Starting /dee2/code/volunteer_pipeline.sh SRR12690166 current disk space = 3056048660480 free memory = 1474373236 SRR12690166 SRAfilesize 358135c26f5845a97890931b8822d4b0 SRR12690166.sra SRR12690166.sra file validated SRR12690166 is paired end SRR12690166 is conventional basespace SRR12690166 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690166_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6555 37.0 37.0 37.0 37.0 37.0 2 36.25 37.0 37.0 37.0 37.0 37.0 3 36.616 37.0 37.0 37.0 37.0 37.0 4 36.616 37.0 37.0 37.0 37.0 37.0 5 36.7515 37.0 37.0 37.0 37.0 37.0 6 36.6175 37.0 37.0 37.0 37.0 37.0 7 36.5925 37.0 37.0 37.0 37.0 37.0 8 36.639 37.0 37.0 37.0 37.0 37.0 9 36.649 37.0 37.0 37.0 37.0 37.0 10-14 36.620400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.603300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5532 37.0 37.0 37.0 37.0 37.0 25-29 36.525400000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.5329 37.0 37.0 37.0 37.0 37.0 35-39 36.4887 37.0 37.0 37.0 37.0 37.0 40-44 36.511 37.0 37.0 37.0 37.0 37.0 45-49 36.485699999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.4699 37.0 37.0 37.0 37.0 37.0 55-59 36.4162 37.0 37.0 37.0 37.0 37.0 60-64 36.4165 37.0 37.0 37.0 37.0 37.0 65-69 36.3341 37.0 37.0 37.0 37.0 37.0 70-74 36.3615 37.0 37.0 37.0 37.0 37.0 75-79 36.3421 37.0 37.0 37.0 37.0 37.0 80-84 36.2751 37.0 37.0 37.0 37.0 37.0 85-89 36.2897 37.0 37.0 37.0 37.0 37.0 90-94 36.2606 37.0 37.0 37.0 37.0 37.0 95-99 36.27729999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.1971 37.0 37.0 37.0 37.0 37.0 105-109 36.1915 37.0 37.0 37.0 37.0 37.0 110-114 36.2064 37.0 37.0 37.0 37.0 37.0 115-119 36.1531 37.0 37.0 37.0 37.0 37.0 120-124 36.0635 37.0 37.0 37.0 37.0 37.0 125-129 36.0279 37.0 37.0 37.0 37.0 37.0 130-134 35.993399999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.9478 37.0 37.0 37.0 37.0 37.0 140-144 35.813900000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.794 37.0 37.0 37.0 37.0 37.0 150-151 35.6135 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 0.0 25 2.0 26 5.0 27 4.0 28 10.0 29 17.0 30 25.0 31 33.0 32 45.0 33 64.0 34 94.0 35 292.0 36 3037.0 37 370.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.65 11.575000000000001 7.8 40.975 2 19.828887770508306 12.02818319073981 36.940110719677904 31.202818319073984 3 17.8 13.100000000000001 28.95 40.150000000000006 4 21.0 21.425 24.2 33.375 5 21.5 29.675 25.624999999999996 23.200000000000003 6 22.175 34.075 23.150000000000002 20.599999999999998 7 16.75 27.474999999999998 37.824999999999996 17.95 8 18.55 27.200000000000003 30.325000000000003 23.925 9 17.45 24.95 35.0 22.6 10-14 20.27 28.895 27.85 22.985 15-19 20.474999999999998 27.765 27.250000000000004 24.51 20-24 20.200000000000003 27.605 28.46 23.735 25-29 19.865 27.775 28.050000000000004 24.310000000000002 30-34 19.985 28.1 27.650000000000002 24.265 35-39 20.445 27.47 28.12 23.965 40-44 20.365 28.175 27.97 23.49 45-49 20.599999999999998 27.66 27.644999999999996 24.095 50-54 20.61 27.87 28.050000000000004 23.47 55-59 20.145 27.975 27.700000000000003 24.18 60-64 20.785 27.105 27.575 24.535 65-69 21.255 27.634999999999998 27.525 23.585 70-74 20.52 27.950000000000003 27.765 23.765 75-79 20.669999999999998 28.189999999999998 27.72 23.419999999999998 80-84 20.405 27.82 27.61 24.165 85-89 20.025000000000002 28.01 28.084999999999997 