Starting /dee2/code/volunteer_pipeline.sh SRR12690156 current disk space = 3056724418560 free memory = 1329471564 SRR12690156 SRAfilesize d8480cd1215f8df03d6dc5625aa4f814 SRR12690156.sra SRR12690156.sra file validated SRR12690156 is paired end SRR12690156 is conventional basespace SRR12690156 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690156_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5735 37.0 37.0 37.0 37.0 37.0 2 36.41675 37.0 37.0 37.0 37.0 37.0 3 36.6005 37.0 37.0 37.0 37.0 37.0 4 36.5735 37.0 37.0 37.0 37.0 37.0 5 36.606 37.0 37.0 37.0 37.0 37.0 6 36.494 37.0 37.0 37.0 37.0 37.0 7 36.4555 37.0 37.0 37.0 37.0 37.0 8 36.5125 37.0 37.0 37.0 37.0 37.0 9 36.648 37.0 37.0 37.0 37.0 37.0 10-14 36.5991 37.0 37.0 37.0 37.0 37.0 15-19 36.577600000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5543 37.0 37.0 37.0 37.0 37.0 25-29 36.5544 37.0 37.0 37.0 37.0 37.0 30-34 36.503499999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.5044 37.0 37.0 37.0 37.0 37.0 40-44 36.4539 37.0 37.0 37.0 37.0 37.0 45-49 36.456399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.428599999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3991 37.0 37.0 37.0 37.0 37.0 60-64 36.3574 37.0 37.0 37.0 37.0 37.0 65-69 36.3526 37.0 37.0 37.0 37.0 37.0 70-74 36.3438 37.0 37.0 37.0 37.0 37.0 75-79 36.3317 37.0 37.0 37.0 37.0 37.0 80-84 36.236000000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.3061 37.0 37.0 37.0 37.0 37.0 90-94 36.2553 37.0 37.0 37.0 37.0 37.0 95-99 36.1891 37.0 37.0 37.0 37.0 37.0 100-104 36.138200000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.074 37.0 37.0 37.0 37.0 37.0 110-114 36.0866 37.0 37.0 37.0 37.0 37.0 115-119 36.0757 37.0 37.0 37.0 37.0 37.0 120-124 35.988299999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0123 37.0 37.0 37.0 37.0 37.0 130-134 35.9885 37.0 37.0 37.0 37.0 37.0 135-139 35.9855 37.0 37.0 37.0 37.0 37.0 140-144 35.773300000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.791399999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.646 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 2.0 25 5.0 26 4.0 27 4.0 28 12.0 29 10.0 30 21.0 31 32.0 32 57.0 33 58.0 34 121.0 35 343.0 36 2993.0 37 336.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.699999999999996 10.674999999999999 6.65 39.975 2 18.259342864309005 14.120892901931276 36.669174818159014 30.950589415600703 3 17.65 16.275000000000002 29.299999999999997 36.775000000000006 4 22.175 24.525 25.15 28.15 5 24.4 30.275000000000002 24.5 20.825 6 20.5 33.475 24.85 21.175 7 16.075 27.450000000000003 40.125 16.35 8 19.175 26.375 31.175000000000004 23.275000000000002 9 17.8 23.35 35.925000000000004 22.925 10-14 20.200000000000003 29.470000000000002 27.779999999999998 22.55 15-19 19.875 28.355000000000004 28.050000000000004 23.72 20-24 19.77 28.560000000000002 28.410000000000004 23.26 25-29 19.895 28.675 28.265 23.165 30-34 20.05 28.785 27.63 23.535 35-39 19.86 28.205000000000002 28.475 23.46 40-44 20.73 28.875 26.735 23.66 45-49 20.385 28.575 27.595 23.445 50-54 19.855 28.754999999999995 28.22 23.169999999999998 55-59 19.97 28.515 27.595 23.919999999999998 60-64 20.41 28.64 27.544999999999998 23.405 65-69 20.315 28.060000000000002 28.044999999999998 23.580000000000002 70-74 20.325 28.57 27.750000000000004 23.355 75-79 20.169999999999998 28.18 28.000000000000004 23.65 80-84 20.035 28.660000000000004 27.779999999999998 23.525 85-89 20.755000000000003 28.360000000000003 28.025 22.86 90-94 20.31 27.884999999999998 28.08 23.724999999999998 95-99 21.0 28.515 27.6 22.884999999999998 100-104 20.62 27.744999999999997 27.889999999999997 23.745 105-109 20.78 27.915 27.805000000000003 23.5 110-114 20.06 28.720000000000002 27.93 23.29 115-119 21.12 28.57 26.93 23.380000000000003 120-124 20.549999999999997 28.255000000000003 27.605 23.59 125-129 20.4 27.994999999999997 27.98 23.625 130-134 20.36 28.720000000000002 26.985 23.935000000000002 135-139 21.135 28.375 27.195000000000004 23.294999999999998 140-144 20.52 28.73 26.855 23.895 145-149 21.12 28.27 27.084999999999997 23.525 150-151 21.3125 28.875 26.5 23.