Starting /dee2/code/volunteer_pipeline.sh SRR12690155 current disk space = 3056603262976 free memory = 1087544956 SRR12690155 SRAfilesize 141778b5b40c906d173586f5d54f7b3e SRR12690155.sra SRR12690155.sra file validated SRR12690155 is paired end SRR12690155 is conventional basespace SRR12690155 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690155_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6485 37.0 37.0 37.0 37.0 37.0 2 36.31375 37.0 37.0 37.0 37.0 37.0 3 36.553 37.0 37.0 37.0 37.0 37.0 4 36.596 37.0 37.0 37.0 37.0 37.0 5 36.653 37.0 37.0 37.0 37.0 37.0 6 36.6395 37.0 37.0 37.0 37.0 37.0 7 36.469 37.0 37.0 37.0 37.0 37.0 8 36.6535 37.0 37.0 37.0 37.0 37.0 9 36.56 37.0 37.0 37.0 37.0 37.0 10-14 36.5782 37.0 37.0 37.0 37.0 37.0 15-19 36.5873 37.0 37.0 37.0 37.0 37.0 20-24 36.5364 37.0 37.0 37.0 37.0 37.0 25-29 36.543899999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.5222 37.0 37.0 37.0 37.0 37.0 35-39 36.4856 37.0 37.0 37.0 37.0 37.0 40-44 36.493 37.0 37.0 37.0 37.0 37.0 45-49 36.4405 37.0 37.0 37.0 37.0 37.0 50-54 36.435500000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.372600000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.4107 37.0 37.0 37.0 37.0 37.0 65-69 36.3847 37.0 37.0 37.0 37.0 37.0 70-74 36.3732 37.0 37.0 37.0 37.0 37.0 75-79 36.3171 37.0 37.0 37.0 37.0 37.0 80-84 36.2521 37.0 37.0 37.0 37.0 37.0 85-89 36.324600000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.2658 37.0 37.0 37.0 37.0 37.0 95-99 36.2985 37.0 37.0 37.0 37.0 37.0 100-104 36.2017 37.0 37.0 37.0 37.0 37.0 105-109 36.1434 37.0 37.0 37.0 37.0 37.0 110-114 36.1935 37.0 37.0 37.0 37.0 37.0 115-119 36.0917 37.0 37.0 37.0 37.0 37.0 120-124 36.071000000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.114 37.0 37.0 37.0 37.0 37.0 130-134 35.995099999999994 37.0 37.0 37.0 37.0 37.0 135-139 36.00099999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.8637 37.0 37.0 37.0 37.0 37.0 145-149 35.7553 37.0 37.0 37.0 37.0 37.0 150-151 35.67175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 4.0 27 7.0 28 7.0 29 19.0 30 22.0 31 35.0 32 47.0 33 64.0 34 106.0 35 300.0 36 3043.0 37 344.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.125 12.225 6.7250000000000005 40.925 2 19.81439678956609 13.46877351392024 36.242789064459494 30.474040632054177 3 16.725 16.05 28.749999999999996 38.475 4 21.15 23.275000000000002 25.874999999999996 29.7 5 23.400000000000002 30.55 23.875 22.175 6 20.849999999999998 34.300000000000004 24.65 20.200000000000003 7 16.075 25.2 40.925 17.8 8 16.45 27.525 32.525 23.5 9 17.974999999999998 22.975 35.199999999999996 23.849999999999998 10-14 19.994999999999997 29.294999999999998 27.55 23.16 15-19 20.165 27.805000000000003 28.305000000000003 23.724999999999998 20-24 20.565 27.52 27.755000000000003 24.16 25-29 20.52 27.765 28.115000000000002 23.599999999999998 30-34 20.275000000000002 28.134999999999998 28.03 23.56 35-39 20.02 27.43 27.61 24.94 40-44 20.200000000000003 28.305000000000003 27.93 23.565 45-49 20.849999999999998 28.275 27.065 23.810000000000002 50-54 20.455000000000002 27.88 28.050000000000004 23.615 55-59 20.810000000000002 27.915 27.944999999999997 23.330000000000002 60-64 20.28 27.634999999999998 27.725 24.36 65-69 20.5 28.060000000000002 27.775 23.665 70-74 21.19 