23.880000000000003 90-94 20.86 27.3 27.534999999999997 24.305 95-99 20.77 27.505000000000003 27.875 23.849999999999998 100-104 20.215 28.155 27.41 24.22 105-109 20.655 28.355000000000004 27.355 23.635 110-114 20.57 28.125 27.32 23.985 115-119 20.805 27.76 28.38 23.055 120-124 21.075 27.189999999999998 27.939999999999998 23.794999999999998 125-129 20.865000000000002 28.1 26.865 24.169999999999998 130-134 20.9 28.065 27.0 24.035 135-139 20.86 28.060000000000002 27.215 23.865 140-144 21.765 27.705000000000002 27.12 23.41 145-149 20.919999999999998 27.74 26.950000000000003 24.39 150-151 21.55 27.4125 26.775 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 1.5 25 4.0 26 4.0 27 5.5 28 6.0 29 9.5 30 13.5 31 17.5 32 23.5 33 37.5 34 54.0 35 66.0 36 73.5 37 94.5 38 127.0 39 155.0 40 174.5 41 184.0 42 201.5 43 234.0 44 275.5 45 264.5 46 239.5 47 256.5 48 248.0 49 214.0 50 195.5 51 172.5 52 144.5 53 114.0 54 83.5 55 71.5 56 64.5 57 49.0 58 42.5 59 31.0 60 13.5 61 7.5 62 7.0 63 5.5 64 3.0 65 2.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.65 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.175 #Duplication Level Percentage of deduplicated Percentage of total 1 92.27013832384053 85.05 2 7.106048277732574 13.100000000000001 3 0.5153241117439653 1.425 4 0.08136696501220504 0.3 5 0.027122321670735017 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCGTCCTGATCAGACCGTCCGGATTGTTCTGATGCCCCAAAATCAGTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.6749999999999998 0.0 0.0 0.0 0.0 116-117 1.9249999999999998 0.0 0.0 0.0 0.0 118-119 2.1500000000000004 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.7874999999999996 0.0 0.0 0.0 0.0 124-125 3.25 0.0 0.0 0.0 0.0 126-127 3.5625 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.2375 0.0 0.0 0.0 0.0 132-133 4.675 0.0 0.0 0.0 0.0 134-135 5.074999999999999 0.0 0.0 0.0 0.0 136-137 5.3625 0.0 0.0 0.0 0.0 138-139 5.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690166 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690166_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.377 37.0 37.0 37.0 37.0 37.0 2 36.2155 37.0 37.0 37.0 37.0 37.0 3 36.148 37.0 37.0 37.0 37.0 37.0 4 36.1805 37.0 37.0 37.0 37.0 37.0 5 36.4095 37.0 37.0 37.0 37.0 37.0 6 36.307 37.0 37.0 37.0 37.0 37.0 7 36.319 37.0 37.0 37.0 37.0 37.0 8 36.384 37.0 37.0 37.0 37.0 37.0 9 36.419 37.0 37.0 37.0 37.0 37.0 10-14 36.3121 37.0 37.0 37.0 37.0 37.0 15-19 36.3241 37.0 37.0 37.0 37.0 37.0 20-24 36.330200000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.2966 37.0 37.0 37.0 37.0 37.0 30-34 36.262899999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.2523 37.0 37.0 37.0 37.0 37.0 40-44 36.154700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.1743 37.0 37.0 37.0 37.0 37.0 50-54 36.15689999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.1515 37.0 37.0 37.0 37.0 37.0 60-64 36.143299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.0918 37.0 37.0 37.0 37.0 37.0 70-74 35.9831 37.0 37.0 37.0 37.0 37.0 75-79 36.083600000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.01649999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.003 37.0 37.0 37.0 37.0 37.0 90-94 35.91029999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.9503 37.0 37.0 37.0 37.0 37.0 100-104 