Starting /dee2/code/volunteer_pipeline.sh SRR12690168 current disk space = 3056068710400 free memory = 1166973996 SRR12690168 SRAfilesize 95689f771f1fd941042cefe30a3ce45a SRR12690168.sra SRR12690168.sra file validated SRR12690168 is paired end SRR12690168 is conventional basespace SRR12690168 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690168_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6195 37.0 37.0 37.0 37.0 37.0 2 36.41025 37.0 37.0 37.0 37.0 37.0 3 36.594 37.0 37.0 37.0 37.0 37.0 4 36.626 37.0 37.0 37.0 37.0 37.0 5 36.6635 37.0 37.0 37.0 37.0 37.0 6 36.602 37.0 37.0 37.0 37.0 37.0 7 36.5435 37.0 37.0 37.0 37.0 37.0 8 36.641 37.0 37.0 37.0 37.0 37.0 9 36.6625 37.0 37.0 37.0 37.0 37.0 10-14 36.58630000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5732 37.0 37.0 37.0 37.0 37.0 20-24 36.6233 37.0 37.0 37.0 37.0 37.0 25-29 36.552499999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.517700000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.534800000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4971 37.0 37.0 37.0 37.0 37.0 45-49 36.4456 37.0 37.0 37.0 37.0 37.0 50-54 36.4344 37.0 37.0 37.0 37.0 37.0 55-59 36.355 37.0 37.0 37.0 37.0 37.0 60-64 36.337599999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.2872 37.0 37.0 37.0 37.0 37.0 70-74 36.35359999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3443 37.0 37.0 37.0 37.0 37.0 80-84 36.2759 37.0 37.0 37.0 37.0 37.0 85-89 36.2962 37.0 37.0 37.0 37.0 37.0 90-94 36.2804 37.0 37.0 37.0 37.0 37.0 95-99 36.1827 37.0 37.0 37.0 37.0 37.0 100-104 36.1502 37.0 37.0 37.0 37.0 37.0 105-109 36.205200000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1471 37.0 37.0 37.0 37.0 37.0 115-119 36.1023 37.0 37.0 37.0 37.0 37.0 120-124 35.9813 37.0 37.0 37.0 37.0 37.0 125-129 36.0281 37.0 37.0 37.0 37.0 37.0 130-134 35.9334 37.0 37.0 37.0 37.0 37.0 135-139 35.9452 37.0 37.0 37.0 37.0 37.0 140-144 35.619499999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.617399999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.4245 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 3.0 26 4.0 27 3.0 28 8.0 29 17.0 30 22.0 31 36.0 32 51.0 33 82.0 34 120.0 35 312.0 36 3000.0 37 340.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.974999999999994 11.700000000000001 7.1 37.225 2 20.426599749058973 12.72271016311167 35.18193224592221 31.66875784190715 3 17.45 15.9 30.099999999999998 36.55 4 22.400000000000002 24.224999999999998 24.7 28.675 5 23.875 28.999999999999996 24.675 22.45 6 21.875 33.35 23.425 21.349999999999998 7 16.875 26.3 40.949999999999996 15.875 8 19.125 25.7 30.5 24.675 9 16.725 24.5 35.175 23.599999999999998 10-14 19.52 28.99 27.965 23.525 15-19 20.775 27.894999999999996 27.500000000000004 23.830000000000002 20-24 20.985 27.925 27.855 23.235 25-29 20.044999999999998 28.395 27.715 23.845 30-34 19.919999999999998 28.625 27.55 23.905 35-39 20.585 28.21 27.339999999999996 23.865 40-44 20.285 28.82 27.025 23.87 45-49 20.979999999999997 27.61 27.665 23.745 50-54 21.125 27.625 27.794999999999998 23.455000000000002 55-59 20.380000000000003 28.660000000000004 27.195000000000004 23.765 60-64 20.26 27.939999999999998 27.805000000000003 23.995 65-69 21.075 28.139999999999997 27.46 23.325000000000003 70-74 21.235 27.305 27.63 23.830000000000002 75-79 21.37 28.13 26.755000000000003 23.745 80-84 20.985 27.785 27.560000000000002 23.669999999999998 85-89 20.919999999999998 27.98 27.584999999999997 23.515 90-94 20.919999999999998 