Starting /dee2/code/volunteer_pipeline.sh SRR12690154 current disk space = 2824108466176 free memory = 1575755824 SRR12690154 SRAfilesize e89cef6f22a2f0be58e27f759b08969b SRR12690154.sra SRR12690154.sra file validated SRR12690154 is paired end SRR12690154 is conventional basespace SRR12690154 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690154_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6495 37.0 37.0 37.0 37.0 37.0 2 36.39275 37.0 37.0 37.0 37.0 37.0 3 36.62 37.0 37.0 37.0 37.0 37.0 4 36.5315 37.0 37.0 37.0 37.0 37.0 5 36.586 37.0 37.0 37.0 37.0 37.0 6 36.6325 37.0 37.0 37.0 37.0 37.0 7 36.521 37.0 37.0 37.0 37.0 37.0 8 36.607 37.0 37.0 37.0 37.0 37.0 9 36.639 37.0 37.0 37.0 37.0 37.0 10-14 36.6178 37.0 37.0 37.0 37.0 37.0 15-19 36.60080000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.55030000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.5167 37.0 37.0 37.0 37.0 37.0 30-34 36.4967 37.0 37.0 37.0 37.0 37.0 35-39 36.4933 37.0 37.0 37.0 37.0 37.0 40-44 36.5166 37.0 37.0 37.0 37.0 37.0 45-49 36.444900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4378 37.0 37.0 37.0 37.0 37.0 55-59 36.3525 37.0 37.0 37.0 37.0 37.0 60-64 36.373 37.0 37.0 37.0 37.0 37.0 65-69 36.290000000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.2688 37.0 37.0 37.0 37.0 37.0 75-79 36.3356 37.0 37.0 37.0 37.0 37.0 80-84 36.2846 37.0 37.0 37.0 37.0 37.0 85-89 36.2664 37.0 37.0 37.0 37.0 37.0 90-94 36.2347 37.0 37.0 37.0 37.0 37.0 95-99 36.1707 37.0 37.0 37.0 37.0 37.0 100-104 36.19590000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.1933 37.0 37.0 37.0 37.0 37.0 110-114 36.1593 37.0 37.0 37.0 37.0 37.0 115-119 36.1512 37.0 37.0 37.0 37.0 37.0 120-124 36.033699999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0438 37.0 37.0 37.0 37.0 37.0 130-134 36.0376 37.0 37.0 37.0 37.0 37.0 135-139 35.9945 37.0 37.0 37.0 37.0 37.0 140-144 35.85170000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.7832 37.0 37.0 37.0 37.0 37.0 150-151 35.548 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 2.0 26 2.0 27 9.0 28 11.0 29 19.0 30 32.0 31 34.0 32 43.0 33 68.0 34 104.0 35 270.0 36 3031.0 37 372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.025 12.125 6.1 36.75 2 20.090293453724605 12.515675946827187 35.31477301228994 32.07925758715827 3 16.3 15.024999999999999 28.425 40.25 4 20.724999999999998 22.95 25.5 30.825000000000003 5 24.125 30.25 24.15 21.475 6 22.125 32.875 24.125 20.875 7 15.950000000000001 26.75 40.275 17.025000000000002 8 17.45 27.125 31.775 23.65 9 17.95 23.75 34.375 23.925 10-14 19.73 29.205 27.985 23.080000000000002 15-19 19.255 28.4 27.935 24.41 20-24 20.025000000000002 27.71 28.83 23.435 25-29 20.485 28.17 27.35 23.995 30-34 20.3 28.28 27.800000000000004 23.62 35-39 19.825 28.134999999999998 28.275 23.765 40-44 20.665 28.110000000000003 27.79 23.435 45-49 19.985 28.425 27.685 23.905 50-54 20.419999999999998 28.48 27.544999999999998 23.555 55-59 20.49 28.294999999999998 27.555000000000003 23.66 60-64 20.34 27.96 27.43 24.27 65-69 20.265 27.685 28.15 23.9 70-74 20.474999999999998 27.815 28.23 23.48 75-79 20.0 28.355000000000004 27.18 24.465 80-84 20.549999999999997 28.305000000000003 27.339999999999996 23.805 85-89 20.919999999999998 27.98 27.889999999999997 23.21 90-94 20.96 27.83 