Starting /dee2/code/volunteer_pipeline.sh SRR12690158 current disk space = 3056049098752 free memory = 1576507088 SRR12690158 SRAfilesize 65fb425c406feb458a8af852ad5efe32 SRR12690158.sra SRR12690158.sra file validated SRR12690158 is paired end SRR12690158 is conventional basespace SRR12690158 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690158_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.613 37.0 37.0 37.0 37.0 37.0 2 36.45625 37.0 37.0 37.0 37.0 37.0 3 36.599 37.0 37.0 37.0 37.0 37.0 4 36.6585 37.0 37.0 37.0 37.0 37.0 5 36.6605 37.0 37.0 37.0 37.0 37.0 6 36.604 37.0 37.0 37.0 37.0 37.0 7 36.5335 37.0 37.0 37.0 37.0 37.0 8 36.5185 37.0 37.0 37.0 37.0 37.0 9 36.597 37.0 37.0 37.0 37.0 37.0 10-14 36.6061 37.0 37.0 37.0 37.0 37.0 15-19 36.5798 37.0 37.0 37.0 37.0 37.0 20-24 36.56830000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.5217 37.0 37.0 37.0 37.0 37.0 30-34 36.4935 37.0 37.0 37.0 37.0 37.0 35-39 36.48309999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4585 37.0 37.0 37.0 37.0 37.0 45-49 36.454899999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3981 37.0 37.0 37.0 37.0 37.0 55-59 36.3877 37.0 37.0 37.0 37.0 37.0 60-64 36.3952 37.0 37.0 37.0 37.0 37.0 65-69 36.296800000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3335 37.0 37.0 37.0 37.0 37.0 75-79 36.322900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.218 37.0 37.0 37.0 37.0 37.0 85-89 36.2616 37.0 37.0 37.0 37.0 37.0 90-94 36.227999999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.1616 37.0 37.0 37.0 37.0 37.0 100-104 36.1602 37.0 37.0 37.0 37.0 37.0 105-109 36.1725 37.0 37.0 37.0 37.0 37.0 110-114 36.1241 37.0 37.0 37.0 37.0 37.0 115-119 36.0957 37.0 37.0 37.0 37.0 37.0 120-124 36.0306 37.0 37.0 37.0 37.0 37.0 125-129 36.0317 37.0 37.0 37.0 37.0 37.0 130-134 35.9597 37.0 37.0 37.0 37.0 37.0 135-139 35.9527 37.0 37.0 37.0 37.0 37.0 140-144 35.6892 37.0 37.0 37.0 37.0 37.0 145-149 35.545100000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.4725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 4.0 26 2.0 27 9.0 28 12.0 29 22.0 30 25.0 31 32.0 32 40.0 33 84.0 34 135.0 35 297.0 36 2999.0 37 338.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.6 12.174999999999999 7.35 40.875 2 19.42842817748809 12.65981448984708 36.224617698671345 31.687139633993482 3 15.625 15.7 29.349999999999998 39.324999999999996 4 21.975 22.525000000000002 25.1 30.4 5 24.025 28.925 25.174999999999997 21.875 6 21.275 34.300000000000004 23.075000000000003 21.349999999999998 7 16.25 28.575 38.05 17.125 8 17.8 27.150000000000002 32.15 22.900000000000002 9 17.424999999999997 24.125 35.725 22.725 10-14 19.89 29.485 27.224999999999998 23.400000000000002 15-19 19.869999999999997 27.450000000000003 27.644999999999996 25.035 20-24 20.025000000000002 28.165000000000003 27.994999999999997 23.815 25-29 20.355 28.23 27.46 23.955000000000002 30-34 20.044999999999998 27.985 27.589999999999996 24.38 35-39 20.265 27.825 27.46 24.45 40-44 20.544999999999998 29.17 27.0 23.285 45-49 20.455000000000002 27.87 28.015 23.66 50-54 20.07 27.6 28.305000000000003 24.025 55-59 20.175 27.905 28.115000000000002 23.805 60-64 20.315 27.644999999999996 28.155 23.885 65-69 20.155 28.04 28.02 23.785 70-74 20.325 28.335 28.095 23.244999999999997 