Starting /dee2/code/volunteer_pipeline.sh SRR12690159 current disk space = 3056412561408 free memory = 1221513624 SRR12690159 SRAfilesize 29ee7c42b8ba574273f2c6ffa0029413 SRR12690159.sra SRR12690159.sra file validated SRR12690159 is paired end SRR12690159 is conventional basespace SRR12690159 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690159_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.532 37.0 37.0 37.0 37.0 37.0 2 36.34975 37.0 37.0 37.0 37.0 37.0 3 36.612 37.0 37.0 37.0 37.0 37.0 4 36.579 37.0 37.0 37.0 37.0 37.0 5 36.5725 37.0 37.0 37.0 37.0 37.0 6 36.6135 37.0 37.0 37.0 37.0 37.0 7 36.5825 37.0 37.0 37.0 37.0 37.0 8 36.5905 37.0 37.0 37.0 37.0 37.0 9 36.624 37.0 37.0 37.0 37.0 37.0 10-14 36.62179999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.6011 37.0 37.0 37.0 37.0 37.0 20-24 36.5709 37.0 37.0 37.0 37.0 37.0 25-29 36.5247 37.0 37.0 37.0 37.0 37.0 30-34 36.515 37.0 37.0 37.0 37.0 37.0 35-39 36.4654 37.0 37.0 37.0 37.0 37.0 40-44 36.464 37.0 37.0 37.0 37.0 37.0 45-49 36.4541 37.0 37.0 37.0 37.0 37.0 50-54 36.4506 37.0 37.0 37.0 37.0 37.0 55-59 36.369499999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3745 37.0 37.0 37.0 37.0 37.0 65-69 36.3486 37.0 37.0 37.0 37.0 37.0 70-74 36.321400000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2971 37.0 37.0 37.0 37.0 37.0 80-84 36.241 37.0 37.0 37.0 37.0 37.0 85-89 36.2753 37.0 37.0 37.0 37.0 37.0 90-94 36.1851 37.0 37.0 37.0 37.0 37.0 95-99 36.1928 37.0 37.0 37.0 37.0 37.0 100-104 36.14149999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.111799999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1158 37.0 37.0 37.0 37.0 37.0 115-119 36.049899999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.0427 37.0 37.0 37.0 37.0 37.0 125-129 36.057599999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.961600000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.9726 37.0 37.0 37.0 37.0 37.0 140-144 35.8288 37.0 37.0 37.0 37.0 37.0 145-149 35.8035 37.0 37.0 37.0 37.0 37.0 150-151 35.496 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 7.0 27 7.0 28 10.0 29 14.0 30 22.0 31 36.0 32 47.0 33 70.0 34 116.0 35 312.0 36 3024.0 37 332.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.375 11.225 6.275 38.125 2 19.66390770002508 11.913719588663154 38.1740657135691 30.248306997742663 3 16.425 14.674999999999999 28.299999999999997 40.6 4 21.099999999999998 23.549999999999997 25.75 29.599999999999998 5 23.325000000000003 29.075 25.45 22.15 6 21.3 32.75 23.65 22.3 7 17.275 26.275 40.175 16.275000000000002 8 18.2 25.25 33.225 23.325000000000003 9 17.2 23.225 36.15 23.425 10-14 19.91 29.015 28.16 22.915 15-19 20.07 27.625 28.505000000000003 23.799999999999997 20-24 20.375 28.494999999999997 27.605 23.525 25-29 20.095 27.700000000000003 28.810000000000002 23.395 30-34 19.54 28.71 27.43 24.32 35-39 20.215 27.955000000000002 28.139999999999997 23.69 40-44 20.075000000000003 28.15 28.065 23.71 45-49 20.175 28.425 27.365000000000002 24.035 50-54 19.98 27.889999999999997 27.925 24.205 55-59 20.04 28.095 27.85 24.015 60-64 20.669999999999998 28.255000000000003 27.51 23.565 65-69 20.775 27.689999999999998 27.77 23.765 70-74 20.835 27.689999999999998 27.810000000000002 23.665 75-79 20.71 27.87 27.675 23.745 80-84 20.435 27.975 27.76 23.830000000000002 85-89 20.74 28.08 27.605 23.575 90-94 20.979999999999997 27.32 27.88 23.82 95-99 20.82 28.025 27.73 23.425 100-104 20.424999999999997 28.705000000000002 27.425 23.445 105-109 21.005 28.13 28.12 22.745 110-114 20.985 28.345 27.35 23.32 115-119 21.575 28.044999999999998 27.575 22.805 120-124 20.78 27.689999999999998 27.400000000000002 24.13 125-129 21.015 27.800000000000004 27.42 23.765 130-134 20.990000000000002 28.34 27.145000000000003 23.525 135-139 21.23 28.285 27.275 23.21 140-144 21.315 28.439999999999998 26.66 23.585 145-149 21.029999999999998 27.88 26.655 24.435000000000002 150-151 21.0125 28.15 27.150000000000002 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 1.5 25 4.0 26 8.0 27 7.5 28 5.0 29 10.0 30 16.5 31 28.0 32 34.5 33 38.0 34 55.5 35 71.0 36 78.5 37 106.0 38 128.0 39 132.5 40 171.0 41 207.0 42 212.0 43 242.5 44 267.5 45 252.0 46 252.0 47 257.5 48 254.5 49 224.5 50 178.0 51 151.0 52 130.0 53 100.0 54 84.0 55 76.5 56 56.5 57 39.5 58 31.0 59 26.0 60 17.0 61 11.0 62 7.0 63 4.0 64 2.5 65 2.5 66 3.5 67 3.0 68 1.