Starting /dee2/code/volunteer_pipeline.sh SRR12690164 current disk space = 3056266031104 free memory = 1208883992 SRR12690164 SRAfilesize 744b97b4357024e10b57e26c8db8763d SRR12690164.sra SRR12690164.sra file validated SRR12690164 is paired end SRR12690164 is conventional basespace SRR12690164 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690164_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.674 37.0 37.0 37.0 37.0 37.0 2 36.49225 37.0 37.0 37.0 37.0 37.0 3 36.6415 37.0 37.0 37.0 37.0 37.0 4 36.657 37.0 37.0 37.0 37.0 37.0 5 36.6445 37.0 37.0 37.0 37.0 37.0 6 36.69 37.0 37.0 37.0 37.0 37.0 7 36.53 37.0 37.0 37.0 37.0 37.0 8 36.6135 37.0 37.0 37.0 37.0 37.0 9 36.672 37.0 37.0 37.0 37.0 37.0 10-14 36.5981 37.0 37.0 37.0 37.0 37.0 15-19 36.6147 37.0 37.0 37.0 37.0 37.0 20-24 36.5815 37.0 37.0 37.0 37.0 37.0 25-29 36.517700000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.5229 37.0 37.0 37.0 37.0 37.0 35-39 36.512100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4865 37.0 37.0 37.0 37.0 37.0 45-49 36.454699999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.4647 37.0 37.0 37.0 37.0 37.0 55-59 36.4342 37.0 37.0 37.0 37.0 37.0 60-64 36.408300000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.356 37.0 37.0 37.0 37.0 37.0 70-74 36.36 37.0 37.0 37.0 37.0 37.0 75-79 36.3542 37.0 37.0 37.0 37.0 37.0 80-84 36.2389 37.0 37.0 37.0 37.0 37.0 85-89 36.3001 37.0 37.0 37.0 37.0 37.0 90-94 36.2674 37.0 37.0 37.0 37.0 37.0 95-99 36.262800000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.224599999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1495 37.0 37.0 37.0 37.0 37.0 110-114 36.128 37.0 37.0 37.0 37.0 37.0 115-119 36.116200000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.0827 37.0 37.0 37.0 37.0 37.0 125-129 36.051100000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.989999999999995 37.0 37.0 37.0 37.0 37.0 135-139 36.0185 37.0 37.0 37.0 37.0 37.0 140-144 35.828500000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.8258 37.0 37.0 37.0 37.0 37.0 150-151 35.681 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 0.0 24 2.0 25 2.0 26 0.0 27 10.0 28 7.0 29 16.0 30 20.0 31 30.0 32 56.0 33 57.0 34 104.0 35 301.0 36 3006.0 37 387.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.45 12.174999999999999 8.6 40.775 2 18.876911506643268 11.957884181499123 37.854098771621956 31.311105540235644 3 16.875 15.5 28.65 38.975 4 21.725 21.55 26.375 30.349999999999998 5 23.425 29.15 24.95 22.475 6 21.7 33.074999999999996 22.575 22.650000000000002 7 17.549999999999997 26.5 40.025 15.925 8 17.0 26.150000000000002 32.675 24.175 9 16.525000000000002 24.375 36.025 23.075000000000003 10-14 20.424999999999997 29.115000000000002 27.605 22.855 15-19 19.88 27.525 28.54 24.055 20-24 20.53 28.105000000000004 28.03 23.335 25-29 20.23 28.025 27.405 24.34 30-34 20.205000000000002 28.065 27.395000000000003 24.335 35-39 20.65 27.384999999999998 27.605 24.36 40-44 20.24 27.715 28.444999999999997 23.599999999999998 45-49 20.095 27.72 28.04 24.145 50-54 20.22 27.395000000000003 28.384999999999998 24.0 55-59 19.925 27.595 28.249999999999996 24.23 60-64 20.195 27.794999999999998 27.96 24.05 65-69 20.22 27.965 27.765 24.05 70-74 20.73 27.139999999999997 28.035 24.095 75-79 19.97 28.29 27.325 24.415 