Starting /dee2/code/volunteer_pipeline.sh SRR12690163 current disk space = 3056479617024 free memory = 1178763704 SRR12690163 SRAfilesize 1fbe0f4dfd8b833666d4b1b0a077ec5f SRR12690163.sra SRR12690163.sra file validated SRR12690163 is paired end SRR12690163 is conventional basespace SRR12690163 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690163_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.643 37.0 37.0 37.0 37.0 37.0 2 36.25725 37.0 37.0 37.0 37.0 37.0 3 36.5475 37.0 37.0 37.0 37.0 37.0 4 36.532 37.0 37.0 37.0 37.0 37.0 5 36.614 37.0 37.0 37.0 37.0 37.0 6 36.6585 37.0 37.0 37.0 37.0 37.0 7 36.5155 37.0 37.0 37.0 37.0 37.0 8 36.5665 37.0 37.0 37.0 37.0 37.0 9 36.639 37.0 37.0 37.0 37.0 37.0 10-14 36.587399999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.59490000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5331 37.0 37.0 37.0 37.0 37.0 25-29 36.500699999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.5415 37.0 37.0 37.0 37.0 37.0 35-39 36.5073 37.0 37.0 37.0 37.0 37.0 40-44 36.491 37.0 37.0 37.0 37.0 37.0 45-49 36.411500000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.454899999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3858 37.0 37.0 37.0 37.0 37.0 60-64 36.35189999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3391 37.0 37.0 37.0 37.0 37.0 70-74 36.315099999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.330799999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.27289999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2705 37.0 37.0 37.0 37.0 37.0 90-94 36.303700000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.21509999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.1623 37.0 37.0 37.0 37.0 37.0 105-109 36.15689999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.1269 37.0 37.0 37.0 37.0 37.0 115-119 36.0821 37.0 37.0 37.0 37.0 37.0 120-124 35.9836 37.0 37.0 37.0 37.0 37.0 125-129 36.009899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9511 37.0 37.0 37.0 37.0 37.0 135-139 35.92960000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.718999999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.6857 37.0 37.0 37.0 37.0 37.0 150-151 35.497249999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 2.0 26 5.0 27 4.0 28 11.0 29 13.0 30 23.0 31 31.0 32 48.0 33 78.0 34 123.0 35 331.0 36 2990.0 37 338.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.074999999999996 11.575000000000001 7.1499999999999995 36.199999999999996 2 20.030158331239004 13.64664488564966 34.68208092485549 31.64111585825584 3 17.724999999999998 16.8 29.875 35.6 4 21.775 23.474999999999998 25.4 29.349999999999998 5 23.150000000000002 29.725 24.275 22.85 6 21.525 33.1 23.799999999999997 21.575 7 16.275000000000002 27.175 40.275 16.275000000000002 8 17.224999999999998 26.450000000000003 31.724999999999998 24.6 9 17.45 24.25 34.55 23.75 10-14 19.775000000000002 29.175 28.235 22.814999999999998 15-19 20.105 27.455000000000002 28.199999999999996 24.240000000000002 20-24 20.44 28.01 28.02 23.53 25-29 20.07 28.17 28.084999999999997 23.674999999999997 30-34 19.950000000000003 28.4 27.750000000000004 23.9 35-39 20.24 28.215 27.72 23.825 40-44 19.900000000000002 27.965 28.194999999999997 23.94 45-49 19.939999999999998 28.625 28.04 23.395 50-54 20.544999999999998 28.015 27.42 24.02 55-59 20.544999999999998 28.395 27.229999999999997 23.830000000000002 60-64 20.29 28.625 27.310000000000002 