Starting /dee2/code/volunteer_pipeline.sh SRR12690153 current disk space = 3056830144512 free memory = 1202021528 SRR12690153 SRAfilesize f91940ec371fbc29cf19fc0abe60e8dd SRR12690153.sra SRR12690153.sra file validated SRR12690153 is paired end SRR12690153 is conventional basespace SRR12690153 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690153_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6685 37.0 37.0 37.0 37.0 37.0 2 36.48175 37.0 37.0 37.0 37.0 37.0 3 36.654 37.0 37.0 37.0 37.0 37.0 4 36.6565 37.0 37.0 37.0 37.0 37.0 5 36.646 37.0 37.0 37.0 37.0 37.0 6 36.6945 37.0 37.0 37.0 37.0 37.0 7 36.569 37.0 37.0 37.0 37.0 37.0 8 36.6095 37.0 37.0 37.0 37.0 37.0 9 36.6635 37.0 37.0 37.0 37.0 37.0 10-14 36.6341 37.0 37.0 37.0 37.0 37.0 15-19 36.618900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.6034 37.0 37.0 37.0 37.0 37.0 25-29 36.5921 37.0 37.0 37.0 37.0 37.0 30-34 36.5528 37.0 37.0 37.0 37.0 37.0 35-39 36.5295 37.0 37.0 37.0 37.0 37.0 40-44 36.51090000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.468999999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.4818 37.0 37.0 37.0 37.0 37.0 55-59 36.427099999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.43920000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.3752 37.0 37.0 37.0 37.0 37.0 70-74 36.363800000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.40429999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.299400000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.3328 37.0 37.0 37.0 37.0 37.0 90-94 36.2773 37.0 37.0 37.0 37.0 37.0 95-99 36.2817 37.0 37.0 37.0 37.0 37.0 100-104 36.217400000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.239799999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1823 37.0 37.0 37.0 37.0 37.0 115-119 36.0898 37.0 37.0 37.0 37.0 37.0 120-124 36.037400000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.0496 37.0 37.0 37.0 37.0 37.0 130-134 36.0295 37.0 37.0 37.0 37.0 37.0 135-139 35.998599999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8501 37.0 37.0 37.0 37.0 37.0 145-149 35.866 37.0 37.0 37.0 37.0 37.0 150-151 35.676 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 2.0 27 10.0 28 9.0 29 11.0 30 24.0 31 25.0 32 42.0 33 71.0 34 113.0 35 291.0 36 3004.0 37 394.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.75 12.275 7.074999999999999 37.9 2 21.41601807682651 12.402711523976901 35.551092141601806 30.630178257594775 3 17.549999999999997 15.0 29.275000000000002 38.175 4 20.65 23.35 26.075 29.925 5 24.349999999999998 31.55 22.925 21.175 6 22.575 33.175 22.425 21.825 7 16.725 27.55 38.65 17.075000000000003 8 18.25 27.200000000000003 30.575000000000003 23.974999999999998 9 17.625 25.05 34.925 22.400000000000002 10-14 20.22 28.935 27.595 23.25 15-19 20.66 27.505000000000003 27.88 23.955000000000002 20-24 20.47 28.515 27.68 23.335 25-29 20.355 27.73 27.68 24.235 30-34 20.22 28.51 27.395000000000003 23.875 35-39 20.66 28.01 27.32 24.01 40-44 20.105 28.325 27.71 23.86 45-49 20.445 28.194999999999997 27.250000000000004 24.11 50-54 20.775 28.64 27.279999999999998 23.305 55-59 20.380000000000003 27.67 28.26 23.69 60-64 20.45 27.950000000000003 27.47 24.13 65-69 21.325 27.37 27.744999999999997 23.56 70-74 20.630000000000003 28.08 27.439999999999998 23.849999999999998 75-79 20.76 27.345000000000002 28.095 23.799999999999997 80-84 20.535 28.13 27.58 23.755000000000003 85-89 20.165 27.96 27.725 24.15 90-94 21.035 27.744999999999997 27.54 23.68 95-99 21.279999999999998 27.955000000000002 27.515 23.25 100-104 20.515 27.605 28.43 23.45 105-109 20.735 28.315 27.36 23.59 110-114 21.01 28.335 27.389999999999997 23.265 115-119 20.995 27.71 27.839999999999996 23.455000000000002 120-124 20.48 28.09 27.810000000000002 23.62 125-129 21.615000000000002 27.425 26.965 23.995 130-134 20.915 27.894999999999996 27.900000000000002 23.29 135-139 21.08 27.845 27.145000000000003 23.93 140-144 21.46 27.76 26.974999999999998 23.805 145-149 21.595 27.515 27.32 23.57 150-151 21.6625 27.3125 26.5125 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 1.5 23 1.5 24 1.0 25 1.5 26 2.0 27 7.0 28 9.0 29 10.5 30 17.0 31 21.5 32 19.0 33 29.5 34 49.0 35 68.5 36 78.5 37 87.0 38 112.5 39 136.5 40 172.5 41 214.0 42 235.5 43 241.0 44 260.5 45 254.0 46 240.5 47 250.0 48 256.5 49 232.5 50 195.5 51 161.5 52 139.5 53 132.0 54 90.5 55 67.5 56 60.5 57 39.5 58 32.5 59 29.0 60 17.5 61 8.5 62 3.5 63 2.0 64 1.5 65 1.