80-84 20.244999999999997 27.639999999999997 27.955000000000002 24.16 85-89 20.8 27.834999999999997 28.15 23.215 90-94 21.055 27.810000000000002 27.750000000000004 23.385 95-99 20.32 28.310000000000002 27.32 24.05 100-104 20.369999999999997 28.360000000000003 27.49 23.78 105-109 20.794999999999998 27.779999999999998 27.125 24.3 110-114 21.815 27.505000000000003 27.13 23.549999999999997 115-119 20.655 28.310000000000002 26.87 24.165 120-124 20.995 28.165000000000003 27.24 23.599999999999998 125-129 21.16 27.455000000000002 27.63 23.755000000000003 130-134 21.195 27.865000000000002 27.525 23.415 135-139 21.584999999999997 27.76 27.415 23.24 140-144 21.895 27.339999999999996 27.500000000000004 23.265 145-149 21.365000000000002 27.534999999999997 27.04 24.060000000000002 150-151 21.2375 27.5625 27.775 23.425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 4.0 28 7.5 29 11.5 30 18.0 31 25.0 32 23.5 33 29.0 34 41.0 35 57.5 36 81.0 37 97.0 38 125.5 39 154.0 40 182.5 41 218.0 42 246.0 43 243.5 44 236.0 45 255.0 46 270.0 47 274.0 48 254.5 49 220.0 50 191.5 51 153.5 52 126.0 53 114.0 54 86.0 55 57.5 56 44.5 57 39.0 58 34.5 59 21.0 60 15.0 61 14.5 62 6.5 63 5.0 64 3.0 65 1.0 66 0.5 67 0.5 68 2.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.225 #Duplication Level Percentage of deduplicated Percentage of total 1 91.34009317621266 83.325 2 7.837763770896136 14.299999999999999 3 0.712523979172376 1.95 4 0.0822143052891203 0.3 5 0.027404768429706773 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.8875000000000002 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.5875 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.550000000000001 0.0 0.0 0.0 0.0 128-129 4.8875 0.0 0.0 0.0 0.0 130-131 5.3 0.0 0.0 0.0 0.0 132-133 5.725 0.0 0.0 0.0 0.0 134-135 6.325 0.0 0.0 0.0 0.0 136-137 6.775 0.0 0.0 0.0 0.0 138-139 7.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTGAC 10 0.006830828 145.0 5 GTTGGGA 10 0.006830828 145.0 1 AGATTGA 10 0.006830828 145.0 4 >>END_MODULE SRR12690164 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690164_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4325 37.0 37.0 37.0 37.0 37.0 2 36.205 37.0 37.0 37.0 37.0 37.0 3 36.377 37.0 37.0 37.0 37.0 37.0 4 36.3225 37.0 37.0 37.0 37.0 37.0 5 36.3625 37.0 37.0 37.0 37.0 37.0 6 36.33 37.0 37.0 37.0 37.0 37.0 7 36.38 37.0 37.0 37.0 37.0 37.0 8 36.406 37.0 37.0 37.0 37.0 37.0 9 36.4225 37.0 37.0 37.0 37.0 37.0 10-14 36.3866 37.0 37.0 37.0 37.0 37.0 15-19 36.3601 37.0 37.0 37.0 37.0 37.0 20-24 36.3744 37.0 37.0 37.0 37.0 37.0 25-29 36.3323 37.0 37.0 37.0 37.0 37.0 30-34 36.2851 37.0 37.0 37.0 37.0 37.0 35-39 36.2895 37.0 37.0 37.0 37.0 37.0 40-44 36.2649 37.0 37.0 37.0 37.0 37.0 45-49 36.21939999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.1785 37.0 37.0 37.0 37.0 37.0 55-59 36.20119999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.104 37.0 37.0 37.0 37.0 37.0 65-69 36.092099999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.1004 37.0 37.0 37.0 37.0 37.0 75-79 36.0784 37.0 37.0 37.0 37.0 37.0 80-84 36.0638 37.0 37.0 37.0 37.0 37.0 85-89 36.087599999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.90820000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.9654 37.0 37.0 37.0 37.0 37.0 100-104 