Starting /dee2/code/volunteer_pipeline.sh SRR12690157 current disk space = 3056897089536 free memory = 1143459748 SRR12690157 SRAfilesize ee466ecc99862688a3f1c5425240f5d6 SRR12690157.sra SRR12690157.sra file validated SRR12690157 is paired end SRR12690157 is conventional basespace SRR12690157 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690157_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6015 37.0 37.0 37.0 37.0 37.0 2 36.3365 37.0 37.0 37.0 37.0 37.0 3 36.581 37.0 37.0 37.0 37.0 37.0 4 36.604 37.0 37.0 37.0 37.0 37.0 5 36.663 37.0 37.0 37.0 37.0 37.0 6 36.5715 37.0 37.0 37.0 37.0 37.0 7 36.6035 37.0 37.0 37.0 37.0 37.0 8 36.6515 37.0 37.0 37.0 37.0 37.0 9 36.6895 37.0 37.0 37.0 37.0 37.0 10-14 36.6203 37.0 37.0 37.0 37.0 37.0 15-19 36.630700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.6053 37.0 37.0 37.0 37.0 37.0 25-29 36.5492 37.0 37.0 37.0 37.0 37.0 30-34 36.5501 37.0 37.0 37.0 37.0 37.0 35-39 36.551 37.0 37.0 37.0 37.0 37.0 40-44 36.5326 37.0 37.0 37.0 37.0 37.0 45-49 36.5036 37.0 37.0 37.0 37.0 37.0 50-54 36.4714 37.0 37.0 37.0 37.0 37.0 55-59 36.389500000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3909 37.0 37.0 37.0 37.0 37.0 65-69 36.3359 37.0 37.0 37.0 37.0 37.0 70-74 36.360800000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.350899999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3021 37.0 37.0 37.0 37.0 37.0 85-89 36.2697 37.0 37.0 37.0 37.0 37.0 90-94 36.2937 37.0 37.0 37.0 37.0 37.0 95-99 36.178200000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2123 37.0 37.0 37.0 37.0 37.0 105-109 36.187799999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1512 37.0 37.0 37.0 37.0 37.0 115-119 36.1406 37.0 37.0 37.0 37.0 37.0 120-124 35.956399999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0534 37.0 37.0 37.0 37.0 37.0 130-134 36.039300000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.942 37.0 37.0 37.0 37.0 37.0 140-144 35.7605 37.0 37.0 37.0 37.0 37.0 145-149 35.7435 37.0 37.0 37.0 37.0 37.0 150-151 35.668 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 3.0 26 1.0 27 2.0 28 14.0 29 12.0 30 18.0 31 35.0 32 48.0 33 71.0 34 108.0 35 299.0 36 3046.0 37 339.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.575 13.05 7.324999999999999 36.05 2 21.672526368658964 11.978905072827725 35.23355097940733 31.115017579105974 3 16.325 15.275 29.775000000000002 38.625 4 21.025 23.225 26.025 29.725 5 22.825 29.225 24.575 23.375 6 21.525 31.6 24.05 22.825 7 17.05 26.55 39.25 17.150000000000002 8 19.175 25.674999999999997 30.55 24.6 9 17.1 25.474999999999998 34.0 23.425 10-14 19.91 28.65 28.189999999999998 23.25 15-19 19.85 27.595 27.944999999999997 24.610000000000003 20-24 20.815 27.565 28.315 23.305 25-29 19.97 28.535 27.439999999999998 24.055 30-34 20.415 27.715 27.529999999999998 24.34 35-39 20.01 28.225 27.52 24.245 40-44 19.33 28.52 28.060000000000002 24.09 45-49 20.06 27.975 27.875 24.09 50-54 20.05 27.79 27.884999999999998 24.275 55-59 20.01 27.36 28.105000000000004 24.525 60-64 20.345 28.23 27.425 24.0 65-69 20.695 28.08 27.74 23.485 70-74 20.635 27.894999999999996 27.639999999999997 23.830000000000002 75-79 20.5 28.265 27.36 23.875 80-84 20.7 27.794999999999998 27.415 24.09 85-89 20.64 27.68 27.805000000000003 23.875 90-94 20.27 28.08 