35.91610000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.897299999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.86659999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.8058 37.0 37.0 37.0 37.0 37.0 120-124 35.7651 37.0 37.0 37.0 37.0 37.0 125-129 35.702799999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.5939 37.0 37.0 37.0 37.0 37.0 135-139 35.5389 37.0 37.0 37.0 37.0 37.0 140-144 35.528499999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.3344 37.0 37.0 37.0 32.2 37.0 150-151 35.05825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 1.0 15 2.0 16 2.0 17 0.0 18 1.0 19 0.0 20 2.0 21 3.0 22 1.0 23 8.0 24 5.0 25 5.0 26 10.0 27 8.0 28 11.0 29 14.0 30 19.0 31 39.0 32 67.0 33 72.0 34 164.0 35 497.0 36 2798.0 37 267.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.975 25.25 11.275 28.499999999999996 2 28.249999999999996 28.95 27.725 15.075 3 20.349999999999998 28.475 30.325000000000003 20.849999999999998 4 23.325000000000003 34.175 24.474999999999998 18.025 5 24.5 36.35 23.075000000000003 16.075 6 20.775 38.725 23.0 17.5 7 21.224999999999998 23.724999999999998 36.725 18.325 8 20.849999999999998 28.000000000000004 27.800000000000004 23.35 9 21.725 24.375 30.7 23.200000000000003 10-14 23.044999999999998 29.485 26.325 21.145 15-19 22.845 28.685 27.575 20.895 20-24 22.775000000000002 28.444999999999997 28.110000000000003 20.669999999999998 25-29 23.715 28.34 27.255000000000003 20.69 30-34 22.48 28.860000000000003 27.055 21.605 35-39 22.745 28.225 27.735 21.295 40-44 22.52 28.449999999999996 28.110000000000003 20.919999999999998 45-49 22.939999999999998 28.315 27.395000000000003 21.349999999999998 50-54 23.21 28.465 27.455000000000002 20.87 55-59 22.62 28.294999999999998 27.805000000000003 21.279999999999998 60-64 22.58 27.79 27.950000000000003 21.68 65-69 23.365 28.050000000000004 27.310000000000002 21.275 70-74 23.78 27.455000000000002 27.48 21.285 75-79 22.564999999999998 27.965 27.839999999999996 21.63 80-84 23.84 28.415000000000003 26.575 21.17 85-89 23.825 27.57 27.084999999999997 21.52 90-94 23.84 27.534999999999997 27.450000000000003 21.175 95-99 23.59 28.185 27.015 21.21 100-104 24.2 27.725 27.145000000000003 20.93 105-109 23.56 28.110000000000003 26.69 21.64 110-114 23.695 28.225 27.034999999999997 21.044999999999998 115-119 24.215 28.610000000000003 26.655 20.52 120-124 24.21 28.09 26.724999999999998 20.974999999999998 125-129 24.435000000000002 27.860000000000003 26.275 21.43 130-134 24.525 27.575 27.205000000000002 20.695 135-139 24.545 27.750000000000004 27.310000000000002 20.395 140-144 25.15 27.985 26.334999999999997 20.53 145-149 25.314999999999998 28.205000000000002 26.745 19.735 150-151 25.775 29.15 25.4375 19.6375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 1.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 0.5 23 3.0 24 3.0 25 1.5 26 3.0 27 2.0 28 2.0 29 7.0 30 14.0 31 18.0 32 27.5 33 39.5 34 47.5 35 60.0 36 80.0 37 104.5 38 144.5 39 190.0 40 212.0 41 220.0 42 247.0 43 273.5 44 271.5 45 271.0 46 261.0 47 222.5 48 211.5 49 202.5 50 163.0 51 131.0 52 109.0 53 85.0 54 74.0 55 68.0 56 52.0 57 44.5 58 30.0 59 17.5 60 16.0 61 13.5 62 9.5 63 7.0 64 6.0 65 5.0 66 3.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 1.5 73 2.