Starting /dee2/code/volunteer_pipeline.sh SRR12690165 current disk space = 3056197648384 free memory = 1288121660 SRR12690165 SRAfilesize ba5ad12fb94e663afd212003744baf7a SRR12690165.sra SRR12690165.sra file validated SRR12690165 is paired end SRR12690165 is conventional basespace SRR12690165 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690165_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.609 37.0 37.0 37.0 37.0 37.0 2 36.39025 37.0 37.0 37.0 37.0 37.0 3 36.62 37.0 37.0 37.0 37.0 37.0 4 36.612 37.0 37.0 37.0 37.0 37.0 5 36.6035 37.0 37.0 37.0 37.0 37.0 6 36.6125 37.0 37.0 37.0 37.0 37.0 7 36.5525 37.0 37.0 37.0 37.0 37.0 8 36.7285 37.0 37.0 37.0 37.0 37.0 9 36.6405 37.0 37.0 37.0 37.0 37.0 10-14 36.625099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.61319999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.6005 37.0 37.0 37.0 37.0 37.0 25-29 36.536199999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4993 37.0 37.0 37.0 37.0 37.0 35-39 36.5356 37.0 37.0 37.0 37.0 37.0 40-44 36.5105 37.0 37.0 37.0 37.0 37.0 45-49 36.5111 37.0 37.0 37.0 37.0 37.0 50-54 36.4522 37.0 37.0 37.0 37.0 37.0 55-59 36.4082 37.0 37.0 37.0 37.0 37.0 60-64 36.3883 37.0 37.0 37.0 37.0 37.0 65-69 36.3962 37.0 37.0 37.0 37.0 37.0 70-74 36.3636 37.0 37.0 37.0 37.0 37.0 75-79 36.3236 37.0 37.0 37.0 37.0 37.0 80-84 36.2342 37.0 37.0 37.0 37.0 37.0 85-89 36.3481 37.0 37.0 37.0 37.0 37.0 90-94 36.2813 37.0 37.0 37.0 37.0 37.0 95-99 36.24980000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.218 37.0 37.0 37.0 37.0 37.0 105-109 36.193 37.0 37.0 37.0 37.0 37.0 110-114 36.168899999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.06750000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.046499999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0602 37.0 37.0 37.0 37.0 37.0 130-134 36.019600000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.01 37.0 37.0 37.0 37.0 37.0 140-144 35.8245 37.0 37.0 37.0 37.0 37.0 145-149 35.8352 37.0 37.0 37.0 37.0 37.0 150-151 35.528999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 0.0 24 1.0 25 2.0 26 6.0 27 5.0 28 9.0 29 13.0 30 20.0 31 28.0 32 37.0 33 66.0 34 124.0 35 291.0 36 3050.0 37 344.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.05 11.450000000000001 6.225 34.275 2 19.78931527464259 13.042387760220716 37.77276147479308 29.395535490343615 3 17.05 18.2 29.7 35.05 4 22.175 25.124999999999996 25.624999999999996 27.075 5 22.55 32.074999999999996 24.975 20.4 6 19.8 35.15 23.825 21.224999999999998 7 14.249999999999998 27.175 42.125 16.45 8 18.375 24.45 33.675 23.5 9 17.25 23.05 35.125 24.575 10-14 19.695 29.765000000000004 27.560000000000002 22.98 15-19 20.24 27.694999999999997 28.084999999999997 23.98 20-24 19.814999999999998 27.975 28.494999999999997 23.715 25-29 19.77 28.16 28.515 23.555 30-34 19.475 28.660000000000004 27.955000000000002 23.91 35-39 19.56 28.43 28.494999999999997 23.515 40-44 20.365 28.935 27.33 23.369999999999997 45-49 20.064999999999998 28.93 27.63 23.375 50-54 20.169999999999998 28.155 28.060000000000002 23.615 55-59 20.560000000000002 27.925 28.275 23.24 60-64 19.885 27.939999999999998 28.23 23.945 65-69 20.22 28.08 28.485 23.215 70-74 20.1 28.27 27.365000000000002 24.265 75-79 19.985 28.38 27.55 24.085 80-84 20.23 28.1 27.800000000000004 23.87 85-89 19.905 28.994999999999997 27.495000000000005 23.605 90-94 20.755000000000003 28.439999999999998 