Starting /dee2/code/volunteer_pipeline.sh SRR12690161 current disk space = 3056234655744 free memory = 1153052872 SRR12690161 SRAfilesize 8f3b3a391ccec403bc47c55934fdfb03 SRR12690161.sra SRR12690161.sra file validated SRR12690161 is paired end SRR12690161 is conventional basespace SRR12690161 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690161_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.583 37.0 37.0 37.0 37.0 37.0 2 36.30575 37.0 37.0 37.0 37.0 37.0 3 36.6345 37.0 37.0 37.0 37.0 37.0 4 36.5965 37.0 37.0 37.0 37.0 37.0 5 36.626 37.0 37.0 37.0 37.0 37.0 6 36.597 37.0 37.0 37.0 37.0 37.0 7 36.6455 37.0 37.0 37.0 37.0 37.0 8 36.5755 37.0 37.0 37.0 37.0 37.0 9 36.668 37.0 37.0 37.0 37.0 37.0 10-14 36.5938 37.0 37.0 37.0 37.0 37.0 15-19 36.5915 37.0 37.0 37.0 37.0 37.0 20-24 36.5699 37.0 37.0 37.0 37.0 37.0 25-29 36.5044 37.0 37.0 37.0 37.0 37.0 30-34 36.521499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.479099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.55049999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.4764 37.0 37.0 37.0 37.0 37.0 50-54 36.4275 37.0 37.0 37.0 37.0 37.0 55-59 36.3922 37.0 37.0 37.0 37.0 37.0 60-64 36.3733 37.0 37.0 37.0 37.0 37.0 65-69 36.3116 37.0 37.0 37.0 37.0 37.0 70-74 36.3554 37.0 37.0 37.0 37.0 37.0 75-79 36.331100000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.258599999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.3282 37.0 37.0 37.0 37.0 37.0 90-94 36.2793 37.0 37.0 37.0 37.0 37.0 95-99 36.2577 37.0 37.0 37.0 37.0 37.0 100-104 36.1726 37.0 37.0 37.0 37.0 37.0 105-109 36.127300000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1245 37.0 37.0 37.0 37.0 37.0 115-119 36.043600000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0045 37.0 37.0 37.0 37.0 37.0 125-129 36.0764 37.0 37.0 37.0 37.0 37.0 130-134 36.063599999999994 37.0 37.0 37.0 37.0 37.0 135-139 36.044 37.0 37.0 37.0 37.0 37.0 140-144 35.822199999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.8098 37.0 37.0 37.0 37.0 37.0 150-151 35.6075 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 2.0 26 5.0 27 6.0 28 13.0 29 12.0 30 17.0 31 38.0 32 36.0 33 77.0 34 109.0 35 323.0 36 2996.0 37 364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.85 12.675 5.75 35.725 2 19.46325558063707 11.963882618510159 37.27113117632305 31.30173062452972 3 16.825000000000003 14.649999999999999 30.3 38.224999999999994 4 21.05 23.75 25.674999999999997 29.525000000000002 5 23.325000000000003 32.2 24.25 20.225 6 22.1 33.025 24.275 20.599999999999998 7 15.825 27.275 38.875 18.025 8 17.925 25.924999999999997 32.1 24.05 9 18.075 23.3 34.325 24.3 10-14 19.79 29.165000000000003 27.63 23.415 15-19 20.145 27.855 28.165000000000003 23.835 20-24 19.830000000000002 28.225 27.815 24.13 25-29 20.395 27.450000000000003 28.505000000000003 23.65 30-34 20.26 27.905 27.91 23.925 35-39 20.724999999999998 27.38 28.475 23.419999999999998 40-44 19.875 28.365000000000002 27.51 24.25 45-49 20.19 27.6 27.985 24.224999999999998 50-54 20.875 28.115000000000002 27.215 23.794999999999998 55-59 20.244999999999997 28.21 27.650000000000002 23.895 60-64 20.71 28.16 27.060000000000002 24.07 65-69 20.79 27.894999999999996 27.634999999999998 23.68 70-74 20.955 27.73 27.845 23.47 75-79 20.76 28.16 27.52 23.56 80-84 20.705000000000002 27.500000000000004 28.26 23.535 85-89 21.17 28.33 27.334999999999997 23.165 90-94 20.990000000000002 27.67 27.265 24.075 95-99 21.325 27.82 27.625 23.23 100-104 21.095 28.49 26.805 23.61 105-109 20.79 28.04 27.134999999999998 24.035 110-114 20.445 28.685 27.439999999999998 23.43 115-119 20.815 28.025 27.41 23.75 120-124 21.245 27.67 27.355 23.73 125-129 21.195 27.939999999999998 27.525 23.34 130-134 21.095 27.810000000000002 27.245 23.849999999999998 135-139 21.33 27.275 27.389999999999997 24.005000000000003 140-144 21.33 27.644999999999996 27.215 23.810000000000002 145-149 20.96 27.855 27.505000000000003 23.68 150-151 21.4 27.825 27.3125 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 1.0 24 2.0 25 3.5 26 4.5 27 2.5 28 3.0 29 11.0 30 28.0 