Starting /dee2/code/volunteer_pipeline.sh SRR12690152 current disk space = 3056869089280 free memory = 1294455956 SRR12690152 SRAfilesize cbcd4050517848a6623df6531987975b SRR12690152.sra SRR12690152.sra file validated SRR12690152 is paired end SRR12690152 is conventional basespace SRR12690152 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690152_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6465 37.0 37.0 37.0 37.0 37.0 2 36.52675 37.0 37.0 37.0 37.0 37.0 3 36.56 37.0 37.0 37.0 37.0 37.0 4 36.6215 37.0 37.0 37.0 37.0 37.0 5 36.661 37.0 37.0 37.0 37.0 37.0 6 36.6425 37.0 37.0 37.0 37.0 37.0 7 36.592 37.0 37.0 37.0 37.0 37.0 8 36.6725 37.0 37.0 37.0 37.0 37.0 9 36.633 37.0 37.0 37.0 37.0 37.0 10-14 36.6008 37.0 37.0 37.0 37.0 37.0 15-19 36.602000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5586 37.0 37.0 37.0 37.0 37.0 25-29 36.5785 37.0 37.0 37.0 37.0 37.0 30-34 36.5052 37.0 37.0 37.0 37.0 37.0 35-39 36.5035 37.0 37.0 37.0 37.0 37.0 40-44 36.505700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4837 37.0 37.0 37.0 37.0 37.0 50-54 36.4612 37.0 37.0 37.0 37.0 37.0 55-59 36.4093 37.0 37.0 37.0 37.0 37.0 60-64 36.416399999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.349000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3668 37.0 37.0 37.0 37.0 37.0 75-79 36.341 37.0 37.0 37.0 37.0 37.0 80-84 36.2792 37.0 37.0 37.0 37.0 37.0 85-89 36.3144 37.0 37.0 37.0 37.0 37.0 90-94 36.25279999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.264700000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.196999999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.198 37.0 37.0 37.0 37.0 37.0 110-114 36.1293 37.0 37.0 37.0 37.0 37.0 115-119 36.1097 37.0 37.0 37.0 37.0 37.0 120-124 36.0908 37.0 37.0 37.0 37.0 37.0 125-129 36.0253 37.0 37.0 37.0 37.0 37.0 130-134 36.044799999999995 37.0 37.0 37.0 37.0 37.0 135-139 36.0018 37.0 37.0 37.0 37.0 37.0 140-144 35.821299999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.80929999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.598749999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 6.0 27 5.0 28 10.0 29 20.0 30 15.0 31 30.0 32 35.0 33 74.0 34 111.0 35 336.0 36 3014.0 37 342.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.125 12.1 8.175 41.6 2 19.033308289506635 12.221387427998998 36.263461056849486 32.48184322564488 3 18.025 15.225 26.5 40.25 4 21.65 22.95 25.0 30.4 5 22.225 30.575000000000003 24.65 22.55 6 20.9 31.8 24.25 23.05 7 17.025000000000002 26.224999999999998 40.6 16.150000000000002 8 18.2 26.35 31.374999999999996 24.075 9 17.75 24.125 36.075 22.05 10-14 19.79 28.875 27.88 23.455000000000002 15-19 19.314999999999998 28.299999999999997 28.175 24.21 20-24 19.755 27.465 28.499999999999996 24.279999999999998 25-29 19.685 28.055000000000003 28.01 24.25 30-34 19.78 26.99 28.804999999999996 24.425 35-39 20.150000000000002 28.025 27.589999999999996 24.235 40-44 20.18 28.27 27.965 23.585 45-49 20.1 28.03 27.66 24.21 50-54 20.19 28.139999999999997 28.065 23.605 55-59 19.855 28.18 28.27 23.695 60-64 20.150000000000002 27.62 28.134999999999998 24.095 65-69 19.875 28.16 27.605 24.36 70-74 20.325 28.21 27.955000000000002 23.51 75-79 20.255000000000003 27.944999999999997 27.435 24.365000000000002 80-84 20.474999999999998 27.825 27.544999999999998 24.154999999999998 85-89 20.325 27.54 27.96 