28.349999999999998 22.86 95-99 20.810000000000002 27.92 27.805000000000003 23.465 100-104 21.349999999999998 27.195000000000004 28.025 23.43 105-109 20.625 27.334999999999997 28.134999999999998 23.905 110-114 20.64 28.349999999999998 27.99 23.02 115-119 21.065 28.265 27.189999999999998 23.48 120-124 21.22 28.51 26.919999999999998 23.35 125-129 21.175 27.950000000000003 27.375 23.5 130-134 20.97 28.075 26.895000000000003 24.060000000000002 135-139 20.974999999999998 27.834999999999997 27.189999999999998 24.0 140-144 21.85 28.395 26.655 23.1 145-149 20.97 27.72 26.900000000000002 24.41 150-151 20.625 28.6125 26.2875 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 3.0 25 3.5 26 4.5 27 7.0 28 7.5 29 10.5 30 14.5 31 17.0 32 25.0 33 33.5 34 43.0 35 67.0 36 85.0 37 97.5 38 129.0 39 156.5 40 178.5 41 211.0 42 240.0 43 254.0 44 267.5 45 281.5 46 271.5 47 255.0 48 244.0 49 206.5 50 172.5 51 151.5 52 122.0 53 100.0 54 73.0 55 55.5 56 48.5 57 39.5 58 33.0 59 28.0 60 22.0 61 10.0 62 3.5 63 4.5 64 4.5 65 2.5 66 3.5 67 3.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.68257431142624 84.05 2 7.553858740114536 13.850000000000001 3 0.763566948459231 2.1 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.425 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.9875 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.3375000000000004 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.5 0.0 0.0 0.0 0.0 124-125 4.9125 0.0 0.0 0.0 0.0 126-127 5.5 0.0 0.0 0.0 0.0 128-129 6.025 0.0 0.0 0.0 0.0 130-131 6.6375 0.0 0.0 0.0 0.0 132-133 7.1375 0.0 0.0 0.0 0.0 134-135 7.625 0.0 0.0 0.0 0.0 136-137 8.2375 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGATATC 10 0.006830828 145.0 145 TATGATT 10 0.006830828 145.0 6 ATATGAT 10 0.006830828 145.0 5 GGAATGA 10 0.006830828 145.0 5 CAGGAAT 10 0.006830828 145.0 3 CATATGA 10 0.006830828 145.0 4 >>END_MODULE SRR12690154 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690154_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.438 37.0 37.0 37.0 37.0 37.0 2 36.2085 37.0 37.0 37.0 37.0 37.0 3 36.1915 37.0 37.0 37.0 37.0 37.0 4 36.215 37.0 37.0 37.0 37.0 37.0 5 36.315 37.0 37.0 37.0 37.0 37.0 6 36.207 37.0 37.0 37.0 37.0 37.0 7 36.2305 37.0 37.0 37.0 37.0 37.0 8 36.37 37.0 37.0 37.0 37.0 37.0 9 36.357 37.0 37.0 37.0 37.0 37.0 10-14 36.288 37.0 37.0 37.0 37.0 37.0 15-19 36.2213 37.0 37.0 37.0 37.0 37.0 20-24 36.2288 37.0 37.0 37.0 37.0 37.0 25-29 36.2242 37.0 37.0 37.0 37.0 37.0 30-34 36.212900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.1254 37.0 37.0 37.0 37.0 37.0 40-44 36.0683 37.0 37.0 37.0 37.0 37.0 45-49 36.106700000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.061400000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.032700000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.0022 37.0 37.0 37.0 37.0 37.0 65-69 36.0062 37.0 37.0 37.0 37.0 37.0 70-74 35.9434 37.0 37.0 37.0 37.0 37.0 75-79 35.928399999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.938199999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.9169 37.0 37.0 37.0 37.0 37.0 90-94 35.7818 37.0 37.0 37.0 37.0 37.0 95-99 35.8411 37.0 37.0 37.0 37.0 37.0 100-104 35.9065 37.0 37.0 37.0 37.0 37.0 105-109 35.8738 37.0 37.0 37.0 37.0 37.0 110-114 35.79189999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.7583 