75-79 21.310000000000002 27.61 27.565 23.515 80-84 20.105 27.855 27.875 24.165 85-89 20.825 28.17 27.485 23.52 90-94 20.64 27.755000000000003 28.4 23.205000000000002 95-99 20.51 28.084999999999997 27.175 24.23 100-104 20.66 27.894999999999996 27.700000000000003 23.745 105-109 21.165 28.205000000000002 27.034999999999997 23.595 110-114 20.89 28.62 26.93 23.56 115-119 21.36 28.325 26.875 23.44 120-124 21.005 28.360000000000003 26.724999999999998 23.91 125-129 21.584999999999997 27.400000000000002 27.185 23.830000000000002 130-134 20.93 28.694999999999997 26.924999999999997 23.45 135-139 21.09 27.605 27.205000000000002 24.099999999999998 140-144 21.529999999999998 28.08 26.479999999999997 23.91 145-149 21.04 27.55 26.745 24.665 150-151 20.599999999999998 28.4125 26.637499999999996 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 2.0 24 2.5 25 1.5 26 3.5 27 7.5 28 12.0 29 13.5 30 11.5 31 15.5 32 28.0 33 34.0 34 44.0 35 68.5 36 84.5 37 95.5 38 126.5 39 151.5 40 177.0 41 206.5 42 227.0 43 257.5 44 265.5 45 260.5 46 258.0 47 263.0 48 246.5 49 204.5 50 185.0 51 158.0 52 129.0 53 107.5 54 85.5 55 59.5 56 44.5 57 42.5 58 36.5 59 30.0 60 17.5 61 13.5 62 10.0 63 3.0 64 1.5 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.05009528995372 84.52499999999999 2 7.1059079771304114 13.05 3 0.7350939286686632 2.025 4 0.10890280424720937 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.3875 0.0 0.0 0.0 0.0 102-103 1.4874999999999998 0.0 0.0 0.0 0.0 104-105 1.6749999999999998 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.2874999999999996 0.0 0.0 0.0 0.0 110-111 2.7125000000000004 0.0 0.0 0.0 0.0 112-113 3.125 0.0 0.0 0.0 0.0 114-115 3.525 0.0 0.0 0.0 0.0 116-117 4.112500000000001 0.0 0.0 0.0 0.0 118-119 4.4875 0.0 0.0 0.0 0.0 120-121 5.112500000000001 0.0 0.0 0.0 0.0 122-123 5.5875 0.0 0.0 0.0 0.0 124-125 6.1625 0.0 0.0 0.0 0.0 126-127 6.6625 0.0 0.0 0.0 0.0 128-129 7.1375 0.0 0.0 0.0 0.0 130-131 7.675 0.0 0.0 0.0 0.0 132-133 8.2875 0.0 0.0 0.0 0.0 134-135 8.8875 0.0 0.0 0.0 0.0 136-137 9.2625 0.0 0.0 0.0 0.0 138-139 9.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690158 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690158_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4215 37.0 37.0 37.0 37.0 37.0 2 36.1625 37.0 37.0 37.0 37.0 37.0 3 36.3495 37.0 37.0 37.0 37.0 37.0 4 36.25 37.0 37.0 37.0 37.0 37.0 5 36.433 37.0 37.0 37.0 37.0 37.0 6 36.3315 37.0 37.0 37.0 37.0 37.0 7 36.3635 37.0 37.0 37.0 37.0 37.0 8 36.3335 37.0 37.0 37.0 37.0 37.0 9 36.402 37.0 37.0 37.0 37.0 37.0 10-14 36.3293 37.0 37.0 37.0 37.0 37.0 15-19 36.3214 37.0 37.0 37.0 37.0 37.0 20-24 36.2855 37.0 37.0 37.0 37.0 37.0 25-29 36.2153 37.0 37.0 37.0 37.0 37.0 30-34 36.214800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.249 37.0 37.0 37.0 37.0 37.0 40-44 36.192899999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.1677 37.0 37.0 37.0 37.0 37.0 50-54 36.1676 37.0 37.0 37.0 37.0 37.0 55-59 36.1095 37.0 37.0 37.0 37.0 37.0 60-64 36.101800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.098 37.0 37.0 37.0 37.0 37.0 70-74 35.9803 37.0 37.0 37.0 37.0 37.0 75-79 36.0064 37.0 37.0 37.0 37.0 37.0 80-84 35.975500000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.96509999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.9106 