28.299999999999997 27.029999999999998 23.48 75-79 20.11 27.765 28.325 23.799999999999997 80-84 20.25 28.849999999999998 27.355 23.544999999999998 85-89 20.285 27.705000000000002 27.62 24.39 90-94 20.16 28.08 27.615000000000002 24.145 95-99 20.145 27.495000000000005 28.17 24.19 100-104 21.060000000000002 29.005 26.575 23.36 105-109 20.845 28.65 27.1 23.405 110-114 20.955 27.834999999999997 27.325 23.885 115-119 20.755000000000003 28.03 27.365000000000002 23.849999999999998 120-124 21.625 27.79 26.665 23.919999999999998 125-129 20.990000000000002 27.49 28.055000000000003 23.465 130-134 20.794999999999998 28.060000000000002 27.355 23.79 135-139 21.295 27.58 27.655 23.47 140-144 21.29 28.439999999999998 27.055 23.215 145-149 21.404999999999998 27.99 27.150000000000002 23.455000000000002 150-151 21.0125 27.462500000000002 26.825 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.5 24 2.5 25 2.5 26 5.0 27 6.0 28 7.5 29 12.0 30 14.5 31 16.0 32 22.0 33 34.5 34 53.5 35 72.0 36 86.5 37 97.5 38 114.0 39 137.0 40 165.5 41 198.5 42 223.5 43 249.0 44 273.0 45 284.0 46 264.5 47 245.0 48 250.5 49 223.0 50 184.5 51 178.0 52 142.5 53 102.0 54 80.5 55 62.5 56 53.5 57 40.0 58 30.0 59 22.5 60 19.0 61 11.0 62 3.5 63 2.0 64 1.5 65 1.0 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.06699751861042 82.575 2 7.912875654811138 14.35 3 0.7444168734491315 2.025 4 0.24813895781637718 0.8999999999999999 5 0.0 0.0 6 0.027570995312930797 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACAATCAATGTTGGAGGATCCATCCAATGGATCAAACACAACACAGT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 1.975 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.3625 0.0 0.0 0.0 0.0 122-123 2.725 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.8 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.7625 0.0 0.0 0.0 0.0 134-135 5.1 0.0 0.0 0.0 0.0 136-137 5.5625 0.0 0.0 0.0 0.0 138-139 5.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCGAT 10 0.006830828 145.0 1 TTAAGAG 10 0.006830828 145.0 5 >>END_MODULE SRR12690155 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690155_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.216 37.0 37.0 37.0 37.0 37.0 2 36.1225 37.0 37.0 37.0 37.0 37.0 3 36.0275 37.0 37.0 37.0 37.0 37.0 4 36.353 37.0 37.0 37.0 37.0 37.0 5 36.091 37.0 37.0 37.0 37.0 37.0 6 36.171 37.0 37.0 37.0 37.0 37.0 7 36.2655 37.0 37.0 37.0 37.0 37.0 8 36.2095 37.0 37.0 37.0 37.0 37.0 9 36.339 37.0 37.0 37.0 37.0 37.0 10-14 36.2947 37.0 37.0 37.0 37.0 37.0 15-19 36.264599999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.218900000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1557 37.0 37.0 37.0 37.0 37.0 30-34 36.1865 37.0 37.0 37.0 37.0 37.0 35-39 36.1728 37.0 37.0 37.0 37.0 37.0 40-44 36.1149 37.0 37.0 37.0 37.0 37.0 45-49 36.1464 37.0 37.0 37.0 37.0 37.0 50-54 36.1183 37.0 37.0 37.0 37.0 37.0 55-59 36.0984 37.0 37.0 37.0 37.0 37.0 60-64 36.045500000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.9728 37.0 37.0 37.0 37.0 37.0 70-74 35.9331 37.0 37.0 37.0 37.0 37.0 75-79 35.9893 37.0 37.0 37.0 37.0 37.0 80-84 35.9698 37.0 37.0 37.0 37.0 37.0 85-89 35.907 37.0 37.0 37.0 37.0 37.0 90-94 35.804500000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.87660000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.8821 