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 3.0 23 3.0 24 2.0 25 2.5 26 4.5 27 6.5 28 9.0 29 9.5 30 15.5 31 26.0 32 35.5 33 49.0 34 64.0 35 72.5 36 90.5 37 110.0 38 130.0 39 180.0 40 209.5 41 218.5 42 228.5 43 249.0 44 258.0 45 243.0 46 255.0 47 250.0 48 230.0 49 213.5 50 176.5 51 132.0 52 109.5 53 100.5 54 76.0 55 56.5 56 48.0 57 29.5 58 21.0 59 29.0 60 19.5 61 7.0 62 6.5 63 5.5 64 3.5 65 2.5 66 2.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.78794642857143 80.45 2 8.984375 16.1 3 1.0602678571428572 2.85 4 0.16741071428571427 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.3499999999999996 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.325 0.0 0.0 0.0 0.0 132-133 4.85 0.0 0.0 0.0 0.0 134-135 5.375 0.0 0.0 0.0 0.0 136-137 6.0 0.0 0.0 0.0 0.0 138-139 6.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAAG 10 0.006830828 145.0 6 >>END_MODULE SRR12690156 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690156_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.201 37.0 37.0 37.0 37.0 37.0 2 36.0855 37.0 37.0 37.0 37.0 37.0 3 36.019 37.0 37.0 37.0 37.0 37.0 4 36.2105 37.0 37.0 37.0 37.0 37.0 5 36.3295 37.0 37.0 37.0 37.0 37.0 6 36.2105 37.0 37.0 37.0 37.0 37.0 7 36.252 37.0 37.0 37.0 37.0 37.0 8 36.2765 37.0 37.0 37.0 37.0 37.0 9 36.184 37.0 37.0 37.0 37.0 37.0 10-14 36.226800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2204 37.0 37.0 37.0 37.0 37.0 20-24 36.2285 37.0 37.0 37.0 37.0 37.0 25-29 36.1349 37.0 37.0 37.0 37.0 37.0 30-34 36.13719999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.107899999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.0546 37.0 37.0 37.0 37.0 37.0 45-49 36.076499999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.9649 37.0 37.0 37.0 37.0 37.0 55-59 36.016 37.0 37.0 37.0 37.0 37.0 60-64 35.983900000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.902300000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.893699999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.940000000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.9051 37.0 37.0 37.0 37.0 37.0 85-89 35.891000000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.775600000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8544 37.0 37.0 37.0 37.0 37.0 100-104 35.78660000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.8421 37.0 37.0 37.0 37.0 37.0 110-114 35.6276 37.0 37.0 37.0 37.0 37.0 115-119 35.62839999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.603899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.4783 37.0 37.0 37.0 34.6 37.0 130-134 35.4809 37.0 37.0 37.0 37.0 37.0 135-139 35.4364 37.0 37.0 37.0 34.6 37.0 140-144 35.404999999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.289 37.0 37.0 37.0 29.8 37.0 150-151 34.7975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 2.0 16 1.0 17 1.0 18 0.0 19 2.0 20 2.0 21 2.0 22 1.0 23 5.0 24 3.0 25 9.0 26 1.0 27 14.0 28 13.0 29 31.0 30 27.0 31 33.0 32 80.0 33 118.0 34 225.0 35 597.0 36 2563.0 37 267.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.675 24.099999999999998 9.575 25.650000000000002 2 27.800000000000004 27.6 29.275000000000002 15.325 3 18.6 29.975 31.8 19.625 4 23.175 35.225 23.599999999999998 18.0 5 24.224999999999998 36.725 22.3 16.75 6 20.175 39.574999999999996 21.775 18.475 7 19.975 21.95 38.475 19.6 8 20.724999999999998 25.874999999999996 28.825 24.575 9 20.674999999999997 26.55 29.675 23.1 10-14 22.58 30.259999999999998 26.46 20.7 15-19 23.189999999999998 28.055000000000003 27.689999999999998 21.065 20-24 22.16 28.294999999999998 28.09 21.455 25-29 22.745 29.255 27.084999999999997 20.915 30-34 22.205 28.83 28.49 20.474999999999998 35-39 22.205 28.599999999999998 27.985 21.21 40-44 22.314999999999998 28.494999999999997 28.525 20.665 45-49 22.25 28.225 28.215 21.310000000000002 50-54 22.625 28.225 28.194999999999997 20.955 