Starting /dee2/code/volunteer_pipeline.sh SRR12690162 current disk space = 3056447221760 free memory = 1204401432 SRR12690162 SRAfilesize e4df8aeb89ef2f697c51e429e257f5cf SRR12690162.sra SRR12690162.sra file validated SRR12690162 is paired end SRR12690162 is conventional basespace SRR12690162 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690162_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.588 37.0 37.0 37.0 37.0 37.0 2 36.40775 37.0 37.0 37.0 37.0 37.0 3 36.643 37.0 37.0 37.0 37.0 37.0 4 36.6065 37.0 37.0 37.0 37.0 37.0 5 36.748 37.0 37.0 37.0 37.0 37.0 6 36.676 37.0 37.0 37.0 37.0 37.0 7 36.5225 37.0 37.0 37.0 37.0 37.0 8 36.6425 37.0 37.0 37.0 37.0 37.0 9 36.682 37.0 37.0 37.0 37.0 37.0 10-14 36.632999999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.606899999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.568 37.0 37.0 37.0 37.0 37.0 25-29 36.5689 37.0 37.0 37.0 37.0 37.0 30-34 36.516299999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.5106 37.0 37.0 37.0 37.0 37.0 40-44 36.498000000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.474900000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4751 37.0 37.0 37.0 37.0 37.0 55-59 36.434000000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.355599999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3389 37.0 37.0 37.0 37.0 37.0 70-74 36.337799999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.3534 37.0 37.0 37.0 37.0 37.0 80-84 36.25750000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.320100000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.2275 37.0 37.0 37.0 37.0 37.0 95-99 36.2342 37.0 37.0 37.0 37.0 37.0 100-104 36.1765 37.0 37.0 37.0 37.0 37.0 105-109 36.147000000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.1609 37.0 37.0 37.0 37.0 37.0 115-119 36.0868 37.0 37.0 37.0 37.0 37.0 120-124 36.052499999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0203 37.0 37.0 37.0 37.0 37.0 130-134 35.9714 37.0 37.0 37.0 37.0 37.0 135-139 35.925 37.0 37.0 37.0 37.0 37.0 140-144 35.7264 37.0 37.0 37.0 37.0 37.0 145-149 35.7168 37.0 37.0 37.0 37.0 37.0 150-151 35.50775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 1.0 25 2.0 26 3.0 27 3.0 28 19.0 29 11.0 30 16.0 31 48.0 32 37.0 33 79.0 34 111.0 35 293.0 36 3030.0 37 345.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.175000000000004 12.049999999999999 7.75 43.025000000000006 2 19.177738781649538 14.013537227375284 36.87641012785159 29.93231386312359 3 16.975 14.725 28.825 39.475 4 20.75 23.525 24.95 30.775000000000002 5 23.400000000000002 29.5 24.55 22.55 6 21.0 34.525 23.5 20.974999999999998 7 15.975 26.650000000000002 40.050000000000004 17.325 8 17.974999999999998 26.35 32.85 22.825 9 17.025000000000002 23.925 36.5 22.55 10-14 19.814999999999998 29.18 27.85 23.155 15-19 19.79 27.515 28.660000000000004 24.035 20-24 19.645000000000003 28.155 28.48 23.72 25-29 20.06 28.084999999999997 27.875 23.98 30-34 20.755000000000003 28.110000000000003 27.55 23.585 35-39 20.435 28.405 27.74 23.419999999999998 40-44 20.655 27.88 27.534999999999997 23.93 45-49 20.580000000000002 27.650000000000002 28.02 23.75 50-54 20.915 27.694999999999997 28.255000000000003 23.135 55-59 19.785 28.144999999999996 28.125 23.945 60-64 20.44 27.925 27.49 24.145 65-69 20.580000000000002 27.865000000000002 27.76 23.794999999999998 70-74 20.885 28.050000000000004 27.465 23.599999999999998 75-79 20.29 28.389999999999997 27.229999999999997 24.09 80-84 20.22 28.165000000000003 28.125 23.49 85-89 20.875 28.27 27.05 23.805 90-94 20.685000000000002 27.425 27.77 24.12 95-99 20.77 27.725 27.555000000000003 23.95 100-104 20.52 28.24 27.21 24.03 105-109 20.985 28.044999999999998 27.68 23.29 110-114 20.65 27.855 27.99 23.505000000000003 115-119 21.45 28.38 26.784999999999997 23.385 120-124 20.995 27.439999999999998 27.445000000000004 24.12 125-129 21.45 27.834999999999997 26.965 23.75 130-134 21.575 27.860000000000003 27.175 23.39 135-139 21.425 27.975 26.99 23.61 140-144 21.075 28.37 26.575 23.98 145-149 21.26 27.93 27.355 23.455000000000002 150-151 21.15 28.000000000000004 26.5875 24.