37.0 37.0 37.0 37.0 37.0 120-124 35.6684 37.0 37.0 37.0 37.0 37.0 125-129 35.5909 37.0 37.0 37.0 37.0 37.0 130-134 35.5084 37.0 37.0 37.0 37.0 37.0 135-139 35.4447 37.0 37.0 37.0 37.0 37.0 140-144 35.379999999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.1908 37.0 37.0 37.0 29.8 37.0 150-151 34.764250000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 7.0 14 7.0 15 4.0 16 0.0 17 1.0 18 1.0 19 0.0 20 3.0 21 5.0 22 2.0 23 9.0 24 7.0 25 6.0 26 7.0 27 10.0 28 13.0 29 13.0 30 20.0 31 30.0 32 51.0 33 81.0 34 191.0 35 499.0 36 2751.0 37 280.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.300000000000004 25.674999999999997 9.700000000000001 25.324999999999996 2 27.175 28.749999999999996 28.050000000000004 16.025 3 20.775 28.449999999999996 32.4 18.375 4 24.175 34.949999999999996 22.725 18.15 5 25.025 36.975 21.099999999999998 16.900000000000002 6 20.424999999999997 40.400000000000006 21.0 18.175 7 20.424999999999997 24.099999999999998 36.5 18.975 8 22.0 27.075 26.35 24.575 9 21.224999999999998 26.05 29.675 23.05 10-14 23.630000000000003 30.020000000000003 25.779999999999998 20.57 15-19 23.085 28.985 26.43 21.5 20-24 22.86 28.83 26.91 21.4 25-29 22.720000000000002 28.42 27.36 21.5 30-34 22.5 28.249999999999996 28.515 20.735 35-39 23.494999999999997 28.395 26.69 21.42 40-44 22.650000000000002 28.895 27.27 21.185000000000002 45-49 22.81 28.71 27.315 21.165 50-54 23.11 28.849999999999998 27.224999999999998 20.815 55-59 23.565 27.665 28.000000000000004 20.77 60-64 22.78 28.810000000000002 27.37 21.04 65-69 22.939999999999998 28.134999999999998 27.955000000000002 20.97 70-74 23.445 28.365000000000002 26.900000000000002 21.29 75-79 23.305 27.665 27.700000000000003 21.33 80-84 22.715 28.694999999999997 27.200000000000003 21.39 85-89 24.265 27.334999999999997 27.43 20.97 90-94 23.91 28.48 27.034999999999997 20.575 95-99 23.685000000000002 27.82 27.339999999999996 21.154999999999998 100-104 23.474999999999998 28.555000000000003 27.055 20.915 105-109 24.01 27.810000000000002 27.425 20.755000000000003 110-114 24.04 27.925 27.51 20.525 115-119 23.715 27.98 27.36 20.945 120-124 24.775 28.17 27.12 19.935 125-129 24.11 27.71 27.279999999999998 20.9 130-134 25.115 27.76 26.77 20.355 135-139 24.815 28.53 26.75 19.905 140-144 25.035 27.765 26.965 20.235 145-149 26.045 28.345 26.085 19.525000000000002 150-151 25.7625 28.237499999999997 26.724999999999998 19.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 1.5 10 1.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 2.5 21 2.0 22 1.0 23 2.0 24 2.5 25 2.0 26 1.0 27 2.5 28 4.5 29 9.5 30 13.5 31 17.5 32 19.5 33 26.0 34 44.5 35 75.5 36 99.5 37 118.0 38 139.5 39 162.0 40 184.0 41 213.5 42 236.5 43 248.0 44 271.0 45 286.5 46 280.5 47 253.0 48 230.0 49 210.0 50 188.5 51 155.5 52 108.5 53 84.0 54 71.0 55 50.5 56 40.5 57 38.0 58 24.5 59 16.0 60 15.5 61 9.5 62 5.5 63 3.5 64 4.0 65 2.5 66 0.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 1.0 73 1.