24.175 90-94 20.75 27.994999999999997 27.82 23.435 95-99 20.68 27.694999999999997 27.925 23.7 100-104 20.435 28.705000000000002 26.924999999999997 23.935000000000002 105-109 20.635 28.189999999999998 27.73 23.445 110-114 20.424999999999997 28.705000000000002 27.655 23.215 115-119 20.465 28.185 28.084999999999997 23.265 120-124 21.125 28.04 27.175 23.66 125-129 21.044999999999998 28.455000000000002 26.974999999999998 23.525 130-134 20.995 28.565 26.755000000000003 23.685000000000002 135-139 21.075 28.345 27.384999999999998 23.195 140-144 20.93 28.055000000000003 27.6 23.415 145-149 20.66 28.4 27.05 23.89 150-151 20.9375 28.4 26.9625 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 1.0 25 1.5 26 4.0 27 6.5 28 8.5 29 11.5 30 16.0 31 20.5 32 26.0 33 42.5 34 58.5 35 70.5 36 89.0 37 100.0 38 128.0 39 166.0 40 177.0 41 199.0 42 217.0 43 235.5 44 265.0 45 260.0 46 246.5 47 254.5 48 237.5 49 212.5 50 189.0 51 158.5 52 126.0 53 94.0 54 82.0 55 73.5 56 60.0 57 44.5 58 32.5 59 22.0 60 18.5 61 14.0 62 8.0 63 5.5 64 4.5 65 3.0 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.25 #Duplication Level Percentage of deduplicated Percentage of total 1 89.85994397759104 80.2 2 8.487394957983193 15.15 3 1.4565826330532212 3.9 4 0.1400560224089636 0.5 5 0.05602240896358543 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCTTGCCTGTCTGGTGCCCAGGATCGGTATCTCTCTCCAGGTTGCTTG 5 0.125 No Hit GTCTGAGCATAGTACTTCTCAGCTTCAGGAGTGCTCTTAATCTTTGCTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.7375 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.6624999999999996 0.0 0.0 0.0 0.0 132-133 3.8875 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 4.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCCAA 20 0.00593511 29.0 20-24 CAATGAA 30 0.0014437955 24.166668 35-39 >>END_MODULE SRR12690152 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690152_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0895 37.0 37.0 37.0 37.0 37.0 2 35.8755 37.0 37.0 37.0 37.0 37.0 3 35.8825 37.0 37.0 37.0 37.0 37.0 4 36.08 37.0 37.0 37.0 37.0 37.0 5 36.0995 37.0 37.0 37.0 37.0 37.0 6 36.0645 37.0 37.0 37.0 37.0 37.0 7 35.982 37.0 37.0 37.0 37.0 37.0 8 36.219 37.0 37.0 37.0 37.0 37.0 9 36.281 37.0 37.0 37.0 37.0 37.0 10-14 36.1695 37.0 37.0 37.0 37.0 37.0 15-19 36.2203 37.0 37.0 37.0 37.0 37.0 20-24 36.1364 37.0 37.0 37.0 37.0 37.0 25-29 36.1036 37.0 37.0 37.0 37.0 37.0 30-34 36.0574 37.0 37.0 37.0 37.0 37.0 35-39 36.0921 37.0 37.0 37.0 37.0 37.0 40-44 35.9956 37.0 37.0 37.0 37.0 37.0 45-49 36.039899999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.9238 37.0 37.0 37.0 37.0 37.0 55-59 35.9338 37.0 37.0 37.0 37.0 37.0 60-64 35.8928 37.0 37.0 37.0 37.0 37.0 65-69 35.8634 37.0 37.0 37.0 37.0 37.0 70-74 35.832100000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.8739 37.0 37.0 37.0 37.0 37.0 80-84 35.7881 37.0 37.0 37.0 37.0 37.0 85-89 35.7747 37.0 37.0 37.0 37.0 37.0 90-94 35.6513 37.0 37.0 37.0 37.0 37.0 95-99 35.676300000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.747699999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.704899999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.6497 37.0 37.0 37.0 37.0 37.0 115-119 35.592200000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.4911 37.0 37.0 37.0 37.0 37.0 125-129 35.4709 37.0 37.0 37.0 37.0 37.0 130-134 35.3185 37.0 37.0 37.0 32.2 37.0 135-139 35.2618 37.0 37.0 37.0 29.8 37.0 140-144 35.2995 37.0 37.0 37.0 32.2 37.0 145-149 35.146499999999996 37.0 37.0 37.0 29.8 37.0 150-151 34.54 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 3.