23.775 65-69 20.330000000000002 28.665000000000003 27.275 23.73 70-74 20.625 28.194999999999997 27.24 23.94 75-79 20.68 27.485 28.235 23.599999999999998 80-84 20.380000000000003 28.294999999999998 27.389999999999997 23.935000000000002 85-89 20.31 28.349999999999998 27.27 24.07 90-94 21.08 28.435 27.310000000000002 23.175 95-99 20.885 27.98 27.61 23.525 100-104 20.974999999999998 29.285 26.384999999999998 23.355 105-109 20.755000000000003 27.975 27.465 23.805 110-114 20.555 27.950000000000003 27.38 24.115000000000002 115-119 21.15 27.779999999999998 27.26 23.810000000000002 120-124 20.845 28.804999999999996 26.96 23.39 125-129 20.755000000000003 27.67 27.310000000000002 24.265 130-134 21.09 27.455000000000002 27.35 24.104999999999997 135-139 21.325 27.939999999999998 27.43 23.305 140-144 20.395 27.66 27.275 24.67 145-149 21.435000000000002 27.650000000000002 26.685 24.23 150-151 21.125 27.675 26.950000000000003 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 3.0 26 4.0 27 6.0 28 10.0 29 12.5 30 17.0 31 24.5 32 34.0 33 44.5 34 59.0 35 67.0 36 70.0 37 91.0 38 124.5 39 152.0 40 169.5 41 203.0 42 227.5 43 241.0 44 266.5 45 262.5 46 254.5 47 259.0 48 245.5 49 224.5 50 196.5 51 156.0 52 134.5 53 112.0 54 75.0 55 54.0 56 46.0 57 41.5 58 31.0 59 22.0 60 18.5 61 11.5 62 5.0 63 3.5 64 2.0 65 3.0 66 3.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.68985750209556 80.25 2 8.968985750209555 16.05 3 1.2293936853869796 3.3000000000000003 4 0.11176306230790724 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.6749999999999998 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 2.0625 0.0 0.0 0.0 0.0 112-113 2.375 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.4749999999999996 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.574999999999999 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.6625 0.0 0.0 0.0 0.0 132-133 6.075 0.0 0.0 0.0 0.0 134-135 6.475 0.0 0.0 0.0 0.0 136-137 6.8375 0.0 0.0 0.0 0.0 138-139 7.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCACAG 10 0.006830828 145.0 1 ATAAAGT 10 0.006830828 145.0 2 TAAAGTA 10 0.006830828 145.0 3 ATTTATG 10 0.006830828 145.0 9 TCATACT 20 0.00593511 29.0 25-29 >>END_MODULE SRR12690163 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690163_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2405 37.0 37.0 37.0 37.0 37.0 2 36.0735 37.0 37.0 37.0 37.0 37.0 3 36.076 37.0 37.0 37.0 37.0 37.0 4 36.182 37.0 37.0 37.0 37.0 37.0 5 36.101 37.0 37.0 37.0 37.0 37.0 6 36.1775 37.0 37.0 37.0 37.0 37.0 7 36.1695 37.0 37.0 37.0 37.0 37.0 8 36.274 37.0 37.0 37.0 37.0 37.0 9 36.2985 37.0 37.0 37.0 37.0 37.0 10-14 36.220400000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.239 37.0 37.0 37.0 37.0 37.0 20-24 36.2259 37.0 37.0 37.0 37.0 37.0 25-29 36.183800000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1652 37.0 37.0 37.0 37.0 37.0 35-39 36.143100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.0988 37.0 37.0 37.0 37.0 37.0 45-49 36.0515 37.0 37.0 37.0 37.0 37.0 50-54 36.06420000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.1535 37.0 37.0 37.0 37.0 37.0 60-64 36.0133 37.0 37.0 37.0 37.0 37.0 65-69 36.0253 37.0 37.0 37.0 37.0 37.0 70-74 35.8871 37.0 37.0 37.0 37.0 37.0 75-79 35.8938 37.0 37.0 37.0 37.0 37.0 80-84 35.893899999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.89130000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.8108 37.0 37.0 