27.134999999999998 23.669999999999998 95-99 20.085 28.34 27.63 23.945 100-104 20.560000000000002 28.810000000000002 27.365000000000002 23.265 105-109 20.735 27.605 27.825 23.835 110-114 19.885 28.455000000000002 28.449999999999996 23.21 115-119 20.71 28.439999999999998 27.224999999999998 23.625 120-124 20.89 28.32 26.740000000000002 24.05 125-129 20.880000000000003 27.529999999999998 28.08 23.51 130-134 21.08 27.97 27.395000000000003 23.555 135-139 21.490000000000002 27.925 26.8 23.785 140-144 21.245 28.044999999999998 27.450000000000003 23.26 145-149 21.535 27.88 26.44 24.145 150-151 21.212500000000002 28.249999999999996 26.724999999999998 23.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 1.5 23 1.5 24 3.5 25 5.5 26 5.5 27 6.0 28 8.5 29 13.0 30 18.5 31 28.5 32 38.0 33 39.0 34 51.0 35 76.0 36 93.5 37 118.0 38 149.5 39 159.0 40 170.5 41 181.5 42 206.0 43 245.0 44 262.5 45 276.0 46 266.0 47 249.5 48 240.0 49 211.5 50 195.5 51 167.0 52 123.5 53 97.0 54 73.5 55 57.0 56 47.0 57 34.0 58 21.0 59 16.5 60 9.0 61 5.0 62 6.5 63 4.0 64 1.5 65 1.0 66 0.0 67 1.5 68 1.5 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.0 #Duplication Level Percentage of deduplicated Percentage of total 1 90.33333333333333 81.3 2 8.38888888888889 15.1 3 1.1111111111111112 3.0 4 0.16666666666666669 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0125 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0125 0.025 0.0 0.0 0.0 52-53 0.025 0.025 0.0 0.0 0.0 54-55 0.025 0.025 0.0 0.0 0.0 56-57 0.025 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.05 0.025 0.0 0.0 0.0 72-73 0.0875 0.025 0.0 0.0 0.0 74-75 0.1 0.025 0.0 0.0 0.0 76-77 0.125 0.025 0.0 0.0 0.0 78-79 0.125 0.025 0.0 0.0 0.0 80-81 0.16249999999999998 0.025 0.0 0.0 0.0 82-83 0.2 0.025 0.0 0.0 0.0 84-85 0.25 0.025 0.0 0.0 0.0 86-87 0.32499999999999996 0.025 0.0 0.0 0.0 88-89 0.38749999999999996 0.025 0.0 0.0 0.0 90-91 0.4875 0.025 0.0 0.0 0.0 92-93 0.6000000000000001 0.025 0.0 0.0 0.0 94-95 0.7625 0.025 0.0 0.0 0.0 96-97 0.975 0.025 0.0 0.0 0.0 98-99 0.9875 0.025 0.0 0.0 0.0 100-101 1.1125 0.025 0.0 0.0 0.0 102-103 1.325 0.025 0.0 0.0 0.0 104-105 1.4375 0.025 0.0 0.0 0.0 106-107 1.5625 0.025 0.0 0.0 0.0 108-109 1.7 0.025 0.0 0.0 0.0 110-111 1.9 0.025 0.0 0.0 0.0 112-113 2.0999999999999996 0.025 0.0 0.0 0.0 114-115 2.6125 0.025 0.0 0.0 0.0 116-117 2.9125 0.025 0.0 0.0 0.0 118-119 3.2375 0.025 0.0 0.0 0.0 120-121 3.5125 0.025 0.0 0.0 0.0 122-123 4.025 0.025 0.0 0.0 0.0 124-125 4.3 0.025 0.0 0.0 0.0 126-127 4.675 0.025 0.0 0.0 0.0 128-129 5.1375 0.025 0.0 0.0 0.0 130-131 5.4875 0.025 0.0 0.0 0.0 132-133 6.0375 0.025 0.0 0.0 0.0 134-135 6.525 0.025 0.0 0.0 0.0 136-137 7.075 0.025 0.0 0.0 0.0 138-139 7.85 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTCAT 10 0.006830828 145.0 4 >>END_MODULE SRR12690165 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690165_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.534 37.0 37.0 37.0 37.0 37.0 2 36.133 37.0 37.0 37.0 37.0 37.0 3 36.112 37.0 37.0 37.0 37.0 37.0 4 36.298 37.0 37.0 37.0 37.0 37.0 5 36.3265 37.0 37.0 37.0 37.0 37.0 6 36.287 37.0 37.0 37.0 37.0 37.0 7 36.2545 37.0 37.0 37.0 37.0 37.0 8 36.461 37.0 37.0 37.0 37.0 37.0 9 36.3635 37.0 37.0 37.0 37.0 37.0 10-14 36.3781 37.0 37.0 37.0 37.0 37.0 15-19 36.3629 37.0 37.0 37.0 37.0 37.0 20-24 36.3421 37.0 37.0 37.0 37.0 37.0 25-29 36.3316 37.0 37.0 37.0 37.0 37.0 30-34 36.283 37.0 37.0 37.0 