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 3.0 23 5.0 24 4.0 25 2.0 26 6.0 27 13.0 28 16.0 29 21.0 30 32.0 31 42.0 32 80.0 33 158.0 34 270.0 35 682.0 36 2472.0 37 186.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.675 23.025000000000002 12.225 30.075000000000003 2 28.825 25.85 28.7 16.625 3 18.8 29.525000000000002 31.624999999999996 20.05 4 23.325000000000003 34.8 23.799999999999997 18.075 5 24.2 36.0 22.2 17.599999999999998 6 21.05 39.574999999999996 22.925 16.45 7 20.325 23.5 37.4 18.775 8 22.025 25.3 28.349999999999998 24.325 9 21.625 25.775 29.95 22.650000000000002 10-14 22.41 29.189999999999998 26.900000000000002 21.5 15-19 22.38 28.455000000000002 27.700000000000003 21.465 20-24 23.0 28.525 27.63 20.845 25-29 22.5 28.16 28.38 20.96 30-34 22.405 28.08 28.58 20.935000000000002 35-39 22.195 28.194999999999997 28.04 21.57 40-44 22.255 28.53 27.939999999999998 21.275 45-49 22.495 28.32 28.455000000000002 20.73 50-54 22.37 28.12 28.4 21.11 55-59 23.235 27.529999999999998 28.115000000000002 21.12 60-64 23.244999999999997 27.689999999999998 28.095 20.97 65-69 23.05 27.785 28.07 21.095 70-74 23.11 28.155 27.46 21.275 75-79 23.385 27.415 27.425 21.775 80-84 22.830000000000002 28.04 27.74 21.39 85-89 23.46 27.71 27.634999999999998 21.195 90-94 23.745 27.725 27.615000000000002 20.915 95-99 23.11 28.425 27.744999999999997 20.72 100-104 23.799999999999997 28.125 27.455000000000002 20.62 105-109 23.919999999999998 27.55 27.1 21.43 110-114 23.494999999999997 28.675 27.51 20.32 115-119 24.695 27.93 26.76 20.615 120-124 24.725 27.935 26.91 20.43 125-129 24.709999999999997 27.495000000000005 27.1 20.695 130-134 25.005 27.810000000000002 26.96 20.225 135-139 24.4 28.299999999999997 27.345000000000002 19.955000000000002 140-144 25.15 27.77 27.134999999999998 19.945 145-149 25.445 27.87 27.27 19.415 150-151 25.2875 28.3625 27.200000000000003 19.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.0 24 2.5 25 2.5 26 5.0 27 6.5 28 9.5 29 12.0 30 14.0 31 17.0 32 34.0 33 43.5 34 45.0 35 68.5 36 82.5 37 106.0 38 134.5 39 162.5 40 209.5 41 230.5 42 251.0 43 291.0 44 287.0 45 267.5 46 257.0 47 241.5 48 218.0 49 183.0 50 168.0 51 149.5 52 107.0 53 88.5 54 72.5 55 54.0 56 47.5 57 33.0 58 22.5 59 15.0 60 15.0 61 12.5 62 5.0 63 3.0 64 2.0 65 0.0 66 0.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.1 #Duplication Level Percentage of deduplicated Percentage of total 1 89.8989898989899 80.10000000000001 2 8.333333333333332 14.85 3 1.4870931537598204 3.975 4 0.22446689113355783 0.8 5 0.02805836139169473 0.125 6 0.02805836139169473 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit TGAAGGTTTCATGAATTTCATGCACAGGGATGAGGAGGTCAACTATTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.175 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.3125 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.9875 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 3.8625 0.0 0.0 0.0 0.0 134-135 4.137499999999999 0.0 0.0 0.0 0.0 136-137 4.512499999999999 0.0 0.0 0.0 0.0 138-139 4.