Starting /dee2/code/volunteer_pipeline.sh SRR12690160 current disk space = 3056415707136 free memory = 1228157848 SRR12690160 SRAfilesize 577a79959b73ef7b6744d35c1f13ab4b SRR12690160.sra SRR12690160.sra file validated SRR12690160 is paired end SRR12690160 is conventional basespace SRR12690160 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690160_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6165 37.0 37.0 37.0 37.0 37.0 2 36.269 37.0 37.0 37.0 37.0 37.0 3 36.638 37.0 37.0 37.0 37.0 37.0 4 36.566 37.0 37.0 37.0 37.0 37.0 5 36.5855 37.0 37.0 37.0 37.0 37.0 6 36.576 37.0 37.0 37.0 37.0 37.0 7 36.5525 37.0 37.0 37.0 37.0 37.0 8 36.5335 37.0 37.0 37.0 37.0 37.0 9 36.6905 37.0 37.0 37.0 37.0 37.0 10-14 36.6248 37.0 37.0 37.0 37.0 37.0 15-19 36.6112 37.0 37.0 37.0 37.0 37.0 20-24 36.5898 37.0 37.0 37.0 37.0 37.0 25-29 36.55630000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.5338 37.0 37.0 37.0 37.0 37.0 35-39 36.5213 37.0 37.0 37.0 37.0 37.0 40-44 36.4733 37.0 37.0 37.0 37.0 37.0 45-49 36.4666 37.0 37.0 37.0 37.0 37.0 50-54 36.4412 37.0 37.0 37.0 37.0 37.0 55-59 36.398799999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.3557 37.0 37.0 37.0 37.0 37.0 65-69 36.3664 37.0 37.0 37.0 37.0 37.0 70-74 36.357600000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.3527 37.0 37.0 37.0 37.0 37.0 80-84 36.2779 37.0 37.0 37.0 37.0 37.0 85-89 36.293400000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2857 37.0 37.0 37.0 37.0 37.0 95-99 36.218 37.0 37.0 37.0 37.0 37.0 100-104 36.192 37.0 37.0 37.0 37.0 37.0 105-109 36.1949 37.0 37.0 37.0 37.0 37.0 110-114 36.1536 37.0 37.0 37.0 37.0 37.0 115-119 36.141299999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.0587 37.0 37.0 37.0 37.0 37.0 125-129 36.0023 37.0 37.0 37.0 37.0 37.0 130-134 36.0186 37.0 37.0 37.0 37.0 37.0 135-139 36.00410000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.833999999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.76370000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.5775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 0.0 24 2.0 25 0.0 26 4.0 27 3.0 28 10.0 29 19.0 30 23.0 31 24.0 32 39.0 33 76.0 34 102.0 35 324.0 36 3028.0 37 343.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.625 11.600000000000001 7.025 32.75 2 21.346057257659467 13.008538422903063 34.630838774485184 31.014565544952283 3 17.925 16.475 28.325 37.275000000000006 4 21.6 23.3 25.674999999999997 29.425 5 22.55 32.175 24.0 21.275 6 20.474999999999998 33.650000000000006 24.025 21.85 7 15.5 26.775 40.425 17.299999999999997 8 17.8 26.700000000000003 32.025 23.474999999999998 9 17.175 24.025 33.7 25.1 10-14 19.7 29.4 27.744999999999997 23.155 15-19 20.365 28.105000000000004 28.199999999999996 23.330000000000002 20-24 20.28 27.785 28.055000000000003 23.880000000000003 25-29 20.315 29.104999999999997 26.795 23.785 30-34 20.455000000000002 28.185 27.625 23.735 35-39 20.44 29.095 27.200000000000003 23.265 40-44 19.695 28.115000000000002 27.785 24.404999999999998 45-49 19.98 28.315 28.03 23.674999999999997 50-54 20.419999999999998 27.805000000000003 28.499999999999996 23.275000000000002 55-59 20.525 28.439999999999998 27.175 23.86 60-64 20.48 28.76 27.529999999999998 23.23 65-69 20.635 27.950000000000003 27.705000000000002 23.71 70-74 20.49 28.27 27.175 24.065 75-79 20.22 28.58 27.655 23.544999999999998 