Starting /dee2/code/volunteer_pipeline.sh SRR12690167 current disk space = 3056117080064 free memory = 1163122164 SRR12690167 SRAfilesize eb6088a02ad7ab9ebfcc0e09934f7246 SRR12690167.sra SRR12690167.sra file validated SRR12690167 is paired end SRR12690167 is conventional basespace SRR12690167 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690167_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5965 37.0 37.0 37.0 37.0 37.0 2 36.414 37.0 37.0 37.0 37.0 37.0 3 36.5855 37.0 37.0 37.0 37.0 37.0 4 36.662 37.0 37.0 37.0 37.0 37.0 5 36.6725 37.0 37.0 37.0 37.0 37.0 6 36.654 37.0 37.0 37.0 37.0 37.0 7 36.64 37.0 37.0 37.0 37.0 37.0 8 36.573 37.0 37.0 37.0 37.0 37.0 9 36.6525 37.0 37.0 37.0 37.0 37.0 10-14 36.65069999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.6463 37.0 37.0 37.0 37.0 37.0 20-24 36.605 37.0 37.0 37.0 37.0 37.0 25-29 36.53320000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.5175 37.0 37.0 37.0 37.0 37.0 35-39 36.5339 37.0 37.0 37.0 37.0 37.0 40-44 36.51 37.0 37.0 37.0 37.0 37.0 45-49 36.527 37.0 37.0 37.0 37.0 37.0 50-54 36.4733 37.0 37.0 37.0 37.0 37.0 55-59 36.41700000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.441100000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.384 37.0 37.0 37.0 37.0 37.0 70-74 36.3765 37.0 37.0 37.0 37.0 37.0 75-79 36.3441 37.0 37.0 37.0 37.0 37.0 80-84 36.3251 37.0 37.0 37.0 37.0 37.0 85-89 36.308800000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2787 37.0 37.0 37.0 37.0 37.0 95-99 36.204100000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1719 37.0 37.0 37.0 37.0 37.0 105-109 36.1907 37.0 37.0 37.0 37.0 37.0 110-114 36.149100000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1502 37.0 37.0 37.0 37.0 37.0 120-124 36.085699999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.033300000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.007 37.0 37.0 37.0 37.0 37.0 135-139 36.033100000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.8464 37.0 37.0 37.0 37.0 37.0 145-149 35.845299999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.665 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 4.0 27 2.0 28 6.0 29 13.0 30 21.0 31 40.0 32 32.0 33 74.0 34 101.0 35 316.0 36 3039.0 37 349.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.775 10.549999999999999 7.725 41.949999999999996 2 18.931795386158477 12.88866599799398 36.88565697091274 31.293881644934807 3 16.325 15.25 27.35 41.075 4 21.5 22.25 24.775 31.474999999999998 5 23.05 29.549999999999997 24.9 22.5 6 20.625 32.725 24.5 22.15 7 15.425 25.174999999999997 41.5 17.9 8 17.474999999999998 25.75 31.624999999999996 25.15 9 17.8 24.425 34.125 23.65 10-14 19.77 29.465000000000003 27.92 22.845 15-19 19.975 27.900000000000002 27.725 24.4 20-24 19.8 28.485 28.18 23.535 25-29 20.455000000000002 28.08 27.425 24.04 30-34 20.369999999999997 28.13 27.139999999999997 24.36 35-39 19.915 27.855 27.815 24.415 40-44 19.91 28.645 28.005000000000003 23.44 45-49 20.195 27.800000000000004 27.584999999999997 24.42 50-54 20.565 28.09 27.694999999999997 23.65 55-59 20.06 28.525 27.495000000000005 23.919999999999998 60-64 20.05 28.175 27.534999999999997 24.240000000000002 65-69 20.44 27.944999999999997 27.705000000000002 23.91 70-74 20.16 28.1 27.224999999999998 24.515 75-79 19.985 