37.0 37.0 37.0 37.0 37.0 95-99 35.896499999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.9456 37.0 37.0 37.0 37.0 37.0 105-109 35.9371 37.0 37.0 37.0 37.0 37.0 110-114 35.856 37.0 37.0 37.0 37.0 37.0 115-119 35.825100000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.7294 37.0 37.0 37.0 37.0 37.0 125-129 35.658300000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.5419 37.0 37.0 37.0 37.0 37.0 135-139 35.4837 37.0 37.0 37.0 37.0 37.0 140-144 35.3532 37.0 37.0 37.0 37.0 37.0 145-149 35.1682 37.0 37.0 37.0 29.8 37.0 150-151 34.7465 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 1.0 15 0.0 16 2.0 17 1.0 18 1.0 19 0.0 20 3.0 21 2.0 22 5.0 23 6.0 24 2.0 25 2.0 26 4.0 27 15.0 28 15.0 29 17.0 30 27.0 31 48.0 32 49.0 33 88.0 34 176.0 35 519.0 36 2707.0 37 304.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.875 26.075 11.200000000000001 26.85 2 28.575 26.724999999999998 29.375 15.325 3 20.275000000000002 28.65 31.075000000000003 20.0 4 22.475 33.6 24.25 19.675 5 25.5 36.3 21.349999999999998 16.85 6 20.7 38.975 22.025 18.3 7 20.0 22.875 38.525 18.6 8 20.1 26.424999999999997 28.525 24.95 9 21.575 24.099999999999998 30.675 23.65 10-14 23.055 29.335 26.58 21.029999999999998 15-19 22.78 28.29 27.11 21.82 20-24 22.58 28.565 27.715 21.14 25-29 22.71 28.875 27.325 21.09 30-34 22.285 28.675 27.705000000000002 21.335 35-39 23.330000000000002 28.28 27.99 20.4 40-44 22.455 28.384999999999998 27.334999999999997 21.825 45-49 22.88 28.625 27.589999999999996 20.905 50-54 22.62 28.549999999999997 27.85 20.979999999999997 55-59 23.119999999999997 28.415000000000003 27.205000000000002 21.26 60-64 23.22 28.505000000000003 27.029999999999998 21.245 65-69 23.055 27.87 27.48 21.595 70-74 23.880000000000003 28.139999999999997 27.384999999999998 20.595 75-79 22.830000000000002 28.29 27.889999999999997 20.990000000000002 80-84 23.330000000000002 28.084999999999997 27.400000000000002 21.185000000000002 85-89 23.34 28.68 26.745 21.235 90-94 23.155 28.299999999999997 27.38 21.165 95-99 22.825 28.689999999999998 27.415 21.07 100-104 23.565 27.97 27.315 21.15 105-109 23.97 28.42 27.255000000000003 20.355 110-114 24.169999999999998 27.655 27.439999999999998 20.735 115-119 24.735 28.24 26.595000000000002 20.43 120-124 24.2 28.405 26.900000000000002 20.495 125-129 25.275 27.675 26.405 20.645 130-134 25.295 28.799999999999997 26.150000000000002 19.755 135-139 25.665 27.165 27.0 20.169999999999998 140-144 26.325 28.07 26.355 19.25 145-149 26.25 28.345 25.979999999999997 19.425 150-151 27.0875 27.2625 26.35 19.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.5 10 1.5 11 1.5 12 0.5 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 3.5 24 2.5 25 3.0 26 3.5 27 3.5 28 6.5 29 12.0 30 15.0 31 18.0 32 28.5 33 34.0 34 45.5 35 62.5 36 83.5 37 119.0 38 154.5 39 181.0 40 205.5 41 223.5 42 241.5 43 273.0 44 266.0 45 264.0 46 266.5 47 247.0 48 235.5 49 191.0 50 144.5 51 139.5 52 114.5 53 88.0 54 80.5 55 56.0 56 46.5 57 35.5 58 21.0 59 20.0 60 15.0 61 8.5 62 7.0 63 4.0 64 2.5 65 1.5 66 1.0 67 2.0 68 1.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 1.0 94 1.0 95 0.5 96 0.5 97 0.0 98 1.