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.72131147540983 83.92500000000001 2 7.377049180327869 13.5 3 0.8469945355191256 2.325 4 0.0 0.0 5 0.0546448087431694 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.425 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.9875 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.6 0.0 0.0 0.0 0.0 114-115 3.0250000000000004 0.0 0.0 0.0 0.0 116-117 3.3125 0.0 0.0 0.0 0.0 118-119 3.6500000000000004 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.5 0.0 0.0 0.0 0.0 124-125 4.925 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 6.025 0.0 0.0 0.0 0.0 130-131 6.6375 0.0 0.0 0.0 0.0 132-133 7.1375 0.0 0.0 0.0 0.0 134-135 7.612500000000001 0.0 0.0 0.0 0.0 136-137 8.25 0.0 0.0 0.0 0.0 138-139 8.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCCT 10 0.006830828 145.0 3 GTTACTC 10 0.006830828 145.0 8 >>END_MODULE Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627739 spots for SRR12690154.sra Written 627739 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra Read 627733 spots for SRR12690154.sra Written 627733 spots for SRR12690154.sra SRR ids: ['SRR12690154.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n2giltaa SRR12690154.sra spots: 12554666 blocks: [[1, 627733], [627734, 1255466], [1255467, 1883199], [1883200, 2510932], [2510933, 3138665], [3138666, 3766398], [3766399, 4394131], [4394132, 5021864], [5021865, 5649597], [5649598, 6277330], [6277331, 6905063], [6905064, 7532796], [7532797, 8160529], [8160530, 8788262], [8788263, 9415995], [9415996, 10043728], [10043729, 10671461], [10671462, 11299194], [11299195, 11926927], [11926928, 12554666]] SRR12690154 file size 4244924 SRR12690154 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690154 SRR12690154_1.fastq SRR12690154_2.fastq Input file: SRR12690154_1.fastq Paired file: SRR12690154_2.fastq trimmed: SRR12690154-trimmed-pair1.fastq, SRR12690154-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 12:34:03 2025 >> started Thu Apr 10 12:34:26 2025 >> done (22.754s) 12554666 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 17735 ( 0.14%) empty read pairs filtered out after trimming by size control 12536904 (99.86%) read pairs available; of these: 1645235 (13.12%) trimmed read pairs available after processing 10891669 (86.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 4 0.00% 21 8 0.00% 22 9 0.00% 23 9 0.00% 24 12 0.00% 25 17 0.00% 26 14 0.00% 27 23 0.00% 28 20 0.00% 29 20 0.00% 30 18 0.00% 31 20 0.00% 32 28 0.00% 33 14 0.00% 34 20 0.00% 35 25 0.00% 36 33 0.00% 37 29 0.00% 38 24 0.00% 39 32 0.00% 40 21 0.00% 41 27 0.00% 42 44 0.00% 43 26 0.00% 44 38 0.00% 45 41 0.00% 46 35 0.00% 47 46 0.00% 48 52 0.00% 49 67 0.00% 50 77 0.00% 51 62 0.00% 52 81 0.00% 53 90 0.00% 54 92 0.00% 55 91 0.00% 56 120 0.00% 57 140 0.00% 58 153 0.00% 59 166 0.00% 60 212 0.00% 61 244 0.00% 62 292 0.00% 63 328 0.00% 64 325 0.00% 65 361 0.00% 66 408 0.00% 67 498 0.00% 68 572 0.00% 69 554 0.00% 70 703 0.01% 71 869 0.01% 72 884 0.01% 73 976 0.01% 74 1112 0.01% 75 1281 0.01% 76 1411 0.01% 77 1561 0.01% 78 1746 0.01% 79 1957 0.02% 80 2134 0.02% 81 2386 0.02% 82 2821 0.02% 83 3145 0.03% 84 3266 0.03% 85 3676 0.03% 86 4111 0.03% 87 4412 0.04% 88 4771 0.04% 89 5143 0.04% 90 5759 0.05% 91 6133 0.05% 92 6536 0.05% 93 7099 0.06% 94 7821 0.06% 95 8578 0.07% 96 9132 0.07% 97 9587 0.08% 98 10077 0.08% 99 10509 0.08% 100 11207 0.09% 101 11760 0.09% 102 12572 0.10% 103 13283 0.11% 104 14375 0.11% 105 14779 0.12% 106 15526 0.12% 107 16234 0.13% 108 16566 0.13% 109 17188 0.14% 110 18092 0.14% 111 18563 0.15% 