27.084999999999997 28.33 24.6 80-84 20.235 28.16 27.73 23.875 85-89 20.575 28.625 26.91 23.89 90-94 19.84 27.639999999999997 27.860000000000003 24.66 95-99 20.605 27.935 28.025 23.435 100-104 20.285 28.435 27.650000000000002 23.630000000000003 105-109 20.845 27.639999999999997 28.115000000000002 23.400000000000002 110-114 20.990000000000002 27.715 27.750000000000004 23.544999999999998 115-119 21.18 28.215 27.71 22.895 120-124 20.76 28.165000000000003 27.275 23.799999999999997 125-129 20.94 28.044999999999998 26.86 24.154999999999998 130-134 20.595 27.750000000000004 27.35 24.305 135-139 21.015 27.985 27.150000000000002 23.849999999999998 140-144 21.085 28.249999999999996 27.025 23.64 145-149 21.2 27.85 27.805000000000003 23.145 150-151 20.875 29.012500000000003 25.687500000000004 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 2.5 21 3.5 22 1.5 23 2.0 24 2.5 25 3.0 26 3.5 27 3.0 28 7.5 29 12.0 30 13.0 31 20.5 32 28.0 33 31.5 34 45.5 35 68.0 36 73.0 37 85.0 38 120.5 39 149.5 40 177.5 41 202.5 42 224.5 43 255.5 44 278.0 45 271.5 46 255.0 47 255.5 48 257.0 49 234.0 50 181.0 51 140.0 52 128.0 53 101.0 54 77.5 55 66.5 56 55.5 57 44.0 58 31.0 59 31.5 60 25.5 61 13.0 62 8.0 63 4.0 64 1.5 65 2.0 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.1360544217687 84.65 2 6.938775510204081 12.75 3 0.8707482993197279 2.4 4 0.05442176870748299 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.6500000000000004 0.0 0.0 0.0 0.0 122-123 3.0999999999999996 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.7875 0.0 0.0 0.0 0.0 128-129 4.175 0.0 0.0 0.0 0.0 130-131 4.574999999999999 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.3375 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTCGA 10 0.006830828 145.0 2 ACACGTC 35 0.0035366106 20.714287 135-139 TCTGAAC 35 0.0035366106 20.714287 140-144 CACGTCT 40 0.0076550315 18.125 135-139 CTGAACT 40 0.0076550315 18.125 140-144 >>END_MODULE SRR12690167 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690167_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.363 37.0 37.0 37.0 37.0 37.0 2 36.0925 37.0 37.0 37.0 37.0 37.0 3 36.12 37.0 37.0 37.0 37.0 37.0 4 36.2455 37.0 37.0 37.0 37.0 37.0 5 36.3505 37.0 37.0 37.0 37.0 37.0 6 36.121 37.0 37.0 37.0 37.0 37.0 7 36.2385 37.0 37.0 37.0 37.0 37.0 8 36.343 37.0 37.0 37.0 37.0 37.0 9 36.2545 37.0 37.0 37.0 37.0 37.0 10-14 36.2624 37.0 37.0 37.0 37.0 37.0 15-19 36.2658 37.0 37.0 37.0 37.0 37.0 20-24 36.249199999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.24249999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.17 37.0 37.0 37.0 37.0 37.0 35-39 36.1768 37.0 37.0 37.0 37.0 37.0 40-44 36.1455 37.0 37.0 37.0 37.0 37.0 45-49 36.1154 37.0 37.0 37.0 37.0 37.0 50-54 36.033100000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.07770000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.9947 37.0 37.0 37.0 37.0 37.0 65-69 35.96249999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.8947 37.0 37.0 37.0 37.0 37.0 75-79 35.9651 37.0 37.0 37.0 37.0 37.0 80-84 35.946000000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.8929 37.0 37.0 37.0 37.0 37.0 90-94 35.765499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8168 37.0 37.0 37.0 37.0 37.0 100-104 35.9159 37.0 37.0 37.0 37.0 37.0 105-109 35.8566 37.0 37.0 37.0 37.0 37.0 110-114 35.7321 37.0 37.0 37.0 37.0 37.0 115-119 35.624700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.6663 37.0 37.0 37.0 37.0 37.0 125-129 35.5827 37.0 37.0 37.0 37.0 37.0 130-134 35.5552 37.0 37.0 37.0 37.0 37.0 135-139 35.461800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.450399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.297900000000006 37.0 37.0 37.0 32.2 37.0 150-151 34.925749999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 1.0 15 8.