27.575 24.075 95-99 20.560000000000002 27.715 27.83 23.895 100-104 21.09 27.800000000000004 27.575 23.535 105-109 21.245 28.03 26.974999999999998 23.75 110-114 21.01 27.3 27.87 23.82 115-119 21.205 27.944999999999997 27.345000000000002 23.505000000000003 120-124 20.93 27.565 27.750000000000004 23.755000000000003 125-129 20.880000000000003 27.785 27.36 23.974999999999998 130-134 21.105 27.589999999999996 27.500000000000004 23.805 135-139 21.19 28.26 26.979999999999997 23.57 140-144 21.275 27.775 27.165 23.785 145-149 21.86 27.689999999999998 26.715 23.735 150-151 21.7875 28.125 25.825 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.0 25 2.0 26 3.0 27 2.5 28 4.0 29 8.0 30 10.5 31 14.5 32 26.0 33 35.0 34 51.0 35 62.0 36 72.0 37 107.5 38 134.5 39 152.0 40 181.0 41 201.5 42 230.5 43 248.0 44 243.5 45 267.5 46 271.0 47 244.0 48 236.0 49 226.5 50 209.5 51 166.5 52 124.5 53 106.0 54 82.0 55 68.5 56 53.5 57 41.0 58 34.5 59 24.0 60 14.5 61 7.0 62 6.0 63 7.0 64 4.0 65 3.0 66 4.0 67 2.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.325 #Duplication Level Percentage of deduplicated Percentage of total 1 91.86969614015878 83.89999999999999 2 7.090062961949083 12.950000000000001 3 0.7938680536545305 2.175 4 0.19162332329592116 0.7000000000000001 5 0.027374760470845878 0.125 6 0.027374760470845878 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTAGCTGTTGCTAGTTGCAGTGACAGAAGCTCCTCTTCAGGAATAA 6 0.15 No Hit GCTTGGCTGCTTTCTCGAAATCAGCCATTGTGATGGCAAGCTTTTCCATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8374999999999999 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.9875 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.925 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.85 0.0 0.0 0.0 0.0 132-133 5.2625 0.0 0.0 0.0 0.0 134-135 5.75 0.0 0.0 0.0 0.0 136-137 6.2125 0.0 0.0 0.0 0.0 138-139 6.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 20.714287 140-144 >>END_MODULE SRR12690157 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690157_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4385 37.0 37.0 37.0 37.0 37.0 2 36.2625 37.0 37.0 37.0 37.0 37.0 3 36.3515 37.0 37.0 37.0 37.0 37.0 4 36.4175 37.0 37.0 37.0 37.0 37.0 5 36.4145 37.0 37.0 37.0 37.0 37.0 6 36.304 37.0 37.0 37.0 37.0 37.0 7 36.4215 37.0 37.0 37.0 37.0 37.0 8 36.4 37.0 37.0 37.0 37.0 37.0 9 36.46 37.0 37.0 37.0 37.0 37.0 10-14 36.3526 37.0 37.0 37.0 37.0 37.0 15-19 36.3163 37.0 37.0 37.0 37.0 37.0 20-24 36.32470000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.28340000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.2629 37.0 37.0 37.0 37.0 37.0 35-39 36.270999999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.231899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2034 37.0 37.0 37.0 37.0 37.0 50-54 36.173500000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1868 37.0 37.0 37.0 37.0 37.0 60-64 36.13719999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.1497 37.0 37.0 37.0 37.0 37.0 70-74 36.047700000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.08710000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.114000000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.088300000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9735 37.0 37.0 37.0 37.0 37.0 95-99 36.03 37.0 37.0 37.0 