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 2.5 26 4.0 27 5.0 28 6.0 29 8.0 30 10.0 31 20.0 32 32.0 33 39.0 34 51.0 35 66.5 36 93.5 37 100.5 38 112.5 39 141.0 40 171.0 41 206.5 42 237.0 43 254.0 44 243.5 45 251.0 46 273.0 47 280.5 48 261.5 49 229.0 50 195.5 51 158.0 52 120.5 53 95.5 54 76.5 55 55.0 56 47.5 57 37.5 58 31.5 59 29.5 60 18.0 61 12.5 62 6.5 63 2.0 64 2.0 65 1.0 66 2.5 67 2.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.10024516480523 84.52499999999999 2 7.000817216017434 12.85 3 0.789975483519477 2.175 4 0.08172160174339417 0.3 5 0.0 0.0 6 0.027240533914464723 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACAAAGAATAGCAACCAAATTTTATGATACATGAGGGAGTCATGACA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.4375 0.0 0.0 0.0 0.0 120-121 3.7249999999999996 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.8125 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.6 0.0 0.0 0.0 0.0 132-133 6.074999999999999 0.0 0.0 0.0 0.0 134-135 6.5125 0.0 0.0 0.0 0.0 136-137 7.0375 0.0 0.0 0.0 0.0 138-139 7.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAATC 10 0.006830828 145.0 7 >>END_MODULE SRR12690162 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690162_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3385 37.0 37.0 37.0 37.0 37.0 2 36.0125 37.0 37.0 37.0 37.0 37.0 3 36.146 37.0 37.0 37.0 37.0 37.0 4 36.18 37.0 37.0 37.0 37.0 37.0 5 36.279 37.0 37.0 37.0 37.0 37.0 6 36.163 37.0 37.0 37.0 37.0 37.0 7 36.1855 37.0 37.0 37.0 37.0 37.0 8 36.2835 37.0 37.0 37.0 37.0 37.0 9 36.3015 37.0 37.0 37.0 37.0 37.0 10-14 36.2973 37.0 37.0 37.0 37.0 37.0 15-19 36.301300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.2364 37.0 37.0 37.0 37.0 37.0 25-29 36.174699999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.1894 37.0 37.0 37.0 37.0 37.0 35-39 36.148700000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1253 37.0 37.0 37.0 37.0 37.0 45-49 36.1339 37.0 37.0 37.0 37.0 37.0 50-54 36.0868 37.0 37.0 37.0 37.0 37.0 55-59 36.0599 37.0 37.0 37.0 37.0 37.0 60-64 36.0045 37.0 37.0 37.0 37.0 37.0 65-69 35.9942 37.0 37.0 37.0 37.0 37.0 70-74 35.9114 37.0 37.0 37.0 37.0 37.0 75-79 35.947700000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.9799 37.0 37.0 37.0 37.0 37.0 85-89 35.9396 37.0 37.0 37.0 37.0 37.0 90-94 35.8008 37.0 37.0 37.0 37.0 37.0 95-99 35.8311 37.0 37.0 37.0 37.0 37.0 100-104 35.897499999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.8211 37.0 37.0 37.0 37.0 37.0 110-114 35.7778 37.0 37.0 37.0 37.0 37.0 115-119 35.701 37.0 37.0 37.0 37.0 37.0 120-124 35.593 37.0 37.0 37.0 37.0 37.0 125-129 35.5824 37.0 37.0 37.0 37.0 37.0 130-134 35.4218 37.0 37.0 37.0 34.6 37.0 135-139 35.4233 37.0 37.0 37.0 34.6 37.0 140-144 35.3756 37.0 37.0 37.0 37.0 37.0 145-149 35.220000000000006 37.0 37.0 37.0 29.8 37.0 150-151 34.818 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 0.0 16 0.0 17 2.0 18 0.0 19 1.0 20 2.0 21 5.0 22 3.0 23 6.0 24 5.0 25 7.0 26 10.0 27 10.0 28 16.0 29 20.0 30 26.0 31 49.0 32 71.0 33 91.0 34 189.0 35 547.0 36 2695.0 37 242.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.425000000000004 23.474999999999998 11.425 28.675 2 27.474999999999998 28.325 28.775000000000002 15.425 3 19.975 29.475 30.275000000000002 20.275000000000002 4 23.075000000000003 34.9 24.2 17.825 5 23.275000000000002 38.375 21.2 17.150000000000002 6 20.25 39.65 21.9 18.2 7 19.6 23.3 37.8 19.3 8 21.25 25.025 28.299999999999997 25.424999999999997 9 22.425 24.474999999999998 29.349999999999998 23.75 10-14 23.549999999999997 29.445 26.119999999999997 20.885 15-19 22.54 28.555000000000003 27.325 21.58 20-24 22.415 28.625 27.315 21.645 25-29 22.29 28.54 27.98 21.19 30-34 23.0 28.42 27.66 20.919999999999998 35-39 22.925 28.470000000000002 27.38 21.224999999999998 40-44 22.625 28.455000000000002 27.575 21.345 45-49 23.150000000000002 27.794999999999998 27.855 21.2 