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.3 #Duplication Level Percentage of deduplicated Percentage of total 1 91.78532311062432 83.8 2 7.064622124863089 12.9 3 1.013143483023001 2.775 4 0.10952902519167579 0.4 5 0.027382256297918947 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTTAATGAATACTGTTAATGAGAGCTAAGGCAATGCTAGTTAACTGAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3624999999999998 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.0875000000000004 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 2.9000000000000004 0.0 0.0 0.0 0.0 120-121 3.0999999999999996 0.0 0.0 0.0 0.0 122-123 3.5374999999999996 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.4875 0.0 0.0 0.0 0.0 128-129 4.925000000000001 0.0 0.0 0.0 0.0 130-131 5.325 0.0 0.0 0.0 0.0 132-133 5.8 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.65 0.0 0.0 0.0 0.0 138-139 7.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690153 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690153_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.247 37.0 37.0 37.0 37.0 37.0 2 36.0655 37.0 37.0 37.0 37.0 37.0 3 36.1015 37.0 37.0 37.0 37.0 37.0 4 36.087 37.0 37.0 37.0 37.0 37.0 5 36.2855 37.0 37.0 37.0 37.0 37.0 6 36.182 37.0 37.0 37.0 37.0 37.0 7 36.2315 37.0 37.0 37.0 37.0 37.0 8 36.2755 37.0 37.0 37.0 37.0 37.0 9 36.334 37.0 37.0 37.0 37.0 37.0 10-14 36.22619999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.25019999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.225 37.0 37.0 37.0 37.0 37.0 25-29 36.169 37.0 37.0 37.0 37.0 37.0 30-34 36.187 37.0 37.0 37.0 37.0 37.0 35-39 36.159400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.05200000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.1108 37.0 37.0 37.0 37.0 37.0 50-54 36.065799999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.067899999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.051199999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.9193 37.0 37.0 37.0 37.0 37.0 70-74 35.9082 37.0 37.0 37.0 37.0 37.0 75-79 35.916399999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.911100000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.9462 37.0 37.0 37.0 37.0 37.0 90-94 35.806799999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.790699999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.7839 37.0 37.0 37.0 37.0 37.0 105-109 35.760799999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.775999999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.64319999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.5961 37.0 37.0 37.0 37.0 37.0 125-129 35.5299 37.0 37.0 37.0 37.0 37.0 130-134 35.4681 37.0 37.0 37.0 34.6 37.0 135-139 35.3606 37.0 37.0 37.0 37.0 37.0 140-144 35.2584 37.0 37.0 37.0 32.2 37.0 145-149 35.100699999999996 37.0 37.0 37.0 29.8 37.0 150-151 34.6455 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 5.0 15 1.0 16 1.0 17 2.0 18 0.0 19 1.0 20 1.0 21 5.0 22 2.0 23 2.0 24 6.0 25 3.0 26 8.0 27 9.0 28 12.0 29 30.0 30 23.0 31 34.0 32 73.0 33 101.0 34 225.0 35 600.0 36 2617.0 37 236.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.1 24.4 10.4 26.1 2 27.05 28.575 28.7 15.675 3 20.625 28.849999999999998 31.65 18.875 4 22.875 34.875 23.599999999999998 18.65 5 26.075 36.449999999999996 21.7 15.775 6 21.224999999999998 38.95 21.275 18.55 7 20.775 23.674999999999997 37.6 17.95 8 21.525 27.55 27.325 23.599999999999998 9 22.375 25.4 29.2 23.025000000000002 10-14 23.415 30.23 25.16 21.195 15-19 22.63 29.645 26.755000000000003 20.97 20-24 22.585 29.060000000000002 27.339999999999996 21.015 25-29 23.04 29.375 27.165 20.419999999999998 30-34 22.67 28.444999999999997 27.389999999999997 21.495 35-39 22.615 28.165000000000003 27.48 21.740000000000002 40-44 22.525000000000002 28.03 28.050000000000004 21.395 45-49 22.55 27.865000000000002 28.34 21.245 50-54 22.925 