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.17500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.6570557249792 81.75 2 8.095370113667869 14.6 3 0.9703354588300527 2.625 4 0.249514832270585 0.8999999999999999 5 0.02772387025228722 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCCATAACTTTAACCACATAGGGTTTATCAGCCTCTTGAAGTGCCAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 3.1 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.5625 0.0 0.0 0.0 0.0 126-127 3.7875 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.8875 0.0 0.0 0.0 0.0 134-135 5.2875 0.0 0.0 0.0 0.0 136-137 5.6 0.0 0.0 0.0 0.0 138-139 6.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTTAA 10 0.006830828 145.0 145 >>END_MODULE SRR12690159 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690159_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.396 37.0 37.0 37.0 37.0 37.0 2 36.1705 37.0 37.0 37.0 37.0 37.0 3 36.249 37.0 37.0 37.0 37.0 37.0 4 36.25 37.0 37.0 37.0 37.0 37.0 5 36.3055 37.0 37.0 37.0 37.0 37.0 6 36.2755 37.0 37.0 37.0 37.0 37.0 7 36.248 37.0 37.0 37.0 37.0 37.0 8 36.368 37.0 37.0 37.0 37.0 37.0 9 36.2555 37.0 37.0 37.0 37.0 37.0 10-14 36.3149 37.0 37.0 37.0 37.0 37.0 15-19 36.2469 37.0 37.0 37.0 37.0 37.0 20-24 36.3404 37.0 37.0 37.0 37.0 37.0 25-29 36.269099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.2132 37.0 37.0 37.0 37.0 37.0 35-39 36.198 37.0 37.0 37.0 37.0 37.0 40-44 36.1309 37.0 37.0 37.0 37.0 37.0 45-49 36.134 37.0 37.0 37.0 37.0 37.0 50-54 36.10889999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.0537 37.0 37.0 37.0 37.0 37.0 60-64 36.0707 37.0 37.0 37.0 37.0 37.0 65-69 36.078199999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.965700000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0148 37.0 37.0 37.0 37.0 37.0 80-84 36.0144 37.0 37.0 37.0 37.0 37.0 85-89 35.999900000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.8902 37.0 37.0 37.0 37.0 37.0 95-99 35.886700000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.9177 37.0 37.0 37.0 37.0 37.0 105-109 35.94350000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.811899999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.7791 37.0 37.0 37.0 37.0 37.0 120-124 35.671 37.0 37.0 37.0 37.0 37.0 125-129 35.659 37.0 37.0 37.0 37.0 37.0 130-134 35.6434 37.0 37.0 37.0 37.0 37.0 135-139 35.447 37.0 37.0 37.0 37.0 37.0 140-144 35.4089 37.0 37.0 37.0 37.0 37.0 145-149 35.2807 37.0 37.0 37.0 32.2 37.0 150-151 34.869 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 3.0 16 1.0 17 1.0 18 1.0 19 2.0 20 2.0 21 1.0 22 5.0 23 4.0 24 1.0 25 7.0 26 11.0 27 12.0 28 14.0 29 21.0 30 32.0 31 38.0 32 55.0 33 87.0 34 166.0 35 520.0 36 2739.0 37 274.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.975 24.175 9.725 25.124999999999996 2 27.950000000000003 27.425 29.2 15.425 3 20.375 28.425 31.5 19.7 4 23.35 33.275 24.05 19.325 5 25.8 36.95 22.3 14.95 6 21.025 38.45 22.3 18.224999999999998 7 20.225 23.875 38.0 17.9 8 20.9 27.175 27.725 24.2 9 21.55 24.975 28.799999999999997 24.675 10-14 23.015 29.665000000000003 26.435 20.885 15-19 22.455 28.410000000000004 28.075 21.060000000000002 20-24 22.830000000000002 28.854999999999997 27.485 20.830000000000002 25-29 22.3 28.294999999999998 28.08 21.325 30-34 22.189999999999998 28.28 28.205000000000002 21.325 35-39 22.86 29.07 26.735 21.335 40-44 22.38 28.93 27.644999999999996 21.044999999999998 45-49 22.57 28.22 28.144999999999996 21.065 50-54 22.75 27.725 28.060000000000002 21.465 55-59 23.215 28.7 27.125 20.96 