37.0 37.0 100-104 36.0137 37.0 37.0 37.0 37.0 37.0 105-109 36.005900000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.922000000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.8798 37.0 37.0 37.0 37.0 37.0 120-124 35.7994 37.0 37.0 37.0 37.0 37.0 125-129 35.7375 37.0 37.0 37.0 37.0 37.0 130-134 35.7149 37.0 37.0 37.0 37.0 37.0 135-139 35.6677 37.0 37.0 37.0 37.0 37.0 140-144 35.5903 37.0 37.0 37.0 37.0 37.0 145-149 35.4572 37.0 37.0 37.0 34.6 37.0 150-151 35.00875 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 2.0 15 2.0 16 2.0 17 1.0 18 0.0 19 1.0 20 1.0 21 2.0 22 2.0 23 1.0 24 2.0 25 5.0 26 5.0 27 12.0 28 10.0 29 12.0 30 29.0 31 35.0 32 57.0 33 92.0 34 154.0 35 462.0 36 2814.0 37 293.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.25 25.25 11.25 25.25 2 28.499999999999996 27.650000000000002 27.725 16.125 3 21.7 28.925 31.674999999999997 17.7 4 23.849999999999998 33.625 23.150000000000002 19.375 5 25.15 36.625 21.575 16.650000000000002 6 21.3 38.875 22.05 17.775 7 20.75 23.225 37.724999999999994 18.3 8 20.875 26.700000000000003 27.0 25.424999999999997 9 22.375 24.925 29.5 23.200000000000003 10-14 23.155 30.209999999999997 25.71 20.925 15-19 22.830000000000002 28.749999999999996 26.735 21.685 20-24 22.875 28.23 27.384999999999998 21.51 25-29 23.125 29.29 26.68 20.905 30-34 22.78 28.08 27.169999999999998 21.97 35-39 22.795 28.360000000000003 27.6 21.245 40-44 22.865 28.544999999999998 27.025 21.565 45-49 23.1 28.65 26.665 21.584999999999997 50-54 22.64 28.499999999999996 27.555000000000003 21.305 55-59 23.105 27.544999999999998 27.265 22.085 60-64 23.345 27.700000000000003 27.229999999999997 21.725 65-69 23.11 27.395000000000003 27.805000000000003 21.69 70-74 22.965 27.805000000000003 27.515 21.715 75-79 23.66 27.935 26.97 21.435000000000002 80-84 23.835 27.67 27.27 21.224999999999998 85-89 23.145 28.08 26.915 21.86 90-94 23.244999999999997 28.425 26.840000000000003 21.490000000000002 95-99 23.474999999999998 27.67 27.150000000000002 21.705 100-104 23.24 27.875 27.26 21.625 105-109 23.565 27.615000000000002 27.265 21.555 110-114 23.325000000000003 28.12 27.395000000000003 21.16 115-119 24.055 28.499999999999996 26.790000000000003 20.655 120-124 24.11 27.694999999999997 27.265 20.93 125-129 24.765 27.975 26.784999999999997 20.474999999999998 130-134 25.330000000000002 27.655 26.99 20.025000000000002 135-139 25.629999999999995 27.860000000000003 26.669999999999998 19.84 140-144 24.87 27.634999999999998 26.805 20.69 145-149 26.229999999999997 28.1 25.540000000000003 20.13 150-151 26.9125 27.5625 25.412499999999998 20.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 2.0 25 3.0 26 4.0 27 5.5 28 4.0 29 4.0 30 9.0 31 13.5 32 17.5 33 28.5 34 45.0 35 59.5 36 76.5 37 107.5 38 140.0 39 162.0 40 184.5 41 214.0 42 233.5 43 254.5 44 282.0 45 288.5 46 271.0 47 254.5 48 235.5 49 199.5 50 184.5 51 156.0 52 111.5 53 93.0 54 79.5 55 66.0 56 54.0 57 39.5 58 28.5 59 22.5 60 15.5 61 11.0 62 7.0 63 4.0 64 2.0 65 2.5 66 3.0 67 2.0 68 1.0 69 0.5 70 1.0 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.95 #Duplication Level Percentage of deduplicated Percentage of total 1 91.56129741616272 83.275 2 7.25673446948873 13.200000000000001 3 0.9620670698185816 2.625 4 0.13743815283122596 0.5 5 0.054975261132490384 