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.9420923245015 84.15 2 7.265774378585086 13.3 3 0.5736137667304015 1.575 4 0.10925976509150505 0.4 5 0.054629882545752524 0.25 6 0.027314941272876262 0.15 7 0.027314941272876262 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit GTTTTATCCAGCACAGACAGTACCTACATCTTATCCAGCACCGAATCCTG 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.6749999999999998 0.0 0.0 0.0 0.0 116-117 1.9249999999999998 0.0 0.0 0.0 0.0 118-119 2.1500000000000004 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.7874999999999996 0.0 0.0 0.0 0.0 124-125 3.25 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.85 0.0 0.0 0.0 0.0 130-131 4.225 0.0 0.0 0.0 0.0 132-133 4.675 0.0 0.0 0.0 0.0 134-135 5.074999999999999 0.0 0.0 0.0 0.0 136-137 5.3625 0.0 0.0 0.0 0.0 138-139 5.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGTTC 10 0.006830828 145.0 8 >>END_MODULE Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062693 spots for SRR12690166.sra Written 1062693 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra Read 1062685 spots for SRR12690166.sra Written 1062685 spots for SRR12690166.sra SRR ids: ['SRR12690166.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oql3rhtq SRR12690166.sra spots: 21253708 blocks: [[1, 1062685], [1062686, 2125370], [2125371, 3188055], [3188056, 4250740], [4250741, 5313425], [5313426, 6376110], [6376111, 7438795], [7438796, 8501480], [8501481, 9564165], [9564166, 10626850], [10626851, 11689535], [11689536, 12752220], [12752221, 13814905], [13814906, 14877590], [14877591, 15940275], [15940276, 17002960], [17002961, 18065645], [18065646, 19128330], [19128331, 20191015], [20191016, 21253708]] SRR12690166 file size 7201239 SRR12690166 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690166 SRR12690166_1.fastq SRR12690166_2.fastq Input file: SRR12690166_1.fastq Paired file: SRR12690166_2.fastq trimmed: SRR12690166-trimmed-pair1.fastq, SRR12690166-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:40:01 2025 >> started Mon Feb 10 20:40:27 2025 >> done (25.563s) 21253708 read pairs processed; of these: 50 ( 0.00%) short read pairs filtered out after trimming by size control 3652 ( 0.02%) empty read pairs filtered out after trimming by size control 21250006 (99.98%) read pairs available; of these: 2203886 (10.37%) trimmed read pairs available after processing 19046120 (89.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 4 0.00% 21 6 0.00% 22 11 0.00% 23 8 0.00% 24 16 0.00% 25 14 0.00% 26 11 0.00% 27 8 0.00% 28 17 0.00% 29 11 0.00% 30 15 0.00% 31 18 0.00% 32 13 0.00% 33 21 0.00% 34 33 0.00% 35 21 0.00% 36 20 0.00% 37 13 0.00% 38 29 0.00% 39 35 0.00% 40 32 0.00% 41 24 0.00% 42 38 0.00% 43 35 0.00% 44 40 0.00% 45 30 0.00% 46 49 0.00% 47 60 0.00% 48 62 0.00% 49 64 0.00% 50 52 0.00% 51 83 0.00% 52 95 0.00% 53 104 0.00% 54 127 0.00% 55 137 0.00% 56 166 0.00% 57 141 0.00% 58 161 0.00% 59 208 0.00% 60 265 0.00% 61 280 0.00% 62 313 0.00% 63 342 0.00% 64 368 0.00% 65 399 0.00% 66 525 0.00% 67 564 0.00% 68 588 0.00% 69 718 0.00% 70 789 0.00% 71 883 0.00% 72 1091 0.01% 73 1125 0.01% 74 1264 0.01% 75 1495 0.01% 76 1633 0.01% 77 1877 0.01% 78 1980 0.01% 79 2212 0.01% 80 2508 0.01% 81 2965 0.01% 82 3064 0.01% 83 3468 0.02% 84 3726 0.02% 85 4293 0.02% 86 4821 0.02% 87 5246 0.02% 88 5553 0.03% 89 6208 0.03% 90 6657 0.03% 91 7119 0.03% 92 7595 0.04% 93 8392 0.04% 94 9344 0.04% 95 10143 0.05% 96 10588 0.05% 97 11291 0.05% 98 12062 0.06% 99 12633 0.06% 100 13728 0.06% 101 14164 0.07% 102 