36.018600000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.9585 37.0 37.0 37.0 37.0 37.0 110-114 35.8513 37.0 37.0 37.0 37.0 37.0 115-119 35.8802 37.0 37.0 37.0 37.0 37.0 120-124 35.7399 37.0 37.0 37.0 37.0 37.0 125-129 35.7125 37.0 37.0 37.0 37.0 37.0 130-134 35.659499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.6712 37.0 37.0 37.0 37.0 37.0 140-144 35.5246 37.0 37.0 37.0 37.0 37.0 145-149 35.3668 37.0 37.0 37.0 32.2 37.0 150-151 34.939 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 4.0 15 0.0 16 2.0 17 2.0 18 1.0 19 2.0 20 0.0 21 1.0 22 1.0 23 4.0 24 2.0 25 7.0 26 9.0 27 5.0 28 14.0 29 20.0 30 21.0 31 33.0 32 40.0 33 78.0 34 164.0 35 508.0 36 2771.0 37 307.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.125 25.674999999999997 11.25 26.950000000000003 2 28.199999999999996 27.35 29.375 15.075 3 19.925 27.425 30.75 21.9 4 22.7 33.4 25.0 18.9 5 25.2 36.575 20.95 17.275 6 22.2 37.15 22.55 18.099999999999998 7 19.975 23.65 37.4 18.975 8 20.375 26.625 28.449999999999996 24.55 9 21.85 25.75 29.049999999999997 23.35 10-14 23.09 29.325000000000003 26.105 21.48 15-19 22.735 29.015 27.189999999999998 21.060000000000002 20-24 23.385 28.405 26.889999999999997 21.32 25-29 22.875 28.415000000000003 27.27 21.44 30-34 22.63 28.675 27.13 21.565 35-39 22.435 27.529999999999998 28.225 21.81 40-44 22.869999999999997 27.82 27.744999999999997 21.565 45-49 22.745 28.32 27.85 21.085 50-54 23.305 28.365000000000002 27.245 21.085 55-59 22.775000000000002 27.98 27.96 21.285 60-64 23.244999999999997 27.810000000000002 27.985 20.96 65-69 22.939999999999998 27.395000000000003 28.17 21.495 70-74 22.805 28.225 27.715 21.255 75-79 22.835 28.74 26.815 21.61 80-84 22.93 27.925 27.200000000000003 21.945 85-89 22.955000000000002 28.03 27.384999999999998 21.63 90-94 23.369999999999997 28.535 27.005000000000003 21.09 95-99 23.494999999999997 28.475 26.96 21.07 100-104 23.849999999999998 28.189999999999998 26.965 20.995 105-109 23.905 27.744999999999997 26.784999999999997 21.565 110-114 24.060000000000002 27.555000000000003 27.465 20.919999999999998 115-119 24.5 28.410000000000004 26.995 20.095 120-124 24.104999999999997 28.299999999999997 27.029999999999998 20.565 125-129 24.665 28.165000000000003 26.700000000000003 20.47 130-134 25.245 27.91 26.790000000000003 20.055 135-139 24.779999999999998 27.435 27.834999999999997 19.950000000000003 140-144 24.875 27.525 27.0 20.599999999999998 145-149 25.314999999999998 28.249999999999996 26.484999999999996 19.950000000000003 150-151 25.7375 28.599999999999998 26.237500000000004 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 1.0 10 2.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.5 24 1.5 25 1.5 26 3.5 27 6.5 28 6.5 29 8.5 30 12.0 31 17.5 32 26.0 33 35.5 34 49.0 35 60.5 36 78.5 37 106.5 38 134.5 39 165.0 40 189.0 41 220.0 42 246.0 43 252.5 44 265.0 45 274.5 46 267.5 47 256.5 48 246.0 49 215.0 50 173.5 51 145.0 52 114.0 53 91.0 54 81.0 55 66.0 56 43.5 57 26.5 58 25.0 59 25.5 60 17.0 61 9.5 62 8.0 63 5.0 64 2.5 65 1.0 66 0.5 67 0.0 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.95 #Duplication Level Percentage of deduplicated Percentage of total 1 91.1214953271028 82.875 2 7.971412864211105 14.499999999999998 3 0.7971412864211105 2.175 4 0.08246289169873557 0.3 5 0.0 0.0 6 