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.0 21 3.0 22 3.0 23 3.0 24 4.0 25 1.0 26 8.0 27 8.0 28 13.0 29 25.0 30 29.0 31 38.0 32 55.0 33 87.0 34 214.0 35 580.0 36 2656.0 37 257.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.275000000000006 23.35 10.475 28.9 2 26.125 27.400000000000002 30.625000000000004 15.85 3 18.775 29.15 31.1 20.974999999999998 4 23.1 34.449999999999996 25.05 17.4 5 23.125 36.625 21.925 18.325 6 20.275000000000002 39.574999999999996 22.725 17.424999999999997 7 21.525 20.875 37.775 19.825 8 20.275000000000002 26.900000000000002 28.325 24.5 9 20.65 25.374999999999996 31.25 22.725 10-14 23.21 29.085 26.455000000000002 21.25 15-19 22.605 28.18 27.825 21.39 20-24 23.06 28.599999999999998 27.055 21.285 25-29 22.37 27.85 29.01 20.77 30-34 22.355 29.099999999999998 27.375 21.17 35-39 22.355 27.994999999999997 27.894999999999996 21.755 40-44 23.044999999999998 27.93 27.584999999999997 21.44 45-49 22.46 27.915 28.09 21.535 50-54 22.79 28.46 27.615000000000002 21.135 55-59 22.825 27.779999999999998 28.015 21.38 60-64 22.939999999999998 27.925 27.655 21.48 65-69 22.98 27.575 28.04 21.404999999999998 70-74 22.82 27.860000000000003 27.785 21.535 75-79 22.525000000000002 27.975 27.495000000000005 22.005 80-84 23.32 27.810000000000002 27.425 21.445 85-89 24.12 27.515 27.04 21.325 90-94 23.175 28.04 27.150000000000002 21.634999999999998 95-99 23.24 27.534999999999997 27.865000000000002 21.36 100-104 23.755000000000003 27.565 27.055 21.625 105-109 23.895 28.105000000000004 27.544999999999998 20.455000000000002 110-114 23.355 28.365000000000002 27.35 20.93 115-119 24.375 28.549999999999997 26.900000000000002 20.175 120-124 24.295 28.144999999999996 27.175 20.385 125-129 24.725 27.800000000000004 26.355 21.12 130-134 24.79 28.000000000000004 26.525 20.685000000000002 135-139 24.169999999999998 27.66 27.700000000000003 20.47 140-144 25.324999999999996 27.205000000000002 27.49 19.98 145-149 24.945 27.775 26.71 20.57 150-151 25.887500000000003 28.287499999999998 26.150000000000002 19.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.5 22 1.5 23 0.5 24 1.0 25 1.0 26 2.0 27 6.5 28 7.0 29 10.0 30 16.0 31 17.5 32 31.0 33 37.5 34 50.0 35 74.5 36 88.0 37 114.0 38 133.5 39 166.5 40 206.5 41 233.5 42 245.5 43 263.0 44 268.5 45 241.0 46 237.0 47 242.0 48 242.5 49 218.5 50 164.5 51 124.0 52 113.0 53 95.0 54 78.5 55 64.0 56 46.0 57 39.0 58 31.0 59 27.5 60 20.0 61 8.5 62 5.0 63 4.5 64 3.0 65 2.