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.57499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.97379197379198 84.22500000000001 2 7.07070707070707 12.950000000000001 3 0.7917007917007918 2.175 4 0.1365001365001365 0.5 5 0.0 0.0 6 0.027300027300027303 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.6875 0.0 0.0 0.0 0.0 112-113 3.0875 0.0 0.0 0.0 0.0 114-115 3.475 0.0 0.0 0.0 0.0 116-117 4.075 0.0 0.0 0.0 0.0 118-119 4.4625 0.0 0.0 0.0 0.0 120-121 5.05 0.0 0.0 0.0 0.0 122-123 5.487500000000001 0.0 0.0 0.0 0.0 124-125 6.0625 0.0 0.0 0.0 0.0 126-127 6.5625 0.0 0.0 0.0 0.0 128-129 7.0375 0.0 0.0 0.0 0.0 130-131 7.575 0.0 0.0 0.0 0.0 132-133 8.2 0.0 0.0 0.0 0.0 134-135 8.7875 0.0 0.0 0.0 0.0 136-137 9.162500000000001 0.0 0.0 0.0 0.0 138-139 9.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688569 spots for SRR12690158.sra Written 688569 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra Read 688551 spots for SRR12690158.sra Written 688551 spots for SRR12690158.sra SRR ids: ['SRR12690158.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dy0d54n2 SRR12690158.sra spots: 13771038 blocks: [[1, 688551], [688552, 1377102], [1377103, 2065653], [2065654, 2754204], [2754205, 3442755], [3442756, 4131306], [4131307, 4819857], [4819858, 5508408], [5508409, 6196959], [6196960, 6885510], [6885511, 7574061], [7574062, 8262612], [8262613, 8951163], [8951164, 9639714], [9639715, 10328265], [10328266, 11016816], [11016817, 11705367], [11705368, 12393918], [12393919, 13082469], [13082470, 13771038]] SRR12690158 file size 4658300 SRR12690158 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690158 SRR12690158_1.fastq SRR12690158_2.fastq Input file: SRR12690158_1.fastq Paired file: SRR12690158_2.fastq trimmed: SRR12690158-trimmed-pair1.fastq, SRR12690158-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:38:01 2025 >> started Mon Feb 10 20:38:16 2025 >> done (15.046s) 13771038 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 1554 ( 0.01%) empty read pairs filtered out after trimming by size control 13769458 (99.99%) read pairs available; of these: 1871090 (13.59%) trimmed read pairs available after processing 11898368 (86.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 6 0.00% 21 4 0.00% 22 7 0.00% 23 8 0.00% 24 5 0.00% 25 9 0.00% 26 12 0.00% 27 12 0.00% 28 14 0.00% 29 14 0.00% 30 13 0.00% 31 12 0.00% 32 16 0.00% 33 22 0.00% 34 25 0.00% 35 21 0.00% 36 25 0.00% 37 22 0.00% 38 21 0.00% 39 29 0.00% 40 37 0.00% 41 41 0.00% 42 36 0.00% 43 35 0.00% 44 34 0.00% 45 47 0.00% 46 41 0.00% 47 37 0.00% 48 56 0.00% 49 69 0.00% 50 81 0.00% 51 102 0.00% 52 81 0.00% 53 104 0.00% 54 113 0.00% 55 127 0.00% 56 140 0.00% 57 153 0.00% 58 149 0.00% 59 196 0.00% 60 258 0.00% 61 260 0.00% 62 306 0.00% 63 295 0.00% 64 424 0.00% 65 424 0.00% 66 411 0.00% 67 528 0.00% 68 568 0.00% 69 696 0.01% 70 735 0.01% 71 902 0.01% 72 967 0.01% 73 1192 0.01% 74 1351 0.01% 75 1401 0.01% 76 1725 0.01% 77 1894 0.01% 78 2125 0.02% 79 2209 0.02% 80 2416 0.02% 81 2759 0.02% 82 3094 0.02% 83 3514 0.03% 84 3951 0.03% 85 4473 0.03% 86 4733 0.03% 87 5010 0.04% 88 5735 0.04% 89 5943 0.04% 90 6710 0.05% 91 7258 0.05% 92 7606 0.06% 93 8340 0.06% 94 9207 0.07% 95 10193 0.07% 96 10396 0.08% 97 11172 0.08% 98 11946 0.09% 99 12755 0.09% 100 13642 0.10% 101 13864 0.10% 102 14844 0.11% 103 15885 0.12% 104 16527 0.12% 105 17181 0.12% 106 18345 0.13% 107 