15274 0.07% 103 15457 0.07% 104 16848 0.08% 105 17633 0.08% 106 18436 0.09% 107 19554 0.09% 108 20604 0.10% 109 21450 0.10% 110 21904 0.10% 111 22970 0.11% 112 23978 0.11% 113 25002 0.12% 114 26175 0.12% 115 27440 0.13% 116 28554 0.13% 117 30062 0.14% 118 31436 0.15% 119 31823 0.15% 120 33714 0.16% 121 34632 0.16% 122 35635 0.17% 123 36902 0.17% 124 38166 0.18% 125 39049 0.18% 126 40176 0.19% 127 41589 0.20% 128 42922 0.20% 129 43691 0.21% 130 45616 0.21% 131 46380 0.22% 132 47451 0.22% 133 49359 0.23% 134 49599 0.23% 135 50720 0.24% 136 52566 0.25% 137 53133 0.25% 138 54481 0.26% 139 56641 0.27% 140 58042 0.27% 141 59602 0.28% 142 60663 0.29% 143 61739 0.29% 144 63661 0.30% 145 63655 0.30% 146 66301 0.31% 147 66719 0.31% 148 68835 0.32% 149 69444 0.33% 150 71886 0.34% 151 19046120 89.63% 21250006 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.44 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=519.09 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCGGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGT criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=34 prefix-density=0.64 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=29.35 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12690166 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:41:23 Started mapping on | Feb 10 20:41:23 Finished on | Feb 10 20:43:53 Mapping speed, Million of reads per hour | 510.00 Number of input reads | 21250006 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20215411 Uniquely mapped reads % | 95.13% Average mapped length | 296.24 Number of splices: Total | 20225408 Number of splices: Annotated (sjdb) | 19696207 Number of splices: GT/AG | 19824935 Number of splices: GC/AG | 313074 Number of splices: AT/AC | 16331 Number of splices: Non-canonical | 71068 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 507560 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 159259 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 527035 527035 527035 N_multimapping 507560 507560 507560 N_noFeature 790133 19905472 878459 N_ambiguous 340574 1198 118228 UnstrandedReadsAssigned:19084704 PositiveStrandReadsAssigned:308741 NegativeStrandReadsAssigned:19218724 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690166 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690166-trimmed-pair1.fastq SRR12690166-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,250,006 reads, 19,202,212 reads pseudoaligned [quant] estimated average fragment length: 254.879 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR12690166.ke.tsv 34699 SRR12690166.se.tsv 87100 total ==> SRR12690166.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.12 529 12.44 Potri.005G024800.1.v4.1 1035 781.121 241 12.7994 Potri.004G059700.1.v4.1 961 707.307 105 6.15848 Potri.007G009000.2.v4.1 1416 1162.12 0 0 Potri.003G141000.2.v4.1 2943 2689.12 761.389 11.746 Potri.016G087400.1.v4.1 270 82.4766 1040 523.112 Potri.015G069301.1.v4.1 564 321.994 0 0 Potri.010G195200.1.v4.1 1773 1519.12 12 0.327704 Potri.012G127500.1.v4.1 977 723.179 449 25.7568 ==> SRR12690166.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 443 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 266 Potri.001G212900.v4.1 55 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 35 SRR12690166 completed mapping pipeline successfully