80-84 20.385 28.405 27.595 23.615 85-89 20.465 28.765 27.134999999999998 23.635 90-94 20.325 28.194999999999997 27.58 23.9 95-99 20.0 27.534999999999997 28.175 24.29 100-104 20.465 28.225 27.54 23.77 105-109 21.335 27.79 27.52 23.355 110-114 21.055 28.285 27.384999999999998 23.275000000000002 115-119 21.035 28.57 26.77 23.625 120-124 20.8 28.365000000000002 27.425 23.41 125-129 20.48 28.055000000000003 27.66 23.805 130-134 20.745 28.444999999999997 26.71 24.099999999999998 135-139 21.025 27.595 27.3 24.08 140-144 21.345 28.294999999999998 26.82 23.54 145-149 20.815 28.46 26.415 24.310000000000002 150-151 21.462500000000002 28.1875 26.5875 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 3.0 25 3.0 26 4.5 27 8.5 28 10.0 29 13.0 30 16.0 31 19.0 32 26.0 33 39.5 34 52.5 35 66.0 36 82.5 37 105.0 38 114.0 39 144.0 40 189.5 41 206.0 42 223.0 43 246.5 44 264.0 45 263.5 46 255.5 47 256.0 48 255.0 49 241.5 50 204.5 51 141.0 52 114.5 53 106.5 54 77.0 55 60.0 56 49.5 57 39.5 58 30.0 59 21.0 60 16.0 61 10.0 62 5.5 63 4.5 64 2.5 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.75 #Duplication Level Percentage of deduplicated Percentage of total 1 92.17983651226159 84.575 2 6.7029972752043605 12.3 3 1.0626702997275206 2.9250000000000003 4 0.05449591280653951 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.2999999999999998 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 3.1375 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.1125 0.0 0.0 0.0 0.0 122-123 4.5375 0.0 0.0 0.0 0.0 124-125 4.975 0.0 0.0 0.0 0.0 126-127 5.4625 0.0 0.0 0.0 0.0 128-129 5.9625 0.0 0.0 0.0 0.0 130-131 6.3375 0.0 0.0 0.0 0.0 132-133 7.0875 0.0 0.0 0.0 0.0 134-135 7.7625 0.0 0.0 0.0 0.0 136-137 8.3875 0.0 0.0 0.0 0.0 138-139 9.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690160 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690160_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3675 37.0 37.0 37.0 37.0 37.0 2 35.9405 37.0 37.0 37.0 37.0 37.0 3 36.196 37.0 37.0 37.0 37.0 37.0 4 36.127 37.0 37.0 37.0 37.0 37.0 5 36.2015 37.0 37.0 37.0 37.0 37.0 6 36.1355 37.0 37.0 37.0 37.0 37.0 7 36.141 37.0 37.0 37.0 37.0 37.0 8 36.3165 37.0 37.0 37.0 37.0 37.0 9 36.3365 37.0 37.0 37.0 37.0 37.0 10-14 36.2002 37.0 37.0 37.0 37.0 37.0 15-19 36.1825 37.0 37.0 37.0 37.0 37.0 20-24 36.180099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1348 37.0 37.0 37.0 37.0 37.0 30-34 36.0694 37.0 37.0 37.0 37.0 37.0 35-39 36.0903 37.0 37.0 37.0 37.0 37.0 40-44 35.9956 37.0 37.0 37.0 37.0 37.0 45-49 36.067 37.0 37.0 37.0 37.0 37.0 50-54 35.978500000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.0089 37.0 37.0 37.0 37.0 37.0 60-64 35.935900000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.8485 37.0 37.0 37.0 37.0 37.0 70-74 35.8067 37.0 37.0 37.0 37.0 37.0 75-79 35.829600000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.8464 37.0 37.0 37.0 37.0 37.0 85-89 35.8231 37.0 37.0 37.0 37.0 37.0 90-94 35.6805 37.0 37.0 37.0 37.0 37.0 95-99 35.7503 37.0 37.0 37.0 37.0 37.0 100-104 35.7385 37.0 37.0 37.0 37.0 37.0 105-109 35.768 37.0 37.0 37.0 37.0 37.0 110-114 35.6823 37.0 37.0 37.0 37.0 37.0 115-119 35.5685 37.0 37.0 37.0 37.0 37.0 120-124 35.4683 37.0 37.0 37.0 37.0 37.0 125-129 35.4597 37.0 37.0 37.0 37.0 37.0 130-134 35.3189 37.0 37.0 37.0 34.6 37.0 135-139 35.3202 37.0 37.0 37.0 37.0 37.0 140-144 35.17100000000001 37.0 37.0 37.0 34.6 37.0 145-149 35.0303 37.0 37.0 37.0 27.4 37.0 150-151 34.472750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 2.0 16 1.0 17 0.0 18 1.0 19 3.0 20 0.0 21 2.0 22 2.0 23 7.0 24 7.0 25 8.0 26 9.0 27 14.0 28 10.0 29 24.0 30 31.0 31 47.0 32 64.0 33 127.0 34 231.0 35 627.0 36 2549.0 37 227.