37.0 37.0 37.0 95-99 35.818 37.0 37.0 37.0 37.0 37.0 100-104 35.85770000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.855000000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.7522 37.0 37.0 37.0 37.0 37.0 115-119 35.677 37.0 37.0 37.0 37.0 37.0 120-124 35.665200000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.5015 37.0 37.0 37.0 37.0 37.0 130-134 35.4165 37.0 37.0 37.0 37.0 37.0 135-139 35.3181 37.0 37.0 37.0 34.6 37.0 140-144 35.294799999999995 37.0 37.0 37.0 32.2 37.0 145-149 35.1326 37.0 37.0 37.0 29.8 37.0 150-151 34.64575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 0.0 20 2.0 21 1.0 22 4.0 23 9.0 24 2.0 25 4.0 26 3.0 27 15.0 28 17.0 29 18.0 30 35.0 31 38.0 32 74.0 33 125.0 34 203.0 35 565.0 36 2638.0 37 240.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.825 25.074999999999996 10.25 23.849999999999998 2 29.7 26.674999999999997 27.0 16.625 3 20.349999999999998 28.7 31.424999999999997 19.525000000000002 4 23.575 34.599999999999994 23.375 18.45 5 24.325 37.5 21.25 16.925 6 21.45 39.1 20.875 18.575 7 19.75 24.0 37.325 18.925 8 21.975 26.674999999999997 27.6 23.75 9 22.225 24.375 29.349999999999998 24.05 10-14 22.884999999999998 29.515 26.46 21.14 15-19 23.405 28.375 26.86 21.36 20-24 22.575 29.044999999999998 27.07 21.310000000000002 25-29 22.655 29.080000000000002 27.125 21.14 30-34 22.945 27.994999999999997 28.015 21.044999999999998 35-39 23.055 28.01 27.88 21.055 40-44 22.425 28.37 27.88 21.325 45-49 22.375 28.155 28.125 21.345 50-54 23.34 28.025 27.655 20.979999999999997 55-59 23.599999999999998 27.345000000000002 27.825 21.23 60-64 23.05 27.595 28.044999999999998 21.310000000000002 65-69 23.974999999999998 27.825 27.43 20.77 70-74 22.91 28.285 27.35 21.455 75-79 22.939999999999998 28.71 26.875 21.475 80-84 23.494999999999997 28.29 27.01 21.205 85-89 24.0 27.32 27.189999999999998 21.490000000000002 90-94 23.645 27.689999999999998 27.21 21.455 95-99 23.775 28.215 27.339999999999996 20.669999999999998 100-104 23.830000000000002 27.915 27.500000000000004 20.755000000000003 105-109 23.549999999999997 27.089999999999996 27.689999999999998 21.67 110-114 23.724999999999998 27.615000000000002 27.63 21.029999999999998 115-119 23.555 27.735 27.72 20.990000000000002 120-124 24.474999999999998 27.79 27.125 20.61 125-129 24.625 28.595 26.27 20.51 130-134 24.779999999999998 28.1 27.224999999999998 19.895 135-139 24.915000000000003 27.665 27.255000000000003 20.165 140-144 25.72 27.060000000000002 27.450000000000003 19.77 145-149 25.624999999999996 27.46 26.424999999999997 20.49 150-151 26.087500000000002 27.85 26.075 19.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 1.0 18 2.0 19 1.0 20 1.0 21 1.5 22 1.5 23 2.0 24 2.0 25 2.0 26 3.5 27 5.5 28 5.5 29 7.5 30 13.0 31 19.5 32 27.5 33 38.0 34 55.5 35 65.0 36 75.0 37 101.5 38 127.5 39 148.5 40 172.5 41 217.0 42 251.5 43 260.5 44 278.5 45 286.0 46 284.0 47 263.5 48 214.0 49 193.5 50 165.0 51 143.0 52 119.0 53 88.0 54 84.0 55 70.0 56 57.5 57 39.5 58 22.5 59 20.0 60 16.5 61 10.0 62 8.5 63 3.5 64 2.5 65 3.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.525 #Duplication Level Percentage of deduplicated Percentage of total 1 89.83524155263892 80.425 2 8.712650097738061 15.6 3 1.3683328679139906 3.675 4 0.08377548170901983 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.5750000000000002 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.325 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.1625 0.0 0.0 0.0 0.0 120-121 3.4000000000000004 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.550000000000001 0.0 0.0 0.0 0.0 128-129 5.2 0.0 0.0 0.0 0.0 130-131 5.6375 0.0 0.0 0.0 0.0 132-133 6.025 0.0 0.0 0.0 0.0 134-135 6.4 0.0 0.0 0.0 0.0 136-137 6.75 0.0 0.0 0.0 0.0 138-139 7.