37.0 37.0 35-39 36.2565 37.0 37.0 37.0 37.0 37.0 40-44 36.24550000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.2156 37.0 37.0 37.0 37.0 37.0 50-54 36.18 37.0 37.0 37.0 37.0 37.0 55-59 36.1539 37.0 37.0 37.0 37.0 37.0 60-64 36.0689 37.0 37.0 37.0 37.0 37.0 65-69 36.1019 37.0 37.0 37.0 37.0 37.0 70-74 35.99929999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.0269 37.0 37.0 37.0 37.0 37.0 80-84 35.9831 37.0 37.0 37.0 37.0 37.0 85-89 36.046499999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.8895 37.0 37.0 37.0 37.0 37.0 95-99 35.965599999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.0116 37.0 37.0 37.0 37.0 37.0 105-109 35.9767 37.0 37.0 37.0 37.0 37.0 110-114 35.905 37.0 37.0 37.0 37.0 37.0 115-119 35.831999999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.7213 37.0 37.0 37.0 37.0 37.0 125-129 35.746399999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.5335 37.0 37.0 37.0 37.0 37.0 135-139 35.566 37.0 37.0 37.0 37.0 37.0 140-144 35.443000000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.3399 37.0 37.0 37.0 32.2 37.0 150-151 34.73725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 3.0 23 6.0 24 7.0 25 3.0 26 6.0 27 12.0 28 13.0 29 12.0 30 28.0 31 43.0 32 53.0 33 98.0 34 181.0 35 506.0 36 2741.0 37 281.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.1 22.875 8.225 23.799999999999997 2 26.924999999999997 27.200000000000003 28.9 16.975 3 21.05 28.975 31.874999999999996 18.099999999999998 4 24.099999999999998 34.2 23.425 18.275 5 23.825 37.95 21.175 17.05 6 20.125 40.35 21.0 18.525 7 18.925 22.2 39.125 19.75 8 20.549999999999997 25.874999999999996 29.325000000000003 24.25 9 22.400000000000002 26.775 28.199999999999996 22.625 10-14 22.99 29.24 26.465 21.305 15-19 22.915 28.58 27.36 21.145 20-24 23.34 28.725 27.315 20.62 25-29 23.044999999999998 29.29 26.939999999999998 20.724999999999998 30-34 22.8 28.395 28.54 20.265 35-39 22.765 27.939999999999998 28.09 21.205 40-44 23.080000000000002 27.72 27.634999999999998 21.565 45-49 23.1 27.71 28.044999999999998 21.145 50-54 23.23 28.249999999999996 27.82 20.7 55-59 23.5 27.944999999999997 27.665 20.89 60-64 23.09 27.685 27.365000000000002 21.86 65-69 22.900000000000002 27.575 27.665 21.86 70-74 23.255 27.705000000000002 28.494999999999997 20.544999999999998 75-79 23.135 26.955000000000002 28.33 21.58 80-84 23.380000000000003 28.07 27.634999999999998 20.915 85-89 23.080000000000002 28.1 28.005000000000003 20.815 90-94 23.71 27.925 27.465 20.9 95-99 23.96 28.110000000000003 27.474999999999998 20.455000000000002 100-104 23.43 28.01 27.455000000000002 21.105 105-109 23.425 27.74 27.72 21.115000000000002 110-114 23.98 28.46 27.08 20.48 115-119 23.68 27.785 27.485 21.05 120-124 24.18 27.325 27.744999999999997 20.75 125-129 24.665 28.044999999999998 27.139999999999997 20.150000000000002 130-134 25.4 27.865000000000002 27.315 19.42 135-139 25.09 27.77 27.045 20.095 140-144 25.615 28.16 26.415 19.81 145-149 25.669999999999998 27.955000000000002 26.71 19.665 150-151 26.6 27.737499999999997 25.7375 19.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 1.0 10 2.0 11 1.0 12 0.5 13 1.5 14 1.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.5 20 1.5 21 0.5 22 3.0 23 3.5 24 3.5 25 5.0 26 6.0 27 7.5 28 6.5 29 8.5 30 16.5 31 19.5 32 29.0 33 37.5 34 47.0 35 68.5 36 87.5 37 108.5 38 127.0 39 152.0 40 181.0 41 204.0 42 235.0 43 257.5 44 272.5 45 271.0 46 260.5 47 256.0 48 248.0 49 224.0 50 184.0 51 149.5 52 118.0 53 95.0 54 74.0 55 57.5 56 46.0 57 32.0 58 22.0 59 15.5 60 12.0 61 10.0 62 4.0 63 2.0 64 3.