55-59 22.915 27.805000000000003 28.29 20.990000000000002 60-64 22.525000000000002 28.555000000000003 27.944999999999997 20.974999999999998 65-69 22.5 27.860000000000003 27.91 21.73 70-74 22.145 28.21 28.205000000000002 21.44 75-79 22.68 28.060000000000002 28.444999999999997 20.815 80-84 22.975 27.815 27.565 21.645 85-89 22.994999999999997 27.55 28.68 20.775 90-94 23.215 27.435 27.815 21.535 95-99 23.22 27.715 28.044999999999998 21.02 100-104 23.02 28.095 27.455000000000002 21.43 105-109 22.955000000000002 28.035 27.994999999999997 21.015 110-114 23.565 28.215 27.32 20.9 115-119 23.465 28.13 27.71 20.695 120-124 23.775 27.534999999999997 27.46 21.23 125-129 24.095 28.605000000000004 26.900000000000002 20.4 130-134 24.51 27.57 27.705000000000002 20.215 135-139 24.395 27.834999999999997 27.544999999999998 20.225 140-144 24.490000000000002 28.255000000000003 26.96 20.294999999999998 145-149 25.240000000000002 28.205000000000002 26.645000000000003 19.91 150-151 25.5 27.737499999999997 27.474999999999998 19.287499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 1.0 16 1.5 17 1.5 18 1.5 19 1.0 20 1.5 21 2.0 22 2.5 23 4.0 24 3.0 25 2.0 26 5.5 27 10.0 28 13.0 29 14.5 30 16.0 31 26.0 32 43.5 33 47.5 34 50.0 35 72.5 36 104.5 37 122.5 38 133.0 39 161.0 40 209.5 41 246.0 42 247.5 43 236.5 44 251.5 45 265.0 46 263.0 47 245.0 48 206.5 49 171.0 50 159.0 51 151.5 52 124.5 53 100.5 54 70.5 55 52.0 56 46.5 57 33.0 58 17.5 59 15.5 60 11.5 61 5.5 62 8.0 63 6.5 64 3.5 65 1.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.025 #Duplication Level Percentage of deduplicated Percentage of total 1 90.30824770896973 81.3 2 8.5254096084421 15.35 3 0.9441821716189948 2.55 4 0.22216051096917525 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.8625 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.325 0.0 0.0 0.0 0.0 132-133 4.85 0.0 0.0 0.0 0.0 134-135 5.375 0.0 0.0 0.0 0.0 136-137 6.0 0.0 0.0 0.0 0.0 138-139 6.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAAAC 10 0.006830828 145.0 3 >>END_MODULE Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595675 spots for SRR12690156.sra Written 595675 spots for SRR12690156.sra Read 595677 spots for SRR12690156.sra Written 595677 spots for SRR12690156.sra SRR ids: ['SRR12690156.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0y7ce626 SRR12690156.sra spots: 11913502 blocks: [[1, 595675], [595676, 1191350], [1191351, 1787025], [1787026, 2382700], [2382701, 2978375], [2978376, 3574050], [3574051, 4169725], [4169726, 4765400], [4765401, 5361075], [5361076, 5956750], [5956751, 6552425], [6552426, 7148100], [7148101, 7743775], [7743776, 8339450], [8339451, 8935125], [8935126, 9530800], [9530801, 10126475], [10126476, 10722150], [10722151, 11317825], [11317826, 11913502]] SRR12690156 file size 4027028 SRR12690156 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690156 SRR12690156_1.fastq SRR12690156_2.fastq Input file: SRR12690156_1.fastq Paired file: SRR12690156_2.fastq trimmed: SRR12690156-trimmed-pair1.fastq, SRR12690156-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:29:40 2025 >> started Mon Feb 10 19:30:00 2025 >> done (20.209s) 11913502 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 1004 ( 0.01%) empty read pairs filtered out after trimming by size control 11912477 (99.99%) read pairs available; of these: 1290918 (10.84%) trimmed read pairs available after processing 10621559 (89.