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.45 25.6 8.625 22.325 2 27.450000000000003 27.200000000000003 28.925 16.425 3 22.225 25.35 32.725 19.7 4 23.3 34.050000000000004 24.4 18.25 5 23.849999999999998 37.65 21.325 17.175 6 20.724999999999998 41.6 20.625 17.05 7 22.325 23.724999999999998 34.075 19.875 8 20.849999999999998 28.875 26.174999999999997 24.099999999999998 9 22.675 25.825 28.775000000000002 22.725 10-14 22.865 29.770000000000003 26.284999999999997 21.08 15-19 22.68 28.07 28.065 21.185000000000002 20-24 22.705000000000002 28.07 28.044999999999998 21.18 25-29 23.445 28.29 27.21 21.055 30-34 23.215 28.1 27.915 20.77 35-39 22.689999999999998 28.165000000000003 27.43 21.715 40-44 23.45 27.229999999999997 28.025 21.295 45-49 22.735 27.6 28.115000000000002 21.55 50-54 22.93 27.575 28.21 21.285 55-59 22.814999999999998 27.625 28.294999999999998 21.265 60-64 22.865 27.894999999999996 27.91 21.33 65-69 22.86 28.105000000000004 27.73 21.305 70-74 22.555 28.1 27.72 21.625 75-79 22.945 28.595 27.315 21.145 80-84 22.689999999999998 28.26 27.345000000000002 21.705 85-89 24.01 28.625 26.419999999999998 20.945 90-94 23.385 28.325 27.389999999999997 20.9 95-99 23.135 28.055000000000003 27.24 21.57 100-104 23.674999999999997 28.360000000000003 27.005000000000003 20.96 105-109 23.595 28.215 27.105 21.085 110-114 23.46 28.075 27.625 20.84 115-119 24.19 28.294999999999998 26.895000000000003 20.62 120-124 24.255 28.555000000000003 26.665 20.525 125-129 24.275 28.134999999999998 26.985 20.605 130-134 24.72 28.194999999999997 26.795 20.29 135-139 24.88 28.095 27.305 19.72 140-144 24.805 27.98 26.86 20.355 145-149 26.63 27.79 25.885 19.695 150-151 26.6 28.499999999999996 26.0125 18.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 0.5 15 1.0 16 2.0 17 1.0 18 0.0 19 0.5 20 1.0 21 1.5 22 3.5 23 3.5 24 2.0 25 4.0 26 6.0 27 5.0 28 8.0 29 13.5 30 16.0 31 20.5 32 26.5 33 39.0 34 49.5 35 61.0 36 78.5 37 108.5 38 143.5 39 163.0 40 183.5 41 214.5 42 236.5 43 248.5 44 265.0 45 264.0 46 260.0 47 263.5 48 229.5 49 187.5 50 171.0 51 152.5 52 119.0 53 83.0 54 82.5 55 72.0 56 48.5 57 36.0 58 28.0 59 28.0 60 16.0 61 9.0 62 9.0 63 7.5 64 3.5 65 1.5 66 1.0 67 1.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.45848080588075 84.89999999999999 2 6.4252654505853535 11.799999999999999 3 0.9256738361012796 2.55 4 0.1361285053090117 0.5 5 0.054451402123604685 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.2999999999999998 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.7875 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.3125 0.0 0.0 0.0 0.0 118-119 3.6375 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.4125 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.3375 0.0 0.0 0.0 0.0 128-129 5.85 0.0 0.0 0.0 0.0 130-131 6.2625 0.0 0.0 0.0 0.0 132-133 6.9875 0.0 0.0 0.0 0.0 134-135 7.6625 0.0 0.0 0.0 0.0 136-137 8.2875 0.0 0.0 0.0 0.0 138-139 8.