37.0 37.0 37.0 37.0 37.0 105-109 35.887699999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.8693 37.0 37.0 37.0 37.0 37.0 115-119 35.68470000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.631 37.0 37.0 37.0 37.0 37.0 125-129 35.642700000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.590999999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.5766 37.0 37.0 37.0 37.0 37.0 140-144 35.5032 37.0 37.0 37.0 37.0 37.0 145-149 35.3614 37.0 37.0 37.0 32.2 37.0 150-151 34.908 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 4.0 22 2.0 23 5.0 24 4.0 25 6.0 26 9.0 27 13.0 28 22.0 29 26.0 30 31.0 31 32.0 32 72.0 33 88.0 34 182.0 35 530.0 36 2700.0 37 268.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.275 23.974999999999998 10.075000000000001 27.675 2 26.6 29.275000000000002 28.749999999999996 15.375 3 19.925 27.925 31.3 20.849999999999998 4 23.05 33.575 24.775 18.6 5 25.424999999999997 37.574999999999996 21.8 15.2 6 21.349999999999998 39.300000000000004 21.6 17.75 7 19.825 24.6 36.85 18.725 8 21.65 26.1 27.775 24.474999999999998 9 21.099999999999998 24.825 30.675 23.400000000000002 10-14 23.150000000000002 29.34 26.450000000000003 21.060000000000002 15-19 22.264999999999997 28.349999999999998 27.815 21.57 20-24 22.975 28.53 27.779999999999998 20.715 25-29 22.14 29.075 27.955000000000002 20.830000000000002 30-34 22.5 28.24 28.12 21.14 35-39 22.305 28.815 27.74 21.14 40-44 22.31 28.395 27.825 21.47 45-49 22.45 28.255000000000003 28.199999999999996 21.095 50-54 22.905 28.185 27.96 20.95 55-59 23.015 27.845 27.67 21.47 60-64 23.745 27.500000000000004 27.400000000000002 21.355 65-69 22.32 28.16 27.905 21.615000000000002 70-74 22.97 27.305 28.185 21.54 75-79 23.195 28.294999999999998 27.455000000000002 21.055 80-84 23.36 27.975 27.095000000000002 21.57 85-89 23.34 28.04 27.345000000000002 21.275 90-94 23.724999999999998 27.555000000000003 27.345000000000002 21.375 95-99 23.055 28.13 27.029999999999998 21.785 100-104 23.244999999999997 28.285 27.310000000000002 21.16 105-109 22.805 27.99 28.15 21.055 110-114 23.385 27.77 27.57 21.275 115-119 23.365 27.46 27.700000000000003 21.475 120-124 23.075000000000003 28.660000000000004 27.555000000000003 20.71 125-129 25.39 27.48 26.700000000000003 20.43 130-134 23.815 28.345 27.13 20.71 135-139 24.555 27.650000000000002 27.02 20.775 140-144 24.525 27.775 27.205000000000002 20.495 145-149 24.945 27.310000000000002 27.089999999999996 20.655 150-151 25.0625 27.400000000000002 27.85 19.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 1.5 19 2.0 20 1.0 21 2.0 22 2.5 23 3.0 24 3.0 25 3.5 26 4.0 27 3.5 28 9.5 29 12.5 30 13.5 31 16.5 32 22.0 33 30.0 34 42.5 35 68.0 36 95.5 37 109.5 38 135.0 39 161.0 40 192.5 41 244.0 42 251.5 43 246.5 44 266.0 45 264.0 46 246.0 47 256.5 48 264.0 49 221.0 50 170.5 51 143.0 52 106.0 53 78.0 54 76.5 55 65.0 56 47.0 57 37.0 58 25.5 59 16.5 60 13.5 61 9.0 62 4.0 63 2.0 64 1.0 65 0.