0.027487630566245192 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.8875000000000002 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.5875 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.225 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.487500000000001 0.0 0.0 0.0 0.0 128-129 4.8125 0.0 0.0 0.0 0.0 130-131 5.225 0.0 0.0 0.0 0.0 132-133 5.675 0.0 0.0 0.0 0.0 134-135 6.275 0.0 0.0 0.0 0.0 136-137 6.725 0.0 0.0 0.0 0.0 138-139 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATTG 10 0.006830828 145.0 145 ACCAATT 10 0.006830828 145.0 2 AACTCTA 10 0.006830828 145.0 6 ACCTGCC 10 0.006830828 145.0 1 >>END_MODULE Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825967 spots for SRR12690164.sra Written 825967 spots for SRR12690164.sra Read 825972 spots for SRR12690164.sra Written 825972 spots for SRR12690164.sra SRR ids: ['SRR12690164.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2au0hwsj SRR12690164.sra spots: 16519345 blocks: [[1, 825967], [825968, 1651934], [1651935, 2477901], [2477902, 3303868], [3303869, 4129835], [4129836, 4955802], [4955803, 5781769], [5781770, 6607736], [6607737, 7433703], [7433704, 8259670], [8259671, 9085637], [9085638, 9911604], [9911605, 10737571], [10737572, 11563538], [11563539, 12389505], [12389506, 13215472], [13215473, 14041439], [14041440, 14867406], [14867407, 15693373], [15693374, 16519345]] SRR12690164 file size 5592295 SRR12690164 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690164 SRR12690164_1.fastq SRR12690164_2.fastq Input file: SRR12690164_1.fastq Paired file: SRR12690164_2.fastq trimmed: SRR12690164-trimmed-pair1.fastq, SRR12690164-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:12:26 2025 >> started Mon Feb 10 20:12:54 2025 >> done (27.536s) 16519345 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 3476 ( 0.02%) empty read pairs filtered out after trimming by size control 16515837 (99.98%) read pairs available; of these: 1847598 (11.19%) trimmed read pairs available after processing 14668239 (88.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 1 0.00% 21 6 0.00% 22 7 0.00% 23 7 0.00% 24 10 0.00% 25 16 0.00% 26 14 0.00% 27 10 0.00% 28 15 0.00% 29 9 0.00% 30 18 0.00% 31 14 0.00% 32 23 0.00% 33 24 0.00% 34 22 0.00% 35 28 0.00% 36 26 0.00% 37 26 0.00% 38 29 0.00% 39 28 0.00% 40 31 0.00% 41 28 0.00% 42 32 0.00% 43 30 0.00% 44 40 0.00% 45 33 0.00% 46 33 0.00% 47 38 0.00% 48 48 0.00% 49 62 0.00% 50 80 0.00% 51 71 0.00% 52 86 0.00% 53 102 0.00% 54 99 0.00% 55 103 0.00% 56 104 0.00% 57 127 0.00% 58 150 0.00% 59 160 0.00% 60 200 0.00% 61 209 0.00% 62 287 0.00% 63 290 0.00% 64 310 0.00% 65 323 0.00% 66 369 0.00% 67 452 0.00% 68 438 0.00% 69 534 0.00% 70 648 0.00% 71 703 0.00% 72 722 0.00% 73 890 0.01% 74 970 0.01% 75 1073 0.01% 76 1172 0.01% 77 1318 0.01% 78 1572 0.01% 79 1719 0.01% 80 1932 0.01% 81 2194 0.01% 82 2567 0.02% 83 2670 0.02% 84 3158 0.02% 85 3467 0.02% 86 3670 0.02% 87 4125 0.02% 88 4477 0.03% 89 4826 0.03% 90 5185 0.03% 91 5757 0.03% 92 6146 0.04% 93 6776 0.04% 94 7239 0.04% 95 7890 0.05% 96 8513 0.05% 97 9213 0.06% 98 9664 0.06% 99 10244 0.06% 100 10899 0.07% 101 11499 0.07% 102 12322 0.07% 103 13292 0.08% 104 13892 0.08% 105 14480 0.09% 106 15194 0.09% 107 16300 0.10% 108 16835 0.10% 109 17756 0.11% 110 18335 0.11% 