27.705000000000002 27.884999999999998 21.485000000000003 55-59 22.425 28.555000000000003 27.215 21.805 60-64 22.965 27.815 27.71 21.51 65-69 23.165 27.395000000000003 27.775 21.665 70-74 22.7 27.97 27.71 21.62 75-79 22.625 27.515 28.050000000000004 21.81 80-84 22.95 28.285 26.88 21.884999999999998 85-89 23.26 28.165000000000003 27.07 21.505 90-94 23.044999999999998 28.189999999999998 27.24 21.525 95-99 23.485 28.384999999999998 26.650000000000002 21.48 100-104 23.895 28.435 26.71 20.96 105-109 23.5 28.37 26.924999999999997 21.205 110-114 23.244999999999997 28.349999999999998 27.105 21.3 115-119 23.69 28.035 27.05 21.224999999999998 120-124 23.385 29.015 27.265 20.335 125-129 24.385 27.744999999999997 27.529999999999998 20.34 130-134 24.765 27.675 26.565 20.995 135-139 24.57 27.450000000000003 27.295 20.685000000000002 140-144 26.035000000000004 26.83 27.13 20.005 145-149 25.61 27.650000000000002 26.91 19.830000000000002 150-151 26.075 28.599999999999998 25.387500000000003 19.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 1.5 22 1.5 23 1.0 24 4.5 25 5.5 26 2.0 27 1.0 28 2.0 29 6.5 30 14.5 31 20.5 32 23.5 33 33.0 34 56.0 35 76.0 36 87.5 37 117.0 38 150.5 39 171.5 40 197.0 41 224.0 42 246.5 43 248.0 44 251.0 45 257.5 46 255.5 47 235.0 48 224.5 49 220.0 50 177.0 51 129.5 52 114.5 53 110.0 54 80.5 55 63.5 56 49.5 57 30.0 58 23.0 59 21.0 60 18.0 61 11.5 62 5.0 63 1.5 64 1.5 65 2.5 66 2.5 67 1.0 68 1.0 69 1.5 70 0.5 71 0.0 72 1.5 73 1.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 1.0 89 1.0 90 0.0 91 1.0 92 1.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.68496158068056 83.525 2 7.189901207464325 13.100000000000001 3 0.960482985729967 2.625 4 0.054884742041712405 0.2 5 0.0823271130625686 0.375 6 0.0 0.0 7 0.027442371020856202 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 7 0.17500000000000002 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit CTATTGAAAAAGCGCAAGTTAAGGCCTAGAGAAGCTGACGCCATAAAGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 2.9125 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.5375 0.0 0.0 0.0 0.0 128-129 4.975 0.0 0.0 0.0 0.0 130-131 5.3625 0.0 0.0 0.0 0.0 132-133 5.85 0.0 0.0 0.0 0.0 134-135 6.262499999999999 0.0 0.0 0.0 0.0 136-137 6.699999999999999 0.0 0.0 0.0 0.0 138-139 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105280 spots for SRR12690153.sra Written 1105280 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra Read 1105269 spots for SRR12690153.sra Written 1105269 spots for SRR12690153.sra SRR ids: ['SRR12690153.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__g26ta1x SRR12690153.sra spots: 22105391 blocks: [[1, 1105269], [1105270, 2210538], [2210539, 3315807], [3315808, 4421076], [4421077, 5526345], [5526346, 6631614], [6631615, 7736883], [7736884, 8842152], [8842153, 9947421], [9947422, 11052690], [11052691, 12157959], [12157960, 13263228], [13263229, 14368497], [14368498, 15473766], [15473767, 16579035], [16579036, 17684304], [17684305, 18789573], [18789574, 19894842], [19894843, 21000111], [21000112, 22105391]] SRR12690153 file size 7490678 SRR12690153 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690153 SRR12690153_1.fastq SRR12690153_2.fastq Input file: SRR12690153_1.fastq Paired file: SRR12690153_2.fastq trimmed: SRR12690153-trimmed-pair1.fastq, SRR12690153-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:27:18 2025 >> started Mon Feb 10 19:27:58 2025 >> done (40.287s) 22105391 read pairs processed; of these: 38 ( 0.00%) short read pairs filtered out after trimming by size control 6911 ( 0.03%) empty read pairs filtered out after trimming by size control 22098442 (99.97%) read pairs available; of these: 2644620 (11.97%) trimmed read pairs available after processing 19453822 (88.