31 29.5 32 24.5 33 31.0 34 48.0 35 71.5 36 85.5 37 103.5 38 123.0 39 139.0 40 169.0 41 193.5 42 215.5 43 243.5 44 247.5 45 253.5 46 259.0 47 253.5 48 249.0 49 219.5 50 190.0 51 157.5 52 126.5 53 118.0 54 102.0 55 73.5 56 55.5 57 47.0 58 33.5 59 25.0 60 15.5 61 9.5 62 6.5 63 5.0 64 6.5 65 4.5 66 1.5 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.0 #Duplication Level Percentage of deduplicated Percentage of total 1 90.41666666666667 81.375 2 8.305555555555555 14.95 3 1.1111111111111112 3.0 4 0.1388888888888889 0.5 5 0.0 0.0 6 0.0 0.0 7 0.027777777777777776 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTACCAAAGCCTCCACTCTTCTTCTTCTGGGGGACAGCAACAGAGTTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.9500000000000002 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.8375 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 3.975 0.0 0.0 0.0 0.0 128-129 4.2125 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.75 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAATG 10 0.006830828 145.0 2 >>END_MODULE SRR12690161 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690161_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.278 37.0 37.0 37.0 37.0 37.0 2 36.0565 37.0 37.0 37.0 37.0 37.0 3 36.1275 37.0 37.0 37.0 37.0 37.0 4 36.1885 37.0 37.0 37.0 37.0 37.0 5 36.2445 37.0 37.0 37.0 37.0 37.0 6 36.241 37.0 37.0 37.0 37.0 37.0 7 36.229 37.0 37.0 37.0 37.0 37.0 8 36.3445 37.0 37.0 37.0 37.0 37.0 9 36.2875 37.0 37.0 37.0 37.0 37.0 10-14 36.2302 37.0 37.0 37.0 37.0 37.0 15-19 36.2595 37.0 37.0 37.0 37.0 37.0 20-24 36.2417 37.0 37.0 37.0 37.0 37.0 25-29 36.1693 37.0 37.0 37.0 37.0 37.0 30-34 36.117900000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.104 37.0 37.0 37.0 37.0 37.0 40-44 36.086400000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.105 37.0 37.0 37.0 37.0 37.0 50-54 36.026300000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.0133 37.0 37.0 37.0 37.0 37.0 60-64 36.0183 37.0 37.0 37.0 37.0 37.0 65-69 35.9927 37.0 37.0 37.0 37.0 37.0 70-74 35.8719 37.0 37.0 37.0 37.0 37.0 75-79 35.915699999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.897800000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.89110000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.8416 37.0 37.0 37.0 37.0 37.0 95-99 35.788500000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.8797 37.0 37.0 37.0 37.0 37.0 105-109 35.8138 37.0 37.0 37.0 37.0 37.0 110-114 35.699 37.0 37.0 37.0 37.0 37.0 115-119 35.649 37.0 37.0 37.0 37.0 37.0 120-124 35.6359 37.0 37.0 37.0 37.0 37.0 125-129 35.5244 37.0 37.0 37.0 37.0 37.0 130-134 35.409200000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.3839 37.0 37.0 37.0 37.0 37.0 140-144 35.2771 37.0 37.0 37.0 34.6 37.0 145-149 35.07039999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.650000000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 8.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 3.0 22 3.0 23 6.0 24 9.0 25 7.0 26 8.0 27 12.0 28 12.0 29 21.0 30 22.0 31 49.0 32 64.0 33 105.0 34 192.0 35 501.0 36 2701.0 37 266.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.575 26.150000000000002 8.75 22.525000000000002 2 29.725 26.55 27.6 16.125 3 19.950000000000003 28.7 30.775000000000002 20.575 4 22.0 35.775 23.549999999999997 18.675 5 25.45 37.05 20.925 16.575 6 21.475 40.125 20.95 17.45 7 20.45 23.875 36.85 18.825 8 20.875 26.825 27.500000000000004 24.8 9 22.225 24.425 29.7 23.65 10-14 23.18 29.709999999999997 25.86 21.25 15-19 22.63 28.33 27.584999999999997 21.455 20-24 23.044999999999998 28.875 27.01 21.07 25-29 22.75 27.96 28.205000000000002 21.085 30-34 22.14 28.144999999999996 28.494999999999997 21.22 35-39 21.884999999999998 28.765 27.735 21.615000000000002 40-44 23.005 28.02 27.68 21.295 45-49 22.545 28.17 27.224999999999998 22.06 50-54 22.625 27.365000000000002 28.249999999999996 21.759999999999998 55-59 22.935 27.384999999999998 27.794999999999998 21.884999999999998 60-64 23.155 27.045 28.384999999999998 21.415 65-69 23.32 27.665 27.744999999999997 21.27 70-74 23.105 28.035 27.224999999999998 