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 2 0.00% 21 7 0.00% 22 12 0.00% 23 4 0.00% 24 7 0.00% 25 15 0.00% 26 14 0.00% 27 8 0.00% 28 14 0.00% 29 14 0.00% 30 14 0.00% 31 15 0.00% 32 17 0.00% 33 18 0.00% 34 10 0.00% 35 16 0.00% 36 18 0.00% 37 18 0.00% 38 15 0.00% 39 16 0.00% 40 26 0.00% 41 18 0.00% 42 22 0.00% 43 14 0.00% 44 36 0.00% 45 34 0.00% 46 38 0.00% 47 48 0.00% 48 42 0.00% 49 42 0.00% 50 67 0.00% 51 51 0.00% 52 69 0.00% 53 63 0.00% 54 75 0.00% 55 81 0.00% 56 68 0.00% 57 115 0.00% 58 124 0.00% 59 135 0.00% 60 136 0.00% 61 161 0.00% 62 166 0.00% 63 209 0.00% 64 255 0.00% 65 236 0.00% 66 262 0.00% 67 281 0.00% 68 341 0.00% 69 372 0.00% 70 401 0.00% 71 464 0.00% 72 561 0.00% 73 658 0.01% 74 684 0.01% 75 791 0.01% 76 826 0.01% 77 935 0.01% 78 1021 0.01% 79 1214 0.01% 80 1414 0.01% 81 1473 0.01% 82 1725 0.01% 83 1879 0.02% 84 2157 0.02% 85 2344 0.02% 86 2625 0.02% 87 2909 0.02% 88 3143 0.03% 89 3442 0.03% 90 3751 0.03% 91 3943 0.03% 92 4368 0.04% 93 4801 0.04% 94 5170 0.04% 95 5715 0.05% 96 6113 0.05% 97 6463 0.05% 98 6824 0.06% 99 7131 0.06% 100 7820 0.07% 101 8251 0.07% 102 8984 0.08% 103 9160 0.08% 104 10083 0.08% 105 10323 0.09% 106 11170 0.09% 107 11496 0.10% 108 11939 0.10% 109 12497 0.10% 110 13123 0.11% 111 13731 0.12% 112 14406 0.12% 113 14791 0.12% 114 15609 0.13% 115 16630 0.14% 116 16834 0.14% 117 17880 0.15% 118 18583 0.16% 119 18941 0.16% 120 19509 0.16% 121 20376 0.17% 122 20927 0.18% 123 22053 0.19% 124 22577 0.19% 125 22778 0.19% 126 24256 0.20% 127 24723 0.21% 128 25687 0.22% 129 26389 0.22% 130 26973 0.23% 131 27852 0.23% 132 28199 0.24% 133 28910 0.24% 134 29528 0.25% 135 30774 0.26% 136 31007 0.26% 137 31744 0.27% 138 32281 0.27% 139 33464 0.28% 140 33662 0.28% 141 34359 0.29% 142 35293 0.30% 143 35483 0.30% 144 36517 0.31% 145 37976 0.32% 146 37776 0.32% 147 38788 0.33% 148 39802 0.33% 149 39754 0.33% 150 40457 0.34% 151 10621559 89.16% 11912477 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=22 prefix-density=0.48 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=12.70 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.7 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=23 prefix-density=0.65 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=39.67 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=2.6 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGG SRR12690156 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:30:48 Started mapping on | Feb 10 19:30:49 Finished on | Feb 10 19:32:09 Mapping speed, Million of reads per hour | 536.06 Number of input reads | 11912477 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11300198 Uniquely mapped reads % | 94.86% Average mapped length | 295.87 Number of splices: Total | 10979306 Number of splices: Annotated (sjdb) | 10713213 Number of splices: GT/AG | 10764074 Number of splices: GC/AG | 170007 Number of splices: AT/AC | 7778 Number of splices: Non-canonical | 37447 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266558 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 58061 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.30% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 345721 345721 345721 N_multimapping 266558 266558 266558 N_noFeature 519365 11173015 568852 N_ambiguous 146677 714 68545 UnstrandedReadsAssigned:10634156 PositiveStrandReadsAssigned:126469 NegativeStrandReadsAssigned:10662801 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690156 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690156-trimmed-pair1.fastq SRR12690156-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,912,477 reads, 10,659,495 reads pseudoaligned [quant] estimated average fragment length: 249.236 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR12690156.ke.tsv 34699 SRR12690156.se.tsv 87100 total ==> SRR12690156.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.76 386 20.2238 Potri.005G024800.1.v4.1 1035 786.764 179 21.096 Potri.004G059700.1.v4.1 961 712.854 33 4.29243 Potri.007G009000.2.v4.1 1416 1167.76 0 0 Potri.003G141000.2.v4.1 2943 2694.76 576 19.8195 Potri.016G087400.1.v4.1 270 83.1674 457 509.511 Potri.015G069301.1.v4.1 564 326.049 0 0 Potri.010G195200.1.v4.1 1773 1524.76 18 1.09461 Potri.012G127500.1.v4.1 977 728.804 74 9.4148 ==> SRR12690156.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 329 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 199 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 27 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12690156 completed mapping pipeline successfully