0.25 6 0.027487630566245192 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGTCTCTTCTTTTAAGCTCCACTACAAAGCTGGCAGATCCTTGAAGACT 6 0.15 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit GTTCCGGATGAGAAAGCTAGGGTTCAAATTCTTTCAGTGCTTACTAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.2625 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.2750000000000004 0.0 0.0 0.0 0.0 124-125 3.5250000000000004 0.0 0.0 0.0 0.0 126-127 3.975 0.0 0.0 0.0 0.0 128-129 4.4625 0.0 0.0 0.0 0.0 130-131 4.925 0.0 0.0 0.0 0.0 132-133 5.3375 0.0 0.0 0.0 0.0 134-135 5.825 0.0 0.0 0.0 0.0 136-137 6.3 0.0 0.0 0.0 0.0 138-139 6.737500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCCTC 10 0.006830828 145.0 9 GCAAAAC 10 0.006830828 145.0 145 >>END_MODULE Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709312 spots for SRR12690157.sra Written 709312 spots for SRR12690157.sra Read 709317 spots for SRR12690157.sra Written 709317 spots for SRR12690157.sra SRR ids: ['SRR12690157.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gfq5757j SRR12690157.sra spots: 14186245 blocks: [[1, 709312], [709313, 1418624], [1418625, 2127936], [2127937, 2837248], [2837249, 3546560], [3546561, 4255872], [4255873, 4965184], [4965185, 5674496], [5674497, 6383808], [6383809, 7093120], [7093121, 7802432], [7802433, 8511744], [8511745, 9221056], [9221057, 9930368], [9930369, 10639680], [10639681, 11348992], [11348993, 12058304], [12058305, 12767616], [12767617, 13476928], [13476929, 14186245]] SRR12690157 file size 4799406 SRR12690157 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690157 SRR12690157_1.fastq SRR12690157_2.fastq Input file: SRR12690157_1.fastq Paired file: SRR12690157_2.fastq trimmed: SRR12690157-trimmed-pair1.fastq, SRR12690157-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:20:45 2025 >> started Mon Feb 10 19:21:02 2025 >> done (16.886s) 14186245 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 2474 ( 0.02%) empty read pairs filtered out after trimming by size control 14183758 (99.98%) read pairs available; of these: 1475120 (10.40%) trimmed read pairs available after processing 12708638 (89.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 8 0.00% 22 13 0.00% 23 5 0.00% 24 9 0.00% 25 7 0.00% 26 13 0.00% 27 18 0.00% 28 12 0.00% 29 8 0.00% 30 21 0.00% 31 11 0.00% 32 13 0.00% 33 24 0.00% 34 10 0.00% 35 24 0.00% 36 23 0.00% 37 17 0.00% 38 19 0.00% 39 16 0.00% 40 22 0.00% 41 30 0.00% 42 20 0.00% 43 27 0.00% 44 24 0.00% 45 36 0.00% 46 30 0.00% 47 33 0.00% 48 36 0.00% 49 31 0.00% 50 54 0.00% 51 60 0.00% 52 56 0.00% 53 56 0.00% 54 61 0.00% 55 74 0.00% 56 98 0.00% 57 89 0.00% 58 97 0.00% 59 126 0.00% 60 165 0.00% 61 169 0.00% 62 214 0.00% 63 235 0.00% 64 266 0.00% 65 223 0.00% 66 291 0.00% 67 319 0.00% 68 376 0.00% 69 466 0.00% 70 478 0.00% 71 565 0.00% 72 665 0.00% 73 704 0.00% 74 777 0.01% 75 927 0.01% 76 1073 0.01% 77 1190 0.01% 78 1259 0.01% 79 1381 0.01% 80 1516 0.01% 81 1865 0.01% 82 1976 0.01% 83 2261 0.02% 84 2479 0.02% 85 2829 0.02% 86 3143 0.02% 87 3371 0.02% 88 3704 0.03% 89 3971 0.03% 90 4271 0.03% 91 4654 0.03% 92 4963 0.03% 93 5616 0.04% 94 6177 0.04% 95 6523 0.05% 96 6891 0.05% 97 7446 0.05% 98 7958 0.06% 99 8577 0.06% 100 8748 0.06% 101 9394 0.07% 102 10071 0.07% 103 10656 0.08% 104 11078 0.08% 