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAACA 10 0.006830828 145.0 2 AATTCGT 10 0.006830828 145.0 5 AGAACAC 10 0.006830828 145.0 3 GAATTCG 10 0.006830828 145.0 4 AGAGAAC 10 0.006830828 145.0 1 ATTGAAT 10 0.006830828 145.0 1 >>END_MODULE Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669719 spots for SRR12690152.sra Written 669719 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra Read 669705 spots for SRR12690152.sra Written 669705 spots for SRR12690152.sra SRR ids: ['SRR12690152.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m3ikqzhx SRR12690152.sra spots: 13394114 blocks: [[1, 669705], [669706, 1339410], [1339411, 2009115], [2009116, 2678820], [2678821, 3348525], [3348526, 4018230], [4018231, 4687935], [4687936, 5357640], [5357641, 6027345], [6027346, 6697050], [6697051, 7366755], [7366756, 8036460], [8036461, 8706165], [8706166, 9375870], [9375871, 10045575], [10045576, 10715280], [10715281, 11384985], [11384986, 12054690], [12054691, 12724395], [12724396, 13394114]] SRR12690152 file size 4530205 SRR12690152 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690152 SRR12690152_1.fastq SRR12690152_2.fastq Input file: SRR12690152_1.fastq Paired file: SRR12690152_2.fastq trimmed: SRR12690152-trimmed-pair1.fastq, SRR12690152-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:19:27 2025 >> started Mon Feb 10 19:19:49 2025 >> done (22.072s) 13394114 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 1873 ( 0.01%) empty read pairs filtered out after trimming by size control 13392228 (99.99%) read pairs available; of these: 1105440 ( 8.25%) trimmed read pairs available after processing 12286788 (91.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 5 0.00% 24 4 0.00% 25 6 0.00% 26 5 0.00% 27 9 0.00% 28 5 0.00% 29 10 0.00% 30 8 0.00% 31 13 0.00% 32 14 0.00% 33 14 0.00% 34 10 0.00% 35 14 0.00% 36 10 0.00% 37 13 0.00% 38 10 0.00% 39 17 0.00% 40 22 0.00% 41 20 0.00% 42 27 0.00% 43 20 0.00% 44 16 0.00% 45 27 0.00% 46 28 0.00% 47 29 0.00% 48 36 0.00% 49 30 0.00% 50 36 0.00% 51 46 0.00% 52 57 0.00% 53 37 0.00% 54 47 0.00% 55 50 0.00% 56 57 0.00% 57 74 0.00% 58 100 0.00% 59 94 0.00% 60 127 0.00% 61 146 0.00% 62 158 0.00% 63 161 0.00% 64 171 0.00% 65 180 0.00% 66 205 0.00% 67 243 0.00% 68 255 0.00% 69 290 0.00% 70 335 0.00% 71 361 0.00% 72 470 0.00% 73 546 0.00% 74 566 0.00% 75 616 0.00% 76 676 0.01% 77 775 0.01% 78 842 0.01% 79 1019 0.01% 80 1042 0.01% 81 1187 0.01% 82 1249 0.01% 83 1432 0.01% 84 1666 0.01% 85 1837 0.01% 86 2034 0.02% 87 2196 0.02% 88 2389 0.02% 89 2534 0.02% 90 2907 0.02% 91 3154 0.02% 92 3295 0.02% 93 3680 0.03% 94 3938 0.03% 95 4457 0.03% 96 4607 0.03% 97 4995 0.04% 98 5336 0.04% 99 5655 0.04% 100 6171 0.05% 101 6349 0.05% 102 6605 0.05% 103 7121 0.05% 104 7614 0.06% 105 8126 0.06% 106 8642 0.06% 107 9095 0.07% 108 9405 0.07% 109 9796 0.07% 110 10260 0.08% 111 10865 0.08% 112 11323 0.08% 113 12068 0.09% 114 12568 0.09% 115 13063 0.10% 116 13729 0.10% 117 14023 0.10% 118 14934 0.11% 119 15218 0.11% 120 16243 0.12% 121 16942 0.13% 122 17161 0.13% 123 18367 0.14% 124 18824 0.14% 125 18987 0.14% 126 20062 0.15% 127 20378 0.15% 128 21206 0.16% 129 21721 0.16% 130 23115 0.17% 131 23005 0.17% 132 23856 0.18% 133 25141 0.19% 134 25491 0.19% 135 26322 0.20% 136 27243 0.20% 137 27430 0.20% 138 28312 0.21% 139 29327 0.22% 140 29946 0.22% 141 31088 0.23% 142 32129 0.24% 143 32562 0.24% 144 34494 0.26% 145 34671 0.26% 146 