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704525 spots for SRR12690160.sra Written 704525 spots for SRR12690160.sra Read 704543 spots for SRR12690160.sra Written 704543 spots for SRR12690160.sra SRR ids: ['SRR12690160.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__fkfu51o SRR12690160.sra spots: 14090518 blocks: [[1, 704525], [704526, 1409050], [1409051, 2113575], [2113576, 2818100], [2818101, 3522625], [3522626, 4227150], [4227151, 4931675], [4931676, 5636200], [5636201, 6340725], [6340726, 7045250], [7045251, 7749775], [7749776, 8454300], [8454301, 9158825], [9158826, 9863350], [9863351, 10567875], [10567876, 11272400], [11272401, 11976925], [11976926, 12681450], [12681451, 13385975], [13385976, 14090518]] SRR12690160 file size 4766874 SRR12690160 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690160 SRR12690160_1.fastq SRR12690160_2.fastq Input file: SRR12690160_1.fastq Paired file: SRR12690160_2.fastq trimmed: SRR12690160-trimmed-pair1.fastq, SRR12690160-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:53:24 2025 >> started Mon Feb 10 19:53:40 2025 >> done (15.701s) 14090518 read pairs processed; of these: 42 ( 0.00%) short read pairs filtered out after trimming by size control 4674 ( 0.03%) empty read pairs filtered out after trimming by size control 14085802 (99.97%) read pairs available; of these: 1669043 (11.85%) trimmed read pairs available after processing 12416759 (88.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 6 0.00% 21 11 0.00% 22 11 0.00% 23 13 0.00% 24 13 0.00% 25 28 0.00% 26 19 0.00% 27 22 0.00% 28 18 0.00% 29 24 0.00% 30 29 0.00% 31 19 0.00% 32 21 0.00% 33 17 0.00% 34 25 0.00% 35 15 0.00% 36 28 0.00% 37 23 0.00% 38 31 0.00% 39 33 0.00% 40 28 0.00% 41 23 0.00% 42 40 0.00% 43 38 0.00% 44 37 0.00% 45 30 0.00% 46 55 0.00% 47 36 0.00% 48 51 0.00% 49 74 0.00% 50 56 0.00% 51 80 0.00% 52 90 0.00% 53 101 0.00% 54 109 0.00% 55 103 0.00% 56 129 0.00% 57 126 0.00% 58 193 0.00% 59 176 0.00% 60 228 0.00% 61 236 0.00% 62 299 0.00% 63 347 0.00% 64 355 0.00% 65 375 0.00% 66 433 0.00% 67 491 0.00% 68 549 0.00% 69 627 0.00% 70 736 0.01% 71 880 0.01% 72 965 0.01% 73 1148 0.01% 74 1224 0.01% 75 1235 0.01% 76 1527 0.01% 77 1615 0.01% 78 1692 0.01% 79 2060 0.01% 80 2278 0.02% 81 2667 0.02% 82 2968 0.02% 83 3200 0.02% 84 3678 0.03% 85 3956 0.03% 86 4176 0.03% 87 4571 0.03% 88 4816 0.03% 89 5281 0.04% 90 5726 0.04% 91 6353 0.05% 92 6847 0.05% 93 7523 0.05% 94 8212 0.06% 95 8765 0.06% 96 9175 0.07% 97 9645 0.07% 98 10099 0.07% 99 10852 0.08% 100 11619 0.08% 101 11870 0.08% 102 12584 0.09% 103 13606 0.10% 104 14206 0.10% 105 14640 0.10% 106 15554 0.11% 107 15896 0.11% 108 16380 0.12% 109 17295 0.12% 110 17550 0.12% 111 18541 0.13% 112 19394 0.14% 113 20374 0.14% 114 20889 0.15% 115 22131 0.16% 116 22652 0.16% 117 23514 0.17% 118 24083 0.17% 119 24498 0.17% 120 25618 0.18% 121 26322 0.19% 122 27288 0.19% 123 28162 0.20% 124 29801 0.21% 125 29964 0.21% 126 30816 0.22% 127 31801 0.23% 128 32042 0.23% 129 32790 0.23% 130 33673 0.24% 131 34218 0.24% 132 35395 0.25% 133 36831 0.26% 134 37283 0.26% 135 38320 0.27% 136 39429 0.28% 137 39572 0.28% 138 39689 0.28% 139 40987 0.29% 140 41772 0.30% 141 41868 0.30% 142 43468 0.31% 143 44303 0.31% 144 45584 0.32% 145 46589 0.33% 146 46685 0.33% 147 47180 0.33% 148 47959 0.34% 149 47828 0.34% 150 48731 0.35% 151 12416759 88.15% 14085802 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=21 prefix-density=0.81 