19031 0.14% 108 19463 0.14% 109 20552 0.15% 110 21161 0.15% 111 22211 0.16% 112 23357 0.17% 113 23601 0.17% 114 24523 0.18% 115 25796 0.19% 116 26468 0.19% 117 27188 0.20% 118 28597 0.21% 119 28958 0.21% 120 30146 0.22% 121 30569 0.22% 122 31754 0.23% 123 32637 0.24% 124 33406 0.24% 125 34075 0.25% 126 35448 0.26% 127 35671 0.26% 128 36743 0.27% 129 37261 0.27% 130 38344 0.28% 131 39058 0.28% 132 39689 0.29% 133 40628 0.30% 134 40584 0.29% 135 41899 0.30% 136 42224 0.31% 137 42913 0.31% 138 44124 0.32% 139 45492 0.33% 140 45439 0.33% 141 46221 0.34% 142 47687 0.35% 143 47902 0.35% 144 48645 0.35% 145 49093 0.36% 146 49878 0.36% 147 50029 0.36% 148 50968 0.37% 149 51296 0.37% 150 52212 0.38% 151 11898368 86.41% 13769458 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.46 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=8.38 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.7 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=2.2 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=66.40 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.2 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12690158 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:39:00 Started mapping on | Feb 10 20:39:00 Finished on | Feb 10 20:40:28 Mapping speed, Million of reads per hour | 563.30 Number of input reads | 13769458 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13087124 Uniquely mapped reads % | 95.04% Average mapped length | 294.24 Number of splices: Total | 13053352 Number of splices: Annotated (sjdb) | 12733036 Number of splices: GT/AG | 12778660 Number of splices: GC/AG | 222086 Number of splices: AT/AC | 9307 Number of splices: Non-canonical | 43299 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330276 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 60625 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.96% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 352058 352058 352058 N_multimapping 330276 330276 330276 N_noFeature 502927 12931498 552721 N_ambiguous 194156 769 87888 UnstrandedReadsAssigned:12390041 PositiveStrandReadsAssigned:154857 NegativeStrandReadsAssigned:12446515 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690158 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690158-trimmed-pair1.fastq SRR12690158-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,769,458 reads, 12,451,456 reads pseudoaligned [quant] estimated average fragment length: 242.333 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR12690158.ke.tsv 34699 SRR12690158.se.tsv 87100 total ==> SRR12690158.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.67 400 17.0153 Potri.005G024800.1.v4.1 1035 793.667 129 12.2839 Potri.004G059700.1.v4.1 961 719.758 12 1.26003 Potri.007G009000.2.v4.1 1416 1174.67 0 0 Potri.003G141000.2.v4.1 2943 2701.67 456.805 12.7786 Potri.016G087400.1.v4.1 270 87.7695 465.033 400.429 Potri.015G069301.1.v4.1 564 333.569 0 0 Potri.010G195200.1.v4.1 1773 1531.67 10 0.493425 Potri.012G127500.1.v4.1 977 735.711 143 14.6897 ==> SRR12690158.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 409 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 184 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR12690158 completed mapping pipeline successfully