35533 0.27% 147 35649 0.27% 148 37706 0.28% 149 37327 0.28% 150 39461 0.29% 151 12286788 91.75% 13392228 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.89 fanout-score-rank=17 prefix-density=0.34 prefix-fanout=4.0 sequence=AGGTTTCTTGACT criterion=fanout-score sequence-density=0.05 sequence-density-rank=37 fanout-score=53.82 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=9.0 sequence=TCTTCTCATCACTCACAAGCAAGTCGTGGCGTAGGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAGTAGCTAACTCCTGAGTCTGAACTTGTTTTACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACAAAGATGTCAAAGCTACAGAAGCACTTGCTGTATCGGCAGTTGTTGCATTAAAATTATCGTTAAGGAAGTCTCCGTATGCTTTATTTCGAACGTAAAAATCAGAAGTAGAACCCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATTCATCAGAATAGCATTGTCTTAACTTCAAATCCTTGAGCGCTTTAGTGGCAGCATTATACCAGGATGTGGTGATGGGAAACCAGAAAACTTTCTTGGGTGCTT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=40 prefix-density=0.40 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTAC criterion=fanout-score sequence-density=0.13 sequence-density-rank=18 fanout-score=43.50 fanout-score-rank=1 prefix-density=2.83 prefix-fanout=2.0 sequence=CACCTGCGACAACTGCGACTGCG SRR12690152 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:20:34 Started mapping on | Feb 10 19:20:34 Finished on | Feb 10 19:22:13 Mapping speed, Million of reads per hour | 486.99 Number of input reads | 13392228 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12574634 Uniquely mapped reads % | 93.90% Average mapped length | 297.20 Number of splices: Total | 12069519 Number of splices: Annotated (sjdb) | 11758794 Number of splices: GT/AG | 11829969 Number of splices: GC/AG | 180521 Number of splices: AT/AC | 9802 Number of splices: Non-canonical | 49227 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.03% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350765 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 136804 % of reads mapped to too many loci | 1.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.25% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 466829 466829 466829 N_multimapping 350765 350765 350765 N_noFeature 524508 12362457 582516 N_ambiguous 240385 970 85621 UnstrandedReadsAssigned:11809741 PositiveStrandReadsAssigned:211207 NegativeStrandReadsAssigned:11906497 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690152 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690152-trimmed-pair1.fastq SRR12690152-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,392,228 reads, 11,861,136 reads pseudoaligned [quant] estimated average fragment length: 259.71 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR12690152.ke.tsv 34699 SRR12690152.se.tsv 87100 total ==> SRR12690152.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.29 412 14.3598 Potri.005G024800.1.v4.1 1035 776.29 254 20.0631 Potri.004G059700.1.v4.1 961 702.404 47 4.10298 Potri.007G009000.2.v4.1 1416 1157.29 0 0 Potri.003G141000.2.v4.1 2943 2684.29 561.979 12.8374 Potri.016G087400.1.v4.1 270 78.2067 666.706 522.731 Potri.015G069301.1.v4.1 564 318.49 0 0 Potri.010G195200.1.v4.1 1773 1514.29 33 1.33627 Potri.012G127500.1.v4.1 977 718.326 64 5.4632 ==> SRR12690152.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 191 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12690152 completed mapping pipeline successfully