112 19571 0.16% 113 19948 0.16% 114 20863 0.17% 115 21903 0.17% 116 22713 0.18% 117 23695 0.19% 118 24194 0.19% 119 24887 0.20% 120 25952 0.21% 121 26609 0.21% 122 27079 0.22% 123 27955 0.22% 124 29656 0.24% 125 29452 0.23% 126 30612 0.24% 127 31521 0.25% 128 31850 0.25% 129 32686 0.26% 130 33874 0.27% 131 33640 0.27% 132 34808 0.28% 133 35992 0.29% 134 36482 0.29% 135 37463 0.30% 136 37936 0.30% 137 38771 0.31% 138 39496 0.32% 139 40379 0.32% 140 40713 0.32% 141 41478 0.33% 142 42201 0.34% 143 43087 0.34% 144 44034 0.35% 145 44800 0.36% 146 45517 0.36% 147 46029 0.37% 148 46724 0.37% 149 47014 0.38% 150 48260 0.38% 151 10891669 86.88% 12536904 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=19 prefix-density=0.41 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.14 sequence-density-rank=19 fanout-score=11.12 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=5.8 sequence=TTTCTCAATTTG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=35 prefix-density=0.31 prefix-fanout=2.0 sequence=TCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=73.48 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.8 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTT SRR12690154 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 12:35:11 Started mapping on | Apr 10 12:35:12 Finished on | Apr 10 12:37:05 Mapping speed, Million of reads per hour | 399.41 Number of input reads | 12536904 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11671625 Uniquely mapped reads % | 93.10% Average mapped length | 294.57 Number of splices: Total | 11272570 Number of splices: Annotated (sjdb) | 11013824 Number of splices: GT/AG | 11060723 Number of splices: GC/AG | 164191 Number of splices: AT/AC | 8624 Number of splices: Non-canonical | 39032 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423219 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 51191 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 442060 442060 442060 N_multimapping 423219 423219 423219 N_noFeature 350197 11535108 392933 N_ambiguous 182391 588 88258 UnstrandedReadsAssigned:11139037 PositiveStrandReadsAssigned:135929 NegativeStrandReadsAssigned:11190434 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690154 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690154-trimmed-pair1.fastq SRR12690154-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,536,904 reads, 11,240,405 reads pseudoaligned [quant] estimated average fragment length: 239.243 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR12690154.ke.tsv 34699 SRR12690154.se.tsv 87100 total ==> SRR12690154.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.76 380 16.8926 Potri.005G024800.1.v4.1 1035 796.757 199 19.7606 Potri.004G059700.1.v4.1 961 722.821 40 4.37826 Potri.007G009000.2.v4.1 1416 1177.76 0 0 Potri.003G141000.2.v4.1 2943 2704.76 364.598 10.665 Potri.016G087400.1.v4.1 270 86.6535 504.86 460.955 Potri.015G069301.1.v4.1 564 332.966 0 0 Potri.010G195200.1.v4.1 1773 1534.76 21 1.08256 Potri.012G127500.1.v4.1 977 738.792 804 86.1007 ==> SRR12690154.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 524 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 168 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 14 SRR12690154 completed mapping pipeline successfully