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.23098201936376 82.45 2 7.524204702627939 13.600000000000001 3 0.8575380359612725 2.325 4 0.2766251728907331 1.0 5 0.05532503457814661 0.25 6 0.027662517289073305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027662517289073305 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 9 0.22499999999999998 No Hit GGATCACGCAGCAGATGCTCACAGGACGGACCTGATGACCATAACGAGGT 6 0.15 No Hit AGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATT 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.0250000000000004 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.775 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.45 0.0 0.0 0.0 0.0 128-129 3.8499999999999996 0.0 0.0 0.0 0.0 130-131 4.262499999999999 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.175 0.0 0.0 0.0 0.0 136-137 5.612500000000001 0.0 0.0 0.0 0.0 138-139 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 50 5.60876E-5 20.3 55-59 >>END_MODULE Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754318 spots for SRR12690155.sra Written 754318 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra Read 754313 spots for SRR12690155.sra Written 754313 spots for SRR12690155.sra SRR ids: ['SRR12690155.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kup0zsb3 SRR12690155.sra spots: 15086265 blocks: [[1, 754313], [754314, 1508626], [1508627, 2262939], [2262940, 3017252], [3017253, 3771565], [3771566, 4525878], [4525879, 5280191], [5280192, 6034504], [6034505, 6788817], [6788818, 7543130], [7543131, 8297443], [8297444, 9051756], [9051757, 9806069], [9806070, 10560382], [10560383, 11314695], [11314696, 12069008], [12069009, 12823321], [12823322, 13577634], [13577635, 14331947], [14331948, 15086265]] SRR12690155 file size 5105272 SRR12690155 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690155 SRR12690155_1.fastq SRR12690155_2.fastq Input file: SRR12690155_1.fastq Paired file: SRR12690155_2.fastq trimmed: SRR12690155-trimmed-pair1.fastq, SRR12690155-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:39:28 2025 >> started Mon Feb 10 19:39:45 2025 >> done (17.162s) 15086265 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 1793 ( 0.01%) empty read pairs filtered out after trimming by size control 15084449 (99.99%) read pairs available; of these: 1472967 ( 9.76%) trimmed read pairs available after processing 13611482 (90.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 4 0.00% 22 11 0.00% 23 8 0.00% 24 5 0.00% 25 9 0.00% 26 12 0.00% 27 14 0.00% 28 17 0.00% 29 17 0.00% 30 18 0.00% 31 12 0.00% 32 11 0.00% 33 18 0.00% 34 13 0.00% 35 18 0.00% 36 29 0.00% 37 20 0.00% 38 21 0.00% 39 17 0.00% 40 19 0.00% 41 28 0.00% 42 29 0.00% 43 28 0.00% 44 28 0.00% 45 26 0.00% 46 31 0.00% 47 39 0.00% 48 44 0.00% 49 52 0.00% 50 56 0.00% 51 60 0.00% 52 71 0.00% 53 76 0.00% 54 73 0.00% 55 66 0.00% 56 87 0.00% 57 100 0.00% 58 112 0.00% 59 152 0.00% 60 153 0.00% 61 173 0.00% 62 213 0.00% 63 199 0.00% 64 252 0.00% 65 228 0.00% 66 305 0.00% 67 306 0.00% 68 364 0.00% 69 427 0.00% 70 496 0.00% 71 579 0.00% 72 663 0.00% 73 741 0.00% 74 796 0.01% 75 846 0.01% 76 956 0.01% 77 1122 0.01% 78 1211 0.01% 79 1437 0.01% 80 1498 0.01% 81 1751 0.01% 82 1902 0.01% 83 2175 0.01% 84 2488 0.02% 85 2818 0.02% 86 2988 0.02% 87 3194 0.02% 88 3517 0.02% 89 3732 0.02% 90 4312 0.03% 91 4678 0.03% 92 4836 0.03% 93 5474 0.04% 94 5979 0.04% 95 6331 0.04% 96 6856 0.05% 97 7352 0.05% 98 7768 0.05% 99 8348 0.06% 100 8877 0.06% 101 9213 0.06% 102 9965 0.07% 103 10385 0.07% 104 11036 0.07% 105 11761 0.08% 106 12120 0.08% 107 12880 0.09% 108 13344 0.09% 109 14230 0.09% 110 14891 