50-54 23.380000000000003 27.925 27.265 21.43 55-59 22.75 28.18 27.785 21.285 60-64 22.96 27.560000000000002 28.03 21.45 65-69 22.95 28.18 27.555000000000003 21.315 70-74 23.805 27.725 27.0 21.47 75-79 22.63 27.82 27.605 21.945 80-84 23.28 28.165000000000003 26.77 21.785 85-89 23.89 28.43 26.855 20.825 90-94 23.380000000000003 28.505000000000003 27.255000000000003 20.86 95-99 23.355 27.96 27.67 21.015 100-104 23.895 27.735 27.375 20.995 105-109 23.69 27.250000000000004 27.605 21.455 110-114 23.765 28.51 26.955000000000002 20.77 115-119 24.02 27.62 27.505000000000003 20.855 120-124 23.94 28.08 27.37 20.61 125-129 24.099999999999998 28.455000000000002 27.025 20.419999999999998 130-134 24.515 27.85 26.919999999999998 20.715 135-139 25.180000000000003 28.125 25.825 20.87 140-144 25.495 28.515 25.990000000000002 20.0 145-149 25.715 28.075 26.090000000000003 20.119999999999997 150-151 25.6 28.012500000000003 26.787499999999998 19.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 1.0 20 1.5 21 1.0 22 2.5 23 2.5 24 1.0 25 2.0 26 3.5 27 4.5 28 5.0 29 8.0 30 14.0 31 18.5 32 19.0 33 28.5 34 53.0 35 68.5 36 78.0 37 99.5 38 122.0 39 161.0 40 213.5 41 249.5 42 266.5 43 264.5 44 257.5 45 251.5 46 243.0 47 254.5 48 242.0 49 203.5 50 181.0 51 157.5 52 119.5 53 93.5 54 73.5 55 49.0 56 43.5 57 35.5 58 25.5 59 22.5 60 14.5 61 10.0 62 11.0 63 7.0 64 4.5 65 1.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.25736095965104 84.6 2 6.652126499454744 12.2 3 0.9269356597600873 2.55 4 0.13631406761177753 0.5 5 0.0 0.0 6 0.02726281352235551 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAAGCAAATTTCTTTGAGAGAAGGGTAGGGGACTATCAAAAGGCTTC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.525 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.7375 0.0 0.0 0.0 0.0 128-129 5.175 0.0 0.0 0.0 0.0 130-131 5.5125 0.0 0.0 0.0 0.0 132-133 5.975 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 6.925000000000001 0.0 0.0 0.0 0.0 138-139 7.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACCC 10 0.006830828 145.0 3 TTCTTAT 10 0.006830828 145.0 6 ATTCTTA 10 0.006830828 145.0 5 >>END_MODULE Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637574 spots for SRR12690162.sra Written 637574 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra Read 637571 spots for SRR12690162.sra Written 637571 spots for SRR12690162.sra SRR ids: ['SRR12690162.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6ybk3prl SRR12690162.sra spots: 12751423 blocks: [[1, 637571], [637572, 1275142], [1275143, 1912713], [1912714, 2550284], [2550285, 3187855], [3187856, 3825426], [3825427, 4462997], [4462998, 5100568], [5100569, 5738139], [5738140, 6375710], [6375711, 7013281], [7013282, 7650852], [7650853, 8288423], [8288424, 8925994], [8925995, 9563565], [9563566, 10201136], [10201137, 10838707], [10838708, 11476278], [11476279, 12113849], [12113850, 12751423]] SRR12690162 file size 4311791 SRR12690162 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690162 SRR12690162_1.fastq SRR12690162_2.fastq Input file: SRR12690162_1.fastq Paired file: SRR12690162_2.fastq trimmed: SRR12690162-trimmed-pair1.fastq, SRR12690162-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:51:45 2025 >> started Mon Feb 10 19:52:01 2025 >> done (15.998s) 12751423 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 3288 ( 0.03%) empty read pairs filtered out after trimming by size control 12748122 (99.97%) read pairs available; of these: 1443694 (11.32%) trimmed read pairs available after processing 11304428 (88.