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTAAGG 10 0.006830828 145.0 7 TTCATAC 10 0.006830828 145.0 2 CTAAGGT 10 0.006830828 145.0 8 GTTCATA 10 0.006830828 145.0 1 GGCCATT 10 0.006830828 145.0 2 AGGCCAT 10 0.006830828 145.0 1 ATACTAA 10 0.006830828 145.0 5 CATACTA 10 0.006830828 145.0 4 CTTCCTG 10 0.006830828 145.0 5 TAAGGTT 10 0.006830828 145.0 9 TACTAAG 10 0.006830828 145.0 6 TTTTTTT 55 0.0025160722 15.818182 55-59 >>END_MODULE Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra Read 1145090 spots for SRR12690163.sra Written 1145090 spots for SRR12690163.sra Read 1145088 spots for SRR12690163.sra Written 1145088 spots for SRR12690163.sra SRR ids: ['SRR12690163.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q16bordc SRR12690163.sra spots: 22901762 blocks: [[1, 1145088], [1145089, 2290176], [2290177, 3435264], [3435265, 4580352], [4580353, 5725440], [5725441, 6870528], [6870529, 8015616], [8015617, 9160704], [9160705, 10305792], [10305793, 11450880], [11450881, 12595968], [12595969, 13741056], [13741057, 14886144], [14886145, 16031232], [16031233, 17176320], [17176321, 18321408], [18321409, 19466496], [19466497, 20611584], [20611585, 21756672], [21756673, 22901762]] SRR12690163 file size 7761320 SRR12690163 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690163 SRR12690163_1.fastq SRR12690163_2.fastq Input file: SRR12690163_1.fastq Paired file: SRR12690163_2.fastq trimmed: SRR12690163-trimmed-pair1.fastq, SRR12690163-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:49:06 2025 >> started Mon Feb 10 19:49:54 2025 >> done (47.902s) 22901762 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 5979 ( 0.03%) empty read pairs filtered out after trimming by size control 22895725 (99.97%) read pairs available; of these: 2543493 (11.11%) trimmed read pairs available after processing 20352232 (88.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 23 0.00% 20 21 0.00% 21 30 0.00% 22 38 0.00% 23 47 0.00% 24 46 0.00% 25 51 0.00% 26 58 0.00% 27 77 0.00% 28 73 0.00% 29 71 0.00% 30 89 0.00% 31 81 0.00% 32 78 0.00% 33 87 0.00% 34 111 0.00% 35 112 0.00% 36 135 0.00% 37 219 0.00% 38 281 0.00% 39 248 0.00% 40 160 0.00% 41 197 0.00% 42 191 0.00% 43 200 0.00% 44 178 0.00% 45 242 0.00% 46 211 0.00% 47 303 0.00% 48 383 0.00% 49 446 0.00% 50 422 0.00% 51 379 0.00% 52 426 0.00% 53 346 0.00% 54 416 0.00% 55 458 0.00% 56 434 0.00% 57 531 0.00% 58 630 0.00% 59 707 0.00% 60 840 0.00% 61 746 0.00% 62 817 0.00% 63 961 0.00% 64 815 0.00% 65 909 0.00% 66 988 0.00% 67 1134 0.00% 68 1245 0.01% 69 1523 0.01% 70 1628 0.01% 71 1621 0.01% 72 1819 0.01% 73 2046 0.01% 74 2196 0.01% 75 2287 0.01% 76 2574 0.01% 77 2769 0.01% 78 3306 0.01% 79 3828 0.02% 80 4096 0.02% 81 4218 0.02% 82 4491 0.02% 83 4641 0.02% 84 5194 0.02% 85 5709 0.02% 86 6273 0.03% 87 6855 0.03% 88 7490 0.03% 89 8278 0.04% 90 8908 0.04% 91 9479 0.04% 92 10083 0.04% 93 10934 0.05% 94 11492 0.05% 95 12629 0.06% 96 13504 0.06% 97 14296 0.06% 98 15040 0.07% 99 16050 0.07% 100 17177 0.08% 101 17763 0.08% 102 18963 0.08% 103 19836 0.09% 104 20588 0.09% 105 22095 