60-64 22.814999999999998 28.035 27.839999999999996 21.310000000000002 65-69 22.33 28.02 27.54 22.11 70-74 23.09 27.725 27.3 21.884999999999998 75-79 23.49 27.224999999999998 27.765 21.52 80-84 23.11 28.139999999999997 27.0 21.75 85-89 22.655 27.96 27.02 22.365 90-94 23.14 27.85 27.345000000000002 21.665 95-99 22.615 27.505000000000003 27.544999999999998 22.335 100-104 23.72 28.144999999999996 27.1 21.035 105-109 23.275000000000002 27.875 27.315 21.535 110-114 23.935000000000002 28.244999999999997 26.99 20.830000000000002 115-119 23.57 27.83 28.110000000000003 20.49 120-124 23.86 27.665 27.38 21.095 125-129 24.22 28.035 27.155 20.59 130-134 24.759999999999998 28.435 26.47 20.335 135-139 24.57 27.54 27.47 20.419999999999998 140-144 24.22 28.365000000000002 26.645000000000003 20.77 145-149 25.405 28.475 26.009999999999998 20.11 150-151 25.924999999999997 28.125 26.0625 19.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.5 12 1.0 13 0.5 14 1.0 15 1.0 16 0.5 17 1.0 18 2.5 19 2.5 20 1.5 21 1.5 22 1.0 23 1.5 24 3.5 25 4.0 26 3.5 27 5.5 28 10.0 29 13.5 30 13.0 31 22.0 32 32.5 33 37.5 34 45.0 35 64.5 36 84.5 37 102.0 38 128.0 39 160.0 40 197.5 41 227.0 42 246.0 43 261.5 44 259.5 45 258.0 46 259.5 47 234.0 48 233.5 49 211.5 50 171.0 51 147.0 52 105.5 53 93.0 54 90.0 55 67.0 56 50.0 57 40.0 58 27.0 59 17.5 60 12.0 61 11.5 62 12.5 63 8.0 64 3.5 65 1.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.88128996385876 81.72500000000001 2 7.534056157909369 13.55 3 1.278843480678343 3.45 4 0.22240756185710314 0.8 5 0.055601890464275786 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027800945232137893 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit GCTCAGTTCAAGAAAGAGACGAAAACAATCCAAAAATGGCGATAATCTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 3.8125 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.487500000000001 0.0 0.0 0.0 0.0 132-133 4.925 0.0 0.0 0.0 0.0 134-135 5.3125 0.0 0.0 0.0 0.0 136-137 5.625 0.0 0.0 0.0 0.0 138-139 6.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGTG 10 0.006830828 145.0 7 >>END_MODULE Read 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580208 spots for SRR12690159.sra Written 580208 spots for SRR12690159.sra Read 580220 spots for SRR12690159.sra Written 580220 spots for SRR12690159.sra SRR ids: ['SRR12690159.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tn2iqdso SRR12690159.sra spots: 11604172 blocks: [[1, 580208], [580209, 1160416], [1160417, 1740624], [1740625, 2320832], [2320833, 2901040], [2901041, 3481248], [3481249, 4061456], [4061457, 4641664], [4641665, 5221872], [5221873, 5802080], [5802081, 6382288], [6382289, 6962496], [6962497, 7542704], [7542705, 8122912], [8122913, 8703120], [8703121, 9283328], [9283329, 9863536], [9863537, 10443744], [10443745, 11023952], [11023953, 11604172]] SRR12690159 file size 3921904 SRR12690159 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690159 SRR12690159_1.fastq SRR12690159_2.fastq Input file: SRR12690159_1.fastq Paired file: SRR12690159_2.fastq trimmed: SRR12690159-trimmed-pair1.fastq, SRR12690159-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:53:00 2025 >> started Mon Feb 10 19:53:18 2025 >> done (17.312s) 11604172 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 7556 ( 0.07%) empty read pairs filtered out after trimming by size control 11596585 (99.93%) read pairs available; of these: 1166041 (10.06%) trimmed read pairs available after processing 10430544 (89.