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 1.0 84 1.0 85 0.5 86 0.5 87 0.5 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.55 #Duplication Level Percentage of deduplicated Percentage of total 1 92.43582741671219 84.625 2 6.362643364281813 11.65 3 0.9284543965046422 2.55 4 0.1638448935008192 0.6 5 0.05461496450027307 0.25 6 0.027307482250136534 0.15 7 0.027307482250136534 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.2750000000000004 0.0 0.0 0.0 0.0 118-119 2.475 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.4749999999999996 0.0 0.0 0.0 0.0 126-127 3.7875 0.0 0.0 0.0 0.0 128-129 4.175 0.0 0.0 0.0 0.0 130-131 4.574999999999999 0.0 0.0 0.0 0.0 132-133 4.9125 0.0 0.0 0.0 0.0 134-135 5.3375 0.0 0.0 0.0 0.0 136-137 5.8875 0.0 0.0 0.0 0.0 138-139 6.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGTGT 35 0.0035366106 20.714287 135-139 TCGTGTA 35 0.0035366106 20.714287 135-139 GTAGGGA 35 0.0035366106 20.714287 140-144 GAGCGTC 40 0.0076550315 18.125 130-134 >>END_MODULE Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582771 spots for SRR12690167.sra Written 582771 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra Read 582765 spots for SRR12690167.sra Written 582765 spots for SRR12690167.sra SRR ids: ['SRR12690167.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mam_7_yu SRR12690167.sra spots: 11655306 blocks: [[1, 582765], [582766, 1165530], [1165531, 1748295], [1748296, 2331060], [2331061, 2913825], [2913826, 3496590], [3496591, 4079355], [4079356, 4662120], [4662121, 5244885], [5244886, 5827650], [5827651, 6410415], [6410416, 6993180], [6993181, 7575945], [7575946, 8158710], [8158711, 8741475], [8741476, 9324240], [9324241, 9907005], [9907006, 10489770], [10489771, 11072535], [11072536, 11655306]] SRR12690167 file size 3939282 SRR12690167 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690167 SRR12690167_1.fastq SRR12690167_2.fastq Input file: SRR12690167_1.fastq Paired file: SRR12690167_2.fastq trimmed: SRR12690167-trimmed-pair1.fastq, SRR12690167-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:26:05 2025 >> started Mon Feb 10 20:26:20 2025 >> done (15.474s) 11655306 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 1360 ( 0.01%) empty read pairs filtered out after trimming by size control 11653925 (99.99%) read pairs available; of these: 1153238 ( 9.90%) trimmed read pairs available after processing 10500687 (90.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 0 0.00% 22 3 0.00% 23 6 0.00% 24 4 0.00% 25 2 0.00% 26 9 0.00% 27 3 0.00% 28 9 0.00% 29 12 0.00% 30 5 0.00% 31 8 0.00% 32 10 0.00% 33 14 0.00% 34 12 0.00% 35 15 0.00% 36 14 0.00% 37 12 0.00% 38 12 0.00% 39 13 0.00% 40 15 0.00% 41 22 0.00% 42 25 0.00% 43 21 0.00% 44 23 0.00% 45 23 0.00% 46 25 0.00% 47 42 0.00% 48 30 0.00% 49 56 0.00% 50 44 0.00% 51 53 0.00% 52 55 0.00% 53 62 0.00% 54 64 0.00% 55 69 0.00% 56 81 0.00% 57 95 0.00% 58 108 0.00% 59 131 0.00% 60 136 0.00% 61 172 0.00% 62 181 0.00% 63 199 0.00% 64 252 0.00% 65 274 0.00% 66 336 0.00% 67 298 0.00% 68 378 0.00% 69 424 0.00% 70 506 0.00% 71 600 0.01% 72 680 0.01% 73 663 0.01% 74 800 0.01% 75 891 0.01% 76 982 0.01% 77 1097 0.01% 78 1247 0.01% 79 1325 0.01% 80 1495 0.01% 81 1696 0.01% 82 1872 0.02% 83 2094 0.02% 84 2261 0.02% 85 2536 0.02% 86 2692 0.02% 87 2969 0.03% 88 3253 0.03% 89 3462 0.03% 90 3788 0.03% 91 4002 0.03% 92 4415 0.04% 93 4638 0.04% 94 5058 0.04% 95 5519 0.05% 96 5889 0.05% 97 6300 0.05% 98 6484 0.06% 99 6786 0.06% 100 7394 0.06% 101 7509 0.06% 102 8057 0.07% 103 8502 0.07% 104 8901 0.08% 105 9237 0.08% 106 9967 0.09% 107 10162 0.09% 108 10566 0.09% 109 11130 0.10% 110 11798 