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 13 0.00% 21 8 0.00% 22 12 0.00% 23 14 0.00% 24 16 0.00% 25 16 0.00% 26 23 0.00% 27 27 0.00% 28 35 0.00% 29 27 0.00% 30 27 0.00% 31 25 0.00% 32 29 0.00% 33 32 0.00% 34 29 0.00% 35 35 0.00% 36 30 0.00% 37 35 0.00% 38 46 0.00% 39 38 0.00% 40 35 0.00% 41 53 0.00% 42 47 0.00% 43 43 0.00% 44 38 0.00% 45 48 0.00% 46 68 0.00% 47 63 0.00% 48 69 0.00% 49 90 0.00% 50 88 0.00% 51 104 0.00% 52 116 0.00% 53 143 0.00% 54 158 0.00% 55 151 0.00% 56 160 0.00% 57 190 0.00% 58 187 0.00% 59 220 0.00% 60 305 0.00% 61 323 0.00% 62 387 0.00% 63 455 0.00% 64 542 0.00% 65 508 0.00% 66 566 0.00% 67 669 0.00% 68 738 0.00% 69 873 0.00% 70 981 0.00% 71 1108 0.01% 72 1235 0.01% 73 1311 0.01% 74 1541 0.01% 75 1741 0.01% 76 1963 0.01% 77 2255 0.01% 78 2437 0.01% 79 2746 0.01% 80 2999 0.01% 81 3444 0.02% 82 3766 0.02% 83 4380 0.02% 84 4779 0.02% 85 5252 0.02% 86 5742 0.03% 87 6273 0.03% 88 6877 0.03% 89 7538 0.03% 90 8150 0.04% 91 8811 0.04% 92 9647 0.04% 93 10289 0.05% 94 11543 0.05% 95 12447 0.06% 96 13011 0.06% 97 13975 0.06% 98 14915 0.07% 99 15606 0.07% 100 16800 0.08% 101 17549 0.08% 102 18905 0.09% 103 19875 0.09% 104 21049 0.10% 105 22114 0.10% 106 23312 0.11% 107 24573 0.11% 108 25724 0.12% 109 26442 0.12% 110 27396 0.12% 111 28917 0.13% 112 29800 0.13% 113 31064 0.14% 114 32391 0.15% 115 34416 0.16% 116 35304 0.16% 117 36591 0.17% 118 37938 0.17% 119 39355 0.18% 120 40576 0.18% 121 42045 0.19% 122 43130 0.20% 123 44658 0.20% 124 46722 0.21% 125 47415 0.21% 126 49639 0.22% 127 50782 0.23% 128 51732 0.23% 129 53315 0.24% 130 54634 0.25% 131 55773 0.25% 132 56997 0.26% 133 59373 0.27% 134 60330 0.27% 135 61325 0.28% 136 62748 0.28% 137 63433 0.29% 138 65332 0.30% 139 66961 0.30% 140 68124 0.31% 141 69636 0.32% 142 71589 0.32% 143 72588 0.33% 144 74382 0.34% 145 74557 0.34% 146 76424 0.35% 147 77110 0.35% 148 79143 0.36% 149 79352 0.36% 150 80554 0.36% 151 19453822 88.03% 22098442 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=13 prefix-density=0.80 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.17 sequence-density-rank=18 fanout-score=9.17 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=4.5 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=22 prefix-density=1.01 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=42.26 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.4 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCT SRR12690153 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:28:46 Started mapping on | Feb 10 19:28:47 Finished on | Feb 10 19:31:11 Mapping speed, Million of reads per hour | 552.46 Number of input reads | 22098442 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20932770 Uniquely mapped reads % | 94.73% Average mapped length | 295.42 Number of splices: Total | 20292320 Number of splices: Annotated (sjdb) | 19849513 Number of splices: GT/AG | 19888133 Number of splices: GC/AG | 333148 Number of splices: AT/AC | 15657 Number of splices: Non-canonical | 55382 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 588210 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 83165 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 577462 577462 577462 N_multimapping 588210 588210 588210 N_noFeature 708125 20724797 777523 N_ambiguous 273982 1140 134619 UnstrandedReadsAssigned:19950663 PositiveStrandReadsAssigned:206833 NegativeStrandReadsAssigned:20020628 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690153 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690153-trimmed-pair1.fastq SRR12690153-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,098,442 reads, 20,169,976 reads pseudoaligned [quant] estimated average fragment length: 238.064 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 SRR12690153.ke.tsv 34699 SRR12690153.se.tsv 87100 total ==> SRR12690153.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.94 490 13.0289 Potri.005G024800.1.v4.1 1035 797.936 156 9.25802 Potri.004G059700.1.v4.1 961 723.989 57 3.72824 Potri.007G009000.2.v4.1 1416 1178.94 0 0 Potri.003G141000.2.v4.1 2943 2705.94 750 13.1252 Potri.016G087400.1.v4.1 270 84.1835 1147 645.205 Potri.015G069301.1.v4.1 564 333.027 0 0 Potri.010G195200.1.v4.1 1773 1535.94 3 0.0924932 Potri.012G127500.1.v4.1 977 739.965 820 52.4764 ==> SRR12690153.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 356 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 338 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 6 SRR12690153 completed mapping pipeline successfully