0.10% 111 15259 0.10% 112 15825 0.10% 113 16656 0.11% 114 17480 0.12% 115 18092 0.12% 116 19093 0.13% 117 20070 0.13% 118 20792 0.14% 119 21092 0.14% 120 22061 0.15% 121 22683 0.15% 122 23649 0.16% 123 24538 0.16% 124 25399 0.17% 125 25683 0.17% 126 27245 0.18% 127 27717 0.18% 128 28927 0.19% 129 29603 0.20% 130 30150 0.20% 131 31244 0.21% 132 32033 0.21% 133 33118 0.22% 134 33585 0.22% 135 34420 0.23% 136 35155 0.23% 137 36256 0.24% 138 37299 0.25% 139 38504 0.26% 140 38945 0.26% 141 40188 0.27% 142 41442 0.27% 143 41686 0.28% 144 42660 0.28% 145 43965 0.29% 146 44543 0.30% 147 44980 0.30% 148 46704 0.31% 149 46484 0.31% 150 48120 0.32% 151 13611482 90.24% 15084449 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=9 prefix-density=0.74 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=12.00 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=3.5 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=22 prefix-density=1.01 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.23 sequence-density-rank=24 fanout-score=18.16 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=5.0 sequence=AATGGCAGCCTCAGT SRR12690155 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:40:32 Started mapping on | Feb 10 19:40:32 Finished on | Feb 10 19:42:24 Mapping speed, Million of reads per hour | 484.86 Number of input reads | 15084449 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14313369 Uniquely mapped reads % | 94.89% Average mapped length | 296.49 Number of splices: Total | 14936698 Number of splices: Annotated (sjdb) | 14643326 Number of splices: GT/AG | 14619684 Number of splices: GC/AG | 264167 Number of splices: AT/AC | 7798 Number of splices: Non-canonical | 45049 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.17 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360439 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 42327 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.34% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 410641 410641 410641 N_multimapping 360439 360439 360439 N_noFeature 491965 14131164 543098 N_ambiguous 228391 692 96997 UnstrandedReadsAssigned:13593013 PositiveStrandReadsAssigned:181513 NegativeStrandReadsAssigned:13673274 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690155 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690155-trimmed-pair1.fastq SRR12690155-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,084,449 reads, 13,632,941 reads pseudoaligned [quant] estimated average fragment length: 252.642 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR12690155.ke.tsv 34699 SRR12690155.se.tsv 87100 total ==> SRR12690155.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.36 270 9.66999 Potri.005G024800.1.v4.1 1035 783.358 246 19.8663 Potri.004G059700.1.v4.1 961 709.475 1 0.0891669 Potri.007G009000.2.v4.1 1416 1164.36 0 0 Potri.003G141000.2.v4.1 2943 2691.36 500.521 11.765 Potri.016G087400.1.v4.1 270 80.9421 467.586 365.45 Potri.015G069301.1.v4.1 564 323.659 0 0 Potri.010G195200.1.v4.1 1773 1521.36 16 0.665318 Potri.012G127500.1.v4.1 977 725.378 84 7.32582 ==> SRR12690155.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 171 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 17 SRR12690155 completed mapping pipeline successfully