105 11768 0.08% 106 12515 0.09% 107 13230 0.09% 108 13731 0.10% 109 14623 0.10% 110 15186 0.11% 111 15671 0.11% 112 16300 0.11% 113 17012 0.12% 114 17642 0.12% 115 18733 0.13% 116 19384 0.14% 117 19942 0.14% 118 21042 0.15% 119 21522 0.15% 120 22367 0.16% 121 23390 0.16% 122 24154 0.17% 123 25178 0.18% 124 25766 0.18% 125 25996 0.18% 126 26987 0.19% 127 28096 0.20% 128 28756 0.20% 129 29303 0.21% 130 30841 0.22% 131 31267 0.22% 132 32229 0.23% 133 32737 0.23% 134 33217 0.23% 135 34347 0.24% 136 34786 0.25% 137 36091 0.25% 138 36559 0.26% 139 37644 0.27% 140 38486 0.27% 141 39725 0.28% 142 40877 0.29% 143 41406 0.29% 144 42602 0.30% 145 43380 0.31% 146 43831 0.31% 147 44652 0.31% 148 45471 0.32% 149 45614 0.32% 150 47847 0.34% 151 12708638 89.60% 14183758 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.46 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=497.08 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=30 prefix-density=0.75 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=103.98 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.4 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12690157 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:21:51 Started mapping on | Feb 10 19:21:51 Finished on | Feb 10 19:23:16 Mapping speed, Million of reads per hour | 600.72 Number of input reads | 14183758 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13475747 Uniquely mapped reads % | 95.01% Average mapped length | 296.21 Number of splices: Total | 13604868 Number of splices: Annotated (sjdb) | 13298779 Number of splices: GT/AG | 13324835 Number of splices: GC/AG | 225971 Number of splices: AT/AC | 10602 Number of splices: Non-canonical | 43460 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323336 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 75985 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.02% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 384675 384675 384675 N_multimapping 323336 323336 323336 N_noFeature 427993 13291273 480130 N_ambiguous 219275 750 86503 UnstrandedReadsAssigned:12828479 PositiveStrandReadsAssigned:183724 NegativeStrandReadsAssigned:12909114 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690157 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690157-trimmed-pair1.fastq SRR12690157-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,183,758 reads, 12,915,030 reads pseudoaligned [quant] estimated average fragment length: 251.476 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52401 SRR12690157.ke.tsv 34699 SRR12690157.se.tsv 87100 total ==> SRR12690157.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.52 482 17.3338 Potri.005G024800.1.v4.1 1035 784.524 191 15.4753 Potri.004G059700.1.v4.1 961 710.618 14 1.25229 Potri.007G009000.2.v4.1 1416 1165.52 0 0 Potri.003G141000.2.v4.1 2943 2692.52 740.465 17.4806 Potri.016G087400.1.v4.1 270 81.8623 613 475.98 Potri.015G069301.1.v4.1 564 324.536 0 0 Potri.010G195200.1.v4.1 1773 1522.52 28 1.16898 Potri.012G127500.1.v4.1 977 726.58 179 15.6596 ==> SRR12690157.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 238 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 208 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR12690157 completed mapping pipeline successfully