111 19503 0.12% 112 20319 0.12% 113 21000 0.13% 114 21963 0.13% 115 23238 0.14% 116 24068 0.15% 117 25148 0.15% 118 26300 0.16% 119 27074 0.16% 120 28041 0.17% 121 29064 0.18% 122 29971 0.18% 123 30668 0.19% 124 32463 0.20% 125 32262 0.20% 126 33761 0.20% 127 35119 0.21% 128 36003 0.22% 129 37155 0.22% 130 38697 0.23% 131 39465 0.24% 132 40052 0.24% 133 41650 0.25% 134 41934 0.25% 135 43719 0.26% 136 44764 0.27% 137 45332 0.27% 138 46203 0.28% 139 48294 0.29% 140 49128 0.30% 141 49850 0.30% 142 51653 0.31% 143 52636 0.32% 144 53391 0.32% 145 54162 0.33% 146 55224 0.33% 147 56380 0.34% 148 57391 0.35% 149 58521 0.35% 150 59522 0.36% 151 14668239 88.81% 16515837 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=18 prefix-density=0.65 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=16.73 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=3.9 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.96 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=117.23 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.2 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTATGGCGATGGTTGTTAGTGCACCTCTAGCAGAAGCTGCCATCTCATGCGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAGGCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12690164 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:13:54 Started mapping on | Feb 10 20:13:55 Finished on | Feb 10 20:15:53 Mapping speed, Million of reads per hour | 503.87 Number of input reads | 16515837 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15710654 Uniquely mapped reads % | 95.12% Average mapped length | 295.96 Number of splices: Total | 15965245 Number of splices: Annotated (sjdb) | 15634899 Number of splices: GT/AG | 15629127 Number of splices: GC/AG | 281123 Number of splices: AT/AC | 10153 Number of splices: Non-canonical | 44842 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 359743 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 75202 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 445440 445440 445440 N_multimapping 359743 359743 359743 N_noFeature 535192 15542117 588982 N_ambiguous 212172 756 97040 UnstrandedReadsAssigned:14963290 PositiveStrandReadsAssigned:167781 NegativeStrandReadsAssigned:15024632 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690164 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690164-trimmed-pair1.fastq SRR12690164-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,515,837 reads, 15,022,430 reads pseudoaligned [quant] estimated average fragment length: 241.203 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR12690164.ke.tsv 34699 SRR12690164.se.tsv 87100 total ==> SRR12690164.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.8 511 18.3317 Potri.005G024800.1.v4.1 1035 794.797 153 12.2772 Potri.004G059700.1.v4.1 961 720.838 9 0.796286 Potri.007G009000.2.v4.1 1416 1175.8 0 0 Potri.003G141000.2.v4.1 2943 2702.8 1240.63 29.2748 Potri.016G087400.1.v4.1 270 83.2668 559 428.158 Potri.015G069301.1.v4.1 564 330.243 0 0 Potri.010G195200.1.v4.1 1773 1532.8 11 0.457691 Potri.012G127500.1.v4.1 977 736.818 66 5.71279 ==> SRR12690164.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 171 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 0 SRR12690164 completed mapping pipeline successfully