0.10% 111 11969 0.10% 112 12580 0.11% 113 13116 0.11% 114 13636 0.12% 115 14211 0.12% 116 15023 0.13% 117 15397 0.13% 118 16188 0.14% 119 16683 0.14% 120 17452 0.15% 121 18061 0.15% 122 18675 0.16% 123 19079 0.16% 124 19722 0.17% 125 19982 0.17% 126 20903 0.18% 127 21550 0.18% 128 22167 0.19% 129 22563 0.19% 130 23537 0.20% 131 23397 0.20% 132 24426 0.21% 133 25526 0.22% 134 25935 0.22% 135 26343 0.23% 136 26915 0.23% 137 27530 0.24% 138 28188 0.24% 139 29965 0.26% 140 30039 0.26% 141 30921 0.27% 142 31674 0.27% 143 31743 0.27% 144 33368 0.29% 145 33580 0.29% 146 34663 0.30% 147 34355 0.29% 148 35621 0.31% 149 36028 0.31% 150 37440 0.32% 151 10500687 90.10% 11653925 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=24 prefix-density=0.65 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=14.36 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=2.6 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=26 prefix-density=0.81 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.18 sequence-density-rank=23 fanout-score=10.38 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=4.8 sequence=GTGCCAAGGTCT SRR12690167 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:27:10 Started mapping on | Feb 10 20:27:10 Finished on | Feb 10 20:28:30 Mapping speed, Million of reads per hour | 524.43 Number of input reads | 11653925 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11110503 Uniquely mapped reads % | 95.34% Average mapped length | 296.28 Number of splices: Total | 11507358 Number of splices: Annotated (sjdb) | 11249451 Number of splices: GT/AG | 11271653 Number of splices: GC/AG | 182196 Number of splices: AT/AC | 6662 Number of splices: Non-canonical | 46847 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275145 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 23751 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.00% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 268277 268277 268277 N_multimapping 275145 275145 275145 N_noFeature 375258 10952979 412593 N_ambiguous 201422 496 81006 UnstrandedReadsAssigned:10533823 PositiveStrandReadsAssigned:157028 NegativeStrandReadsAssigned:10616904 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690167 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690167-trimmed-pair1.fastq SRR12690167-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,653,925 reads, 10,558,519 reads pseudoaligned [quant] estimated average fragment length: 253.288 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 989 rounds 52401 SRR12690167.ke.tsv 34699 SRR12690167.se.tsv 87100 total ==> SRR12690167.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.71 384 16.5572 Potri.005G024800.1.v4.1 1035 782.712 230 22.3719 Potri.004G059700.1.v4.1 961 708.848 1 0.107405 Potri.007G009000.2.v4.1 1416 1163.71 0 0 Potri.003G141000.2.v4.1 2943 2690.71 564.546 15.9738 Potri.016G087400.1.v4.1 270 81.393 492.624 460.793 Potri.015G069301.1.v4.1 564 324.368 0 0 Potri.010G195200.1.v4.1 1773 1520.71 12 0.600774 Potri.012G127500.1.v4.1 977 724.772 45 4.72702 ==> SRR12690167.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 75 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 106 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12690167 completed mapping pipeline successfully