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=26.86 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.8 sequence=AGAAAAACTTGGGACAAATTAAATTACATGCTCAGTAACAGTAGAGATAACAATCATAAAATCCACCCCCCCTGCCGGAACACCACCGACGACACAAACAGAAAGAGATCTTATTTAACCGCTAAACTCTTCCTCTTTGTGTGTCTCGATGACAACATCAGACGTAGGATAAGCAACACAGGTGAGAACCCAGCCTTCCTCTATCTGGTCATCATCAAGGAAGCTAGCATCAGACTGATCCACAGTCCCCTTCACAATCTTGCCAAGACATGAAGAGCATGAGCCAGCCCTGCATGAGTAGGGGAGGTCAATCTCTTCTGCCTCCTCAGCATGGTCAAGGATGTAGATGTCATCGGGGCATGCAAACTCCTTCTCACCATCAGGAGTGATGAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTA criterion=sequence-density sequence-density=1.33 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=1.32 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=31.56 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.9 sequence=GCCAAAACTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAAATTCAGCTTTCTTTGGCAACAGCTTGAAGAAAGTGAGCTCATCAAGGTTCACAAACTCCAAAATTTCACCAGGGAGCTTCAAGGTTGTTGCAGAGTACGATGAGAAGAAGCAGACCGACAAGGACAGATGGGGAGGCCTTGTTACAGACATGTCTGATGACCAACAAGATATCAGCAGAGGAAAGGGTATGGTGGACTCTCTTTTCCAAGCCCCCCAGGGAACTGGAACTCACAACCCCGTTTTGAATTCTTATGAGTATCTCAGTCAAGGTCTTCGTACGTACAACTTGGACAACAACATGGATGGTTTCTACATTGCTCCTGCTTTCATGGACAAGCTTGTTGTTC SRR12690160 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:54:44 Started mapping on | Feb 10 19:54:44 Finished on | Feb 10 19:56:10 Mapping speed, Million of reads per hour | 589.64 Number of input reads | 14085802 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13281186 Uniquely mapped reads % | 94.29% Average mapped length | 295.05 Number of splices: Total | 13371015 Number of splices: Annotated (sjdb) | 13089590 Number of splices: GT/AG | 13097862 Number of splices: GC/AG | 222698 Number of splices: AT/AC | 9064 Number of splices: Non-canonical | 41391 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309330 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 39637 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.10% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 495286 495286 495286 N_multimapping 309330 309330 309330 N_noFeature 459218 13119332 509154 N_ambiguous 199731 602 87450 UnstrandedReadsAssigned:12622237 PositiveStrandReadsAssigned:161252 NegativeStrandReadsAssigned:12684582 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690160 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690160-trimmed-pair1.fastq SRR12690160-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,085,802 reads, 12,714,189 reads pseudoaligned [quant] estimated average fragment length: 253.081 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR12690160.ke.tsv 34699 SRR12690160.se.tsv 87100 total ==> SRR12690160.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.92 282 11.6762 Potri.005G024800.1.v4.1 1035 782.919 142 13.2616 Potri.004G059700.1.v4.1 961 709.062 11 1.13431 Potri.007G009000.2.v4.1 1416 1163.92 0 0 Potri.003G141000.2.v4.1 2943 2690.92 562.467 15.2834 Potri.016G087400.1.v4.1 270 86.3599 526 445.346 Potri.015G069301.1.v4.1 564 325.774 0 0 Potri.010G195200.1.v4.1 1773 1520.92 3 0.144225 Potri.012G127500.1.v4.1 977 725.003 87 8.77412 ==> SRR12690160.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 114 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 175 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 49 SRR12690160 completed mapping pipeline successfully