21.634999999999998 75-79 22.99 27.544999999999998 27.894999999999996 21.57 80-84 23.165 28.349999999999998 27.134999999999998 21.349999999999998 85-89 23.375 27.71 27.384999999999998 21.529999999999998 90-94 23.71 27.825 26.88 21.584999999999997 95-99 23.465 28.215 26.845000000000002 21.475 100-104 23.36 27.195000000000004 27.83 21.615000000000002 105-109 23.095 27.52 27.884999999999998 21.5 110-114 23.465 28.365000000000002 27.284999999999997 20.885 115-119 24.044999999999998 28.175 27.11 20.669999999999998 120-124 24.404999999999998 27.87 26.955000000000002 20.77 125-129 24.025 27.73 27.305 20.94 130-134 25.259999999999998 27.1 27.025 20.615 135-139 23.84 27.634999999999998 27.605 20.919999999999998 140-144 25.09 27.900000000000002 26.735 20.275000000000002 145-149 25.82 27.99 25.974999999999998 20.215 150-151 25.412499999999998 28.050000000000004 26.700000000000003 19.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 2.0 25 2.5 26 4.0 27 3.0 28 6.0 29 10.0 30 12.0 31 12.0 32 24.5 33 33.0 34 43.5 35 64.0 36 82.0 37 103.5 38 136.5 39 178.0 40 210.0 41 235.5 42 241.5 43 245.5 44 253.0 45 257.0 46 270.0 47 265.0 48 227.0 49 194.0 50 161.5 51 122.5 52 105.5 53 102.5 54 101.5 55 81.0 56 45.5 57 31.0 58 29.5 59 23.5 60 17.0 61 12.5 62 9.5 63 8.5 64 5.0 65 3.0 66 2.5 67 0.5 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.74228523769808 81.6 2 7.839866555462886 14.099999999999998 3 1.05643591882124 2.85 4 0.25020850708924103 0.8999999999999999 5 0.08340283569641367 0.375 6 0.0 0.0 7 0.027800945232137893 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAATCAAAGCAAACAAGGGGTGCTAGAAGATAAGAAGATGGCTTCCCTT 7 0.17500000000000002 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit GCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.9249999999999998 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.8375 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 3.975 0.0 0.0 0.0 0.0 128-129 4.2125 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.75 0.0 0.0 0.0 0.0 134-135 5.262499999999999 0.0 0.0 0.0 0.0 136-137 5.825 0.0 0.0 0.0 0.0 138-139 6.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862128 spots for SRR12690161.sra Written 862128 spots for SRR12690161.sra Read 862135 spots for SRR12690161.sra Written 862135 spots for SRR12690161.sra SRR ids: ['SRR12690161.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_skpt3i1z SRR12690161.sra spots: 17242567 blocks: [[1, 862128], [862129, 1724256], [1724257, 2586384], [2586385, 3448512], [3448513, 4310640], [4310641, 5172768], [5172769, 6034896], [6034897, 6897024], [6897025, 7759152], [7759153, 8621280], [8621281, 9483408], [9483409, 10345536], [10345537, 11207664], [11207665, 12069792], [12069793, 12931920], [12931921, 13794048], [13794049, 14656176], [14656177, 15518304], [15518305, 16380432], [16380433, 17242567]] SRR12690161 file size 5838078 SRR12690161 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690161 SRR12690161_1.fastq SRR12690161_2.fastq Input file: SRR12690161_1.fastq Paired file: SRR12690161_2.fastq trimmed: SRR12690161-trimmed-pair1.fastq, SRR12690161-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:00:51 2025 >> started Mon Feb 10 20:01:20 2025 >> done (29.346s) 17242567 read pairs processed; of these: 33 ( 0.00%) short read pairs filtered out after trimming by size control 2545 ( 0.01%) empty read pairs filtered out after trimming by size control 17239989 (99.99%) read pairs available; of these: 1645153 ( 9.54%) trimmed read pairs available after processing 15594836 (90.