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 1.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.725 #Duplication Level Percentage of deduplicated Percentage of total 1 90.38729451100586 81.10000000000001 2 8.080245193647254 14.499999999999998 3 1.3095569796600723 3.5249999999999995 4 0.19504040122596825 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.02786291446085261 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.425 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.7375 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 4.125 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.8125 0.0 0.0 0.0 0.0 128-129 5.2875 0.0 0.0 0.0 0.0 130-131 5.6625 0.0 0.0 0.0 0.0 132-133 6.2125 0.0 0.0 0.0 0.0 134-135 6.699999999999999 0.0 0.0 0.0 0.0 136-137 7.275 0.0 0.0 0.0 0.0 138-139 8.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra Read 569751 spots for SRR12690165.sra Written 569751 spots for SRR12690165.sra Read 569736 spots for SRR12690165.sra Written 569736 spots for SRR12690165.sra SRR ids: ['SRR12690165.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kh30gusk SRR12690165.sra spots: 11394735 blocks: [[1, 569736], [569737, 1139472], [1139473, 1709208], [1709209, 2278944], [2278945, 2848680], [2848681, 3418416], [3418417, 3988152], [3988153, 4557888], [4557889, 5127624], [5127625, 5697360], [5697361, 6267096], [6267097, 6836832], [6836833, 7406568], [7406569, 7976304], [7976305, 8546040], [8546041, 9115776], [9115777, 9685512], [9685513, 10255248], [10255249, 10824984], [10824985, 11394735]] SRR12690165 file size 3850729 SRR12690165 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690165 SRR12690165_1.fastq SRR12690165_2.fastq Input file: SRR12690165_1.fastq Paired file: SRR12690165_2.fastq trimmed: SRR12690165-trimmed-pair1.fastq, SRR12690165-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:15:39 2025 >> started Mon Feb 10 20:15:57 2025 >> done (17.747s) 11394735 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 816 ( 0.01%) empty read pairs filtered out after trimming by size control 11393897 (99.99%) read pairs available; of these: 1419597 (12.46%) trimmed read pairs available after processing 9974300 (87.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 3 0.00% 21 12 0.00% 22 16 0.00% 23 12 0.00% 24 11 0.00% 25 16 0.00% 26 19 0.00% 27 20 0.00% 28 20 0.00% 29 10 0.00% 30 16 0.00% 31 12 0.00% 32 17 0.00% 33 21 0.00% 34 18 0.00% 35 14 0.00% 36 24 0.00% 37 22 0.00% 38 13 0.00% 39 27 0.00% 40 18 0.00% 41 32 0.00% 42 27 0.00% 43 18 0.00% 44 30 0.00% 45 26 0.00% 46 52 0.00% 47 39 0.00% 48 53 0.00% 49 49 0.00% 50 72 0.00% 51 78 0.00% 52 82 0.00% 53 86 0.00% 54 91 0.00% 55 106 0.00% 56 98 0.00% 57 124 0.00% 58 138 0.00% 59 159 0.00% 60 177 0.00% 61 210 0.00% 62 203 0.00% 63 253 0.00% 64 297 0.00% 65 266 0.00% 66 366 0.00% 67 403 0.00% 68 450 0.00% 69 524 0.00% 70 607 0.01% 71 713 0.01% 72 828 0.01% 73 834 0.01% 74 1006 0.01% 75 1107 0.01% 76 1122 0.01% 77 1228 0.01% 78 1500 0.01% 79 1702 0.01% 80 1759 0.02% 81 2156 0.02% 82 2369 0.02% 83 2526 0.02% 84 3027 0.03% 85 3195 0.03% 86 3445 0.03% 87 3684 0.03% 88 3763 0.03% 89 4241 0.04% 90 4639 0.04% 91 5237 0.05% 92 5651 0.05% 93 6178 0.05% 94 6664 0.06% 95 7058 0.06% 96 7359 0.06% 97 