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 6 0.00% 23 7 0.00% 24 11 0.00% 25 12 0.00% 26 13 0.00% 27 9 0.00% 28 7 0.00% 29 17 0.00% 30 15 0.00% 31 14 0.00% 32 17 0.00% 33 15 0.00% 34 11 0.00% 35 20 0.00% 36 19 0.00% 37 14 0.00% 38 21 0.00% 39 13 0.00% 40 17 0.00% 41 18 0.00% 42 14 0.00% 43 38 0.00% 44 19 0.00% 45 34 0.00% 46 28 0.00% 47 34 0.00% 48 29 0.00% 49 31 0.00% 50 38 0.00% 51 54 0.00% 52 53 0.00% 53 55 0.00% 54 59 0.00% 55 69 0.00% 56 75 0.00% 57 91 0.00% 58 122 0.00% 59 135 0.00% 60 222 0.00% 61 160 0.00% 62 207 0.00% 63 207 0.00% 64 232 0.00% 65 207 0.00% 66 257 0.00% 67 315 0.00% 68 279 0.00% 69 401 0.00% 70 459 0.00% 71 493 0.00% 72 573 0.00% 73 657 0.01% 74 760 0.01% 75 858 0.01% 76 890 0.01% 77 1012 0.01% 78 1086 0.01% 79 1284 0.01% 80 1381 0.01% 81 1455 0.01% 82 1806 0.02% 83 1945 0.02% 84 2176 0.02% 85 2356 0.02% 86 2552 0.02% 87 2824 0.02% 88 3131 0.03% 89 3367 0.03% 90 3656 0.03% 91 3963 0.03% 92 4160 0.04% 93 4619 0.04% 94 4964 0.04% 95 5399 0.05% 96 5660 0.05% 97 6257 0.05% 98 6551 0.06% 99 6863 0.06% 100 7222 0.06% 101 7553 0.07% 102 8205 0.07% 103 8567 0.07% 104 8996 0.08% 105 9410 0.08% 106 9999 0.09% 107 10243 0.09% 108 10553 0.09% 109 11402 0.10% 110 11466 0.10% 111 12284 0.11% 112 12775 0.11% 113 13269 0.11% 114 13781 0.12% 115 14256 0.12% 116 14956 0.13% 117 15593 0.13% 118 16319 0.14% 119 16479 0.14% 120 17393 0.15% 121 18066 0.16% 122 18956 0.16% 123 19524 0.17% 124 20227 0.17% 125 20492 0.18% 126 21289 0.18% 127 21917 0.19% 128 22686 0.20% 129 23121 0.20% 130 24138 0.21% 131 24227 0.21% 132 25207 0.22% 133 26023 0.22% 134 26215 0.23% 135 26869 0.23% 136 27655 0.24% 137 28501 0.25% 138 28961 0.25% 139 30247 0.26% 140 30599 0.26% 141 31077 0.27% 142 32156 0.28% 143 32451 0.28% 144 33606 0.29% 145 34077 0.29% 146 34788 0.30% 147 35136 0.30% 148 36336 0.31% 149 36444 0.31% 150 37412 0.32% 151 10430544 89.94% 11596585 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.73 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=522.82 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGT criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=24 prefix-density=1.05 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=74.93 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.6 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12690159 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:54:15 Started mapping on | Feb 10 19:54:31 Finished on | Feb 10 19:55:45 Mapping speed, Million of reads per hour | 564.16 Number of input reads | 11596585 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10985624 Uniquely mapped reads % | 94.73% Average mapped length | 296.30 Number of splices: Total | 11119089 Number of splices: Annotated (sjdb) | 10883672 Number of splices: GT/AG | 10880702 Number of splices: GC/AG | 194945 Number of splices: AT/AC | 7045 Number of splices: Non-canonical | 36397 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 257653 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 83885 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 353308 353308 353308 N_multimapping 257653 257653 257653 N_noFeature 454972 10829913 497651 N_ambiguous 180896 597 67524 UnstrandedReadsAssigned:10349756 PositiveStrandReadsAssigned:155114 NegativeStrandReadsAssigned:10420449 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690159 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690159-trimmed-pair1.fastq SRR12690159-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,596,585 reads, 10,454,893 reads pseudoaligned [quant] estimated average fragment length: 257.402 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 947 rounds 52401 SRR12690159.ke.tsv 34699 SRR12690159.se.tsv 87100 total ==> SRR12690159.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.6 382 17.0704 Potri.005G024800.1.v4.1 1035 778.598 71 7.17846 Potri.004G059700.1.v4.1 961 704.823 13 1.45194 Potri.007G009000.2.v4.1 1416 1159.6 0 0 Potri.003G141000.2.v4.1 2943 2686.6 393.851 11.5403 Potri.016G087400.1.v4.1 270 82.9294 449 426.211 Potri.015G069301.1.v4.1 564 321.6 0 0 Potri.010G195200.1.v4.1 1773 1516.6 4 0.207623 Potri.012G127500.1.v4.1 977 720.715 43 4.69668 ==> SRR12690159.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 155 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 134 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR12690159 completed mapping pipeline successfully