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 8 0.00% 21 6 0.00% 22 3 0.00% 23 7 0.00% 24 6 0.00% 25 11 0.00% 26 14 0.00% 27 15 0.00% 28 11 0.00% 29 10 0.00% 30 13 0.00% 31 13 0.00% 32 9 0.00% 33 18 0.00% 34 28 0.00% 35 20 0.00% 36 28 0.00% 37 23 0.00% 38 24 0.00% 39 24 0.00% 40 30 0.00% 41 32 0.00% 42 45 0.00% 43 29 0.00% 44 31 0.00% 45 17 0.00% 46 33 0.00% 47 39 0.00% 48 53 0.00% 49 71 0.00% 50 66 0.00% 51 86 0.00% 52 81 0.00% 53 89 0.00% 54 98 0.00% 55 84 0.00% 56 90 0.00% 57 116 0.00% 58 121 0.00% 59 165 0.00% 60 180 0.00% 61 246 0.00% 62 245 0.00% 63 248 0.00% 64 309 0.00% 65 269 0.00% 66 374 0.00% 67 411 0.00% 68 420 0.00% 69 484 0.00% 70 546 0.00% 71 636 0.00% 72 717 0.01% 73 762 0.01% 74 931 0.01% 75 1053 0.01% 76 1138 0.01% 77 1246 0.01% 78 1372 0.01% 79 1602 0.01% 80 1685 0.01% 81 1809 0.01% 82 2226 0.02% 83 2362 0.02% 84 2671 0.02% 85 3115 0.02% 86 3337 0.03% 87 3543 0.03% 88 3925 0.03% 89 3993 0.03% 90 4468 0.04% 91 4924 0.04% 92 5181 0.04% 93 5752 0.05% 94 6143 0.05% 95 6765 0.05% 96 7150 0.06% 97 7719 0.06% 98 8105 0.06% 99 8685 0.07% 100 9183 0.07% 101 9411 0.07% 102 10291 0.08% 103 10869 0.09% 104 11271 0.09% 105 11909 0.09% 106 12897 0.10% 107 13297 0.10% 108 13770 0.11% 109 14582 0.11% 110 14682 0.12% 111 15423 0.12% 112 16073 0.13% 113 16533 0.13% 114 17485 0.14% 115 18114 0.14% 116 18974 0.15% 117 20034 0.16% 118 20692 0.16% 119 21395 0.17% 120 21696 0.17% 121 22594 0.18% 122 23235 0.18% 123 24155 0.19% 124 25179 0.20% 125 25405 0.20% 126 26315 0.21% 127 27219 0.21% 128 27899 0.22% 129 28850 0.23% 130 29486 0.23% 131 30200 0.24% 132 30942 0.24% 133 32180 0.25% 134 32791 0.26% 135 33404 0.26% 136 34505 0.27% 137 34785 0.27% 138 35458 0.28% 139 37052 0.29% 140 37271 0.29% 141 38372 0.30% 142 39605 0.31% 143 40171 0.32% 144 40639 0.32% 145 41646 0.33% 146 42092 0.33% 147 42659 0.33% 148 43611 0.34% 149 43997 0.35% 150 44980 0.35% 151 11304428 88.68% 12748122 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=14 prefix-density=0.61 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=157.51 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.4 sequence=CTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATTCC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=20 prefix-density=0.74 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=56.58 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12690162 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:52:48 Started mapping on | Feb 10 19:52:48 Finished on | Feb 10 19:54:04 Mapping speed, Million of reads per hour | 603.86 Number of input reads | 12748122 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12142614 Uniquely mapped reads % | 95.25% Average mapped length | 295.81 Number of splices: Total | 12465083 Number of splices: Annotated (sjdb) | 12220062 Number of splices: GT/AG | 12206602 Number of splices: GC/AG | 220361 Number of splices: AT/AC | 7968 Number of splices: Non-canonical | 30152 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283625 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 53196 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.00% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 321883 321883 321883 N_multimapping 283625 283625 283625 N_noFeature 373514 12018014 409887 N_ambiguous 161806 661 73146 UnstrandedReadsAssigned:11607294 PositiveStrandReadsAssigned:123939 NegativeStrandReadsAssigned:11659581 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690162 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690162-trimmed-pair1.fastq SRR12690162-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,748,122 reads, 11,736,557 reads pseudoaligned [quant] estimated average fragment length: 241.979 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR12690162.ke.tsv 34699 SRR12690162.se.tsv 87100 total ==> SRR12690162.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.02 360 16.9026 Potri.005G024800.1.v4.1 1035 794.021 261 27.4254 Potri.004G059700.1.v4.1 961 720.119 50 5.79309 Potri.007G009000.2.v4.1 1416 1175.02 0 0 Potri.003G141000.2.v4.1 2943 2702.02 481.653 14.8727 Potri.016G087400.1.v4.1 270 83.2743 621 622.193 Potri.015G069301.1.v4.1 564 331.317 0 0 Potri.010G195200.1.v4.1 1773 1532.02 21 1.14367 Potri.012G127500.1.v4.1 977 736.076 172 19.4962 ==> SRR12690162.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 513 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR12690162 completed mapping pipeline successfully