7803 0.07% 98 8149 0.07% 99 8525 0.07% 100 9220 0.08% 101 9743 0.09% 102 10587 0.09% 103 11348 0.10% 104 11977 0.11% 105 12483 0.11% 106 12898 0.11% 107 13047 0.11% 108 13447 0.12% 109 14268 0.13% 110 14627 0.13% 111 15461 0.14% 112 16493 0.14% 113 17218 0.15% 114 17932 0.16% 115 18911 0.17% 116 19235 0.17% 117 19552 0.17% 118 20265 0.18% 119 20418 0.18% 120 21365 0.19% 121 22633 0.20% 122 23173 0.20% 123 23828 0.21% 124 25872 0.23% 125 25841 0.23% 126 26669 0.23% 127 26862 0.24% 128 27425 0.24% 129 27779 0.24% 130 28673 0.25% 131 29120 0.26% 132 30190 0.26% 133 31388 0.28% 134 32219 0.28% 135 32935 0.29% 136 33547 0.29% 137 34296 0.30% 138 34851 0.31% 139 35343 0.31% 140 35836 0.31% 141 36065 0.32% 142 36946 0.32% 143 37977 0.33% 144 39514 0.35% 145 40182 0.35% 146 41002 0.36% 147 40961 0.36% 148 41862 0.37% 149 41230 0.36% 150 41949 0.37% 151 9974300 87.54% 11393897 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=21 prefix-density=0.65 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=11.20 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=3.5 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=22 prefix-density=0.80 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=34.18 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.9 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAA SRR12690165 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:16:52 Started mapping on | Feb 10 20:16:53 Finished on | Feb 10 20:18:01 Mapping speed, Million of reads per hour | 603.21 Number of input reads | 11393897 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10687896 Uniquely mapped reads % | 93.80% Average mapped length | 294.78 Number of splices: Total | 10908658 Number of splices: Annotated (sjdb) | 10680942 Number of splices: GT/AG | 10690577 Number of splices: GC/AG | 176344 Number of splices: AT/AC | 7928 Number of splices: Non-canonical | 33809 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250796 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 30858 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.61% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 455205 455205 455205 N_multimapping 250796 250796 250796 N_noFeature 398965 10560502 441249 N_ambiguous 144792 538 59349 UnstrandedReadsAssigned:10144139 PositiveStrandReadsAssigned:126856 NegativeStrandReadsAssigned:10187298 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690165 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690165-trimmed-pair1.fastq SRR12690165-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,393,897 reads, 10,255,370 reads pseudoaligned [quant] estimated average fragment length: 243.79 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR12690165.ke.tsv 34699 SRR12690165.se.tsv 87100 total ==> SRR12690165.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.21 325 17.3017 Potri.005G024800.1.v4.1 1035 792.21 278 33.1634 Potri.004G059700.1.v4.1 961 718.368 21 2.76266 Potri.007G009000.2.v4.1 1416 1173.21 0 0 Potri.003G141000.2.v4.1 2943 2700.21 425.466 14.8909 Potri.016G087400.1.v4.1 270 86.434 422 461.405 Potri.015G069301.1.v4.1 564 331.863 0 0 Potri.010G195200.1.v4.1 1773 1530.21 21 1.29695 Potri.012G127500.1.v4.1 977 734.284 80 10.2963 ==> SRR12690165.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 167 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR12690165 completed mapping pipeline successfully