0.10% 106 23164 0.10% 107 23858 0.10% 108 25022 0.11% 109 26206 0.11% 110 27235 0.12% 111 28223 0.12% 112 29562 0.13% 113 30335 0.13% 114 31620 0.14% 115 33018 0.14% 116 33875 0.15% 117 36326 0.16% 118 36480 0.16% 119 37564 0.16% 120 39177 0.17% 121 40347 0.18% 122 41030 0.18% 123 42425 0.19% 124 44282 0.19% 125 45119 0.20% 126 46963 0.21% 127 47634 0.21% 128 48331 0.21% 129 50212 0.22% 130 51164 0.22% 131 52360 0.23% 132 54004 0.24% 133 55269 0.24% 134 56118 0.25% 135 57436 0.25% 136 59665 0.26% 137 59907 0.26% 138 60854 0.27% 139 63016 0.28% 140 63048 0.28% 141 64568 0.28% 142 66431 0.29% 143 67153 0.29% 144 69470 0.30% 145 69674 0.30% 146 71165 0.31% 147 72206 0.32% 148 73872 0.32% 149 73723 0.32% 150 74997 0.33% 151 20352232 88.89% 22895725 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=18 prefix-density=0.55 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=20 fanout-score=32.14 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=10.3 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=26 prefix-density=0.88 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=39.70 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.0 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTACAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12690163 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:51:14 Started mapping on | Feb 10 19:51:14 Finished on | Feb 10 19:54:09 Mapping speed, Million of reads per hour | 471.00 Number of input reads | 22895725 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21375640 Uniquely mapped reads % | 93.36% Average mapped length | 295.65 Number of splices: Total | 20690727 Number of splices: Annotated (sjdb) | 20234880 Number of splices: GT/AG | 20278910 Number of splices: GC/AG | 333557 Number of splices: AT/AC | 13427 Number of splices: Non-canonical | 64833 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 546528 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 63175 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.87% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 973557 973557 973557 N_multimapping 546528 546528 546528 N_noFeature 776194 21107535 858405 N_ambiguous 332056 1492 145230 UnstrandedReadsAssigned:20267390 PositiveStrandReadsAssigned:266613 NegativeStrandReadsAssigned:20372005 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690163 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690163-trimmed-pair1.fastq SRR12690163-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,895,725 reads, 20,358,855 reads pseudoaligned [quant] estimated average fragment length: 254.513 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR12690163.ke.tsv 34699 SRR12690163.se.tsv 87100 total ==> SRR12690163.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.49 559 13.6727 Potri.005G024800.1.v4.1 1035 781.487 216 11.9287 Potri.004G059700.1.v4.1 961 707.63 58 3.53738 Potri.007G009000.2.v4.1 1416 1162.49 0 0 Potri.003G141000.2.v4.1 2943 2689.49 929.463 14.915 Potri.016G087400.1.v4.1 270 84.4361 942 481.485 Potri.015G069301.1.v4.1 564 324.228 0 0 Potri.010G195200.1.v4.1 1773 1519.49 22 0.624864 Potri.012G127500.1.v4.1 977 723.587 370 22.0684 ==> SRR12690163.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1072 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 285 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12690163 completed mapping pipeline successfully