 515 0.00% 66 610 0.00% 67 700 0.00% 68 824 0.00% 69 866 0.00% 70 1000 0.00% 71 1134 0.00% 72 1248 0.01% 73 1497 0.01% 74 1675 0.01% 75 1813 0.01% 76 1985 0.01% 77 2206 0.01% 78 2529 0.01% 79 2955 0.01% 80 3133 0.01% 81 3629 0.02% 82 4168 0.02% 83 4524 0.02% 84 4798 0.02% 85 5533 0.02% 86 5899 0.03% 87 6468 0.03% 88 7032 0.03% 89 7610 0.03% 90 8417 0.04% 91 8873 0.04% 92 9804 0.04% 93 10686 0.05% 94 11614 0.05% 95 12310 0.05% 96 13369 0.06% 97 14283 0.06% 98 15014 0.07% 99 15867 0.07% 100 17214 0.07% 101 18020 0.08% 102 18813 0.08% 103 20079 0.09% 104 21141 0.09% 105 21957 0.10% 106 23163 0.10% 107 24263 0.11% 108 25333 0.11% 109 26335 0.11% 110 27605 0.12% 111 28496 0.12% 112 29628 0.13% 113 30599 0.13% 114 31886 0.14% 115 32884 0.14% 116 34639 0.15% 117 36137 0.16% 118 37162 0.16% 119 38165 0.17% 120 39500 0.17% 121 41308 0.18% 122 42287 0.18% 123 44517 0.19% 124 44922 0.19% 125 45874 0.20% 126 47740 0.21% 127 48955 0.21% 128 49953 0.22% 129 51011 0.22% 130 52168 0.23% 131 53509 0.23% 132 54893 0.24% 133 57257 0.25% 134 58095 0.25% 135 58739 0.25% 136 60416 0.26% 137 61274 0.27% 138 62589 0.27% 139 64811 0.28% 140 65989 0.29% 141 66929 0.29% 142 68184 0.30% 143 68934 0.30% 144 71308 0.31% 145 72262 0.31% 146 73598 0.32% 147 74073 0.32% 148 76030 0.33% 149 76399 0.33% 150 78586 0.34% 151 20503399 88.84% 23078071 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=0.60 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=8.10 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=4.8 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=24 prefix-density=0.58 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.21 sequence-density-rank=21 fanout-score=23.99 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=10.8 sequence=AAAGAAAAGAAAA SRR12690151 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:09:43 Started mapping on | Feb 10 20:09:44 Finished on | Feb 10 20:12:06 Mapping speed, Million of reads per hour | 585.08 Number of input reads | 23078071 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21885281 Uniquely mapped reads % | 94.83% Average mapped length | 295.63 Number of splices: Total | 21922497 Number of splices: Annotated (sjdb) | 21398188 Number of splices: GT/AG | 21452184 Number of splices: GC/AG | 379070 Number of splices: AT/AC | 16035 Number of splices: Non-canonical | 75208 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 509797 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 107365 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 682993 682993 682993 N_multimapping 509797 509797 509797 N_noFeature 855330 21608009 943408 N_ambiguous 330423 1223 140496 UnstrandedReadsAssigned:20699528 PositiveStrandReadsAssigned:276049 NegativeStrandReadsAssigned:20801377 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690151 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690151-trimmed-pair1.fastq SRR12690151-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,078,071 reads, 20,860,727 reads pseudoaligned [quant] estimated average fragment length: 250.901 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR12690151.ke.tsv 34699 SRR12690151.se.tsv 87100 total ==> SRR12690151.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.1 706 17.5869 Potri.005G024800.1.v4.1 1035 785.099 407 22.8329 Potri.004G059700.1.v4.1 961 711.245 8 0.495405 Potri.007G009000.2.v4.1 1416 1166.1 0 0 Potri.003G141000.2.v4.1 2943 2693.1 795.454 13.0093 Potri.016G087400.1.v4.1 270 84.1659 918 480.393 Potri.015G069301.1.v4.1 564 327.317 0 0 Potri.010G195200.1.v4.1 1773 1523.1 28 0.809692 Potri.012G127500.1.v4.1 977 727.166 124 7.51067 ==> SRR12690151.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 228 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 25 SRR12690151 completed mapping pipeline successfully