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 8 0.00% 21 6 0.00% 22 16 0.00% 23 18 0.00% 24 18 0.00% 25 21 0.00% 26 31 0.00% 27 29 0.00% 28 17 0.00% 29 23 0.00% 30 24 0.00% 31 18 0.00% 32 30 0.00% 33 30 0.00% 34 25 0.00% 35 27 0.00% 36 19 0.00% 37 30 0.00% 38 27 0.00% 39 25 0.00% 40 22 0.00% 41 38 0.00% 42 37 0.00% 43 42 0.00% 44 35 0.00% 45 35 0.00% 46 51 0.00% 47 56 0.00% 48 64 0.00% 49 77 0.00% 50 55 0.00% 51 72 0.00% 52 82 0.00% 53 108 0.00% 54 94 0.00% 55 83 0.00% 56 104 0.00% 57 153 0.00% 58 132 0.00% 59 176 0.00% 60 222 0.00% 61 217 0.00% 62 231 0.00% 63 265 0.00% 64 279 0.00% 65 302 0.00% 66 318 0.00% 67 361 0.00% 68 408 0.00% 69 494 0.00% 70 584 0.00% 71 652 0.00% 72 747 0.00% 73 887 0.01% 74 944 0.01% 75 1078 0.01% 76 1137 0.01% 77 1295 0.01% 78 1452 0.01% 79 1667 0.01% 80 1657 0.01% 81 2020 0.01% 82 2285 0.01% 83 2453 0.01% 84 2818 0.02% 85 3022 0.02% 86 3317 0.02% 87 3601 0.02% 88 3858 0.02% 89 4325 0.03% 90 4688 0.03% 91 5139 0.03% 92 5642 0.03% 93 6008 0.03% 94 6806 0.04% 95 7213 0.04% 96 7696 0.04% 97 8003 0.05% 98 8616 0.05% 99 9170 0.05% 100 9768 0.06% 101 10001 0.06% 102 10951 0.06% 103 11720 0.07% 104 12332 0.07% 105 12669 0.07% 106 13534 0.08% 107 14095 0.08% 108 14862 0.09% 109 15328 0.09% 110 15842 0.09% 111 16826 0.10% 112 17438 0.10% 113 18478 0.11% 114 19057 0.11% 115 20245 0.12% 116 21028 0.12% 117 21848 0.13% 118 22824 0.13% 119 23373 0.14% 120 24131 0.14% 121 25131 0.15% 122 25991 0.15% 123 27678 0.16% 124 28675 0.17% 125 28924 0.17% 126 29970 0.17% 127 30936 0.18% 128 31921 0.19% 129 32873 0.19% 130 33175 0.19% 131 34128 0.20% 132 36152 0.21% 133 37202 0.22% 134 38010 0.22% 135 39093 0.23% 136 40147 0.23% 137 40422 0.23% 138 41466 0.24% 139 42712 0.25% 140 43818 0.25% 141 44456 0.26% 142 46155 0.27% 143 46919 0.27% 144 48677 0.28% 145 49909 0.29% 146 50420 0.29% 147 50923 0.30% 148 52243 0.30% 149 52416 0.30% 150 54420 0.32% 151 15594836 90.46% 17239989 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=19 prefix-density=0.76 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=18.68 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.0 sequence=AGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=20 prefix-density=0.99 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=29.50 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.0 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGACTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12690161 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:02:04 Started mapping on | Feb 10 20:02:05 Finished on | Feb 10 20:03:50 Mapping speed, Million of reads per hour | 591.09 Number of input reads | 17239989 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16245768 Uniquely mapped reads % | 94.23% Average mapped length | 296.52 Number of splices: Total | 16072757 Number of splices: Annotated (sjdb) | 15721595 Number of splices: GT/AG | 15752561 Number of splices: GC/AG | 259217 Number of splices: AT/AC | 10490 Number of splices: Non-canonical | 50489 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.10 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429869 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 51445 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 564352 564352 564352 N_multimapping 429869 429869 429869 N_noFeature 545452 16041830 604670 N_ambiguous 247013 808 101828 UnstrandedReadsAssigned:15453303 PositiveStrandReadsAssigned:203130 NegativeStrandReadsAssigned:15539270 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690161 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690161-trimmed-pair1.fastq SRR12690161-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,239,989 reads, 15,571,789 reads pseudoaligned [quant] estimated average fragment length: 253.13 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR12690161.ke.tsv 34699 SRR12690161.se.tsv 87100 total ==> SRR12690161.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.87 348 10.7215 Potri.005G024800.1.v4.1 1035 782.87 181 12.5783 Potri.004G059700.1.v4.1 961 709.076 19 1.45779 Potri.007G009000.2.v4.1 1416 1163.87 0 0 Potri.003G141000.2.v4.1 2943 2690.87 671 13.5664 Potri.016G087400.1.v4.1 270 80.7801 599.084 403.476 Potri.015G069301.1.v4.1 564 324.962 0 0 Potri.010G195200.1.v4.1 1773 1520.87 8 0.286176 Potri.012G127500.1.v4.1 977 724.964 311 23.3388 ==> SRR12690161.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 443 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 180 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 27 SRR12690161 completed mapping pipeline successfully