28.1 26.840000000000003 24.14 95-99 21.575 27.975 26.905 23.544999999999998 100-104 21.645 27.555000000000003 27.02 23.78 105-109 21.315 27.55 27.155 23.98 110-114 21.990000000000002 27.939999999999998 27.034999999999997 23.035 115-119 21.94 28.185 26.810000000000002 23.064999999999998 120-124 21.54 28.15 27.115000000000002 23.195 125-129 21.790000000000003 28.265 26.669999999999998 23.275000000000002 130-134 21.634999999999998 27.725 26.525 24.115000000000002 135-139 21.709999999999997 27.794999999999998 26.655 23.84 140-144 21.7 27.860000000000003 26.640000000000004 23.799999999999997 145-149 21.88 27.16 26.8 24.16 150-151 21.0125 27.975 26.375 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.5 25 2.0 26 3.0 27 3.5 28 6.0 29 8.0 30 12.0 31 21.5 32 26.0 33 31.5 34 47.5 35 70.0 36 81.5 37 102.0 38 125.5 39 142.5 40 166.0 41 194.5 42 215.0 43 237.0 44 262.5 45 251.0 46 259.5 47 261.0 48 230.5 49 225.0 50 208.0 51 176.5 52 143.5 53 104.0 54 80.0 55 75.0 56 65.5 57 49.0 58 31.0 59 19.5 60 16.5 61 9.5 62 4.0 63 3.5 64 3.5 65 6.0 66 5.0 67 2.5 68 3.0 69 2.0 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.95 #Duplication Level Percentage of deduplicated Percentage of total 1 91.14898295766905 82.89999999999999 2 7.9989004947773505 14.549999999999999 3 0.6871907641561297 1.875 4 0.08246289169873557 0.3 5 0.08246289169873557 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGTTACCTCACCGAGTGGCCCGCCAGCAATTCTGTAACCCTCAACGG 5 0.125 No Hit GCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTA 5 0.125 No Hit CGGGTAATTGAAATGGGTTGTCTTTCGTTGACCCTGGGGATTCAGCTCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.25 0.0 0.0 0.0 0.0 3 0.25 0.0 0.0 0.0 0.0 4 0.25 0.0 0.0 0.0 0.0 5 0.25 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10-11 0.25 0.0 0.0 0.0 0.0 12-13 0.25 0.0 0.0 0.0 0.0 14-15 0.25 0.0 0.0 0.0 0.0 16-17 0.25 0.0 0.0 0.0 0.0 18-19 0.25 0.0 0.0 0.0 0.0 20-21 0.25 0.0 0.0 0.0 0.0 22-23 0.25 0.0 0.0 0.0 0.0 24-25 0.25 0.0 0.0 0.0 0.0 26-27 0.25 0.0 0.0 0.0 0.0 28-29 0.25 0.0 0.0 0.0 0.0 30-31 0.25 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.25 0.0 0.0 0.0 0.0 42-43 0.25 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.25 0.0 0.0 0.0 0.0 48-49 0.25 0.0 0.0 0.0 0.0 50-51 0.25 0.0 0.0 0.0 0.0 52-53 0.25 0.0 0.0 0.0 0.0 54-55 0.25 0.0 0.0 0.0 0.0 56-57 0.25 0.0 0.0 0.0 0.0 58-59 0.25 0.0 0.0 0.0 0.0 60-61 0.25 0.0 0.0 0.0 0.0 62-63 0.25 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.3 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.3875 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.5375000000000001 0.0 0.0 0.0 0.0 82-83 0.6 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 0.9874999999999999 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.5499999999999998 0.0 0.0 0.0 0.0 98-99 1.825 0.0 0.0 0.0 0.0 100-101 2.05 0.0 0.0 0.0 0.0 102-103 2.2125 0.0 0.0 0.0 0.0 104-105 2.425 0.0 0.0 0.0 0.0 106-107 2.7750000000000004 0.0 0.0 0.0 0.0 108-109 3.0875 0.0 0.0 0.0 0.0 110-111 3.5374999999999996 0.0 0.0 0.0 0.0 112-113 3.9125 0.0 0.0 0.0 0.0 114-115 4.25 0.0 0.0 0.0 0.0 116-117 4.800000000000001 0.0 0.0 0.0 0.0 118-119 5.3 0.0 0.0 0.0 0.0 120-121 6.012499999999999 0.0 0.0 0.0 0.0 122-123 6.4625 0.0 0.0 0.0 0.0 124-125 6.775 0.0 0.0 0.0 0.0 126-127 7.300000000000001 0.0 0.0 0.0 0.0 128-129 8.0125 0.0 0.0 0.0 0.0 130-131 8.712499999999999 0.0 0.0 0.0 0.0 132-133 9.3 0.0 0.0 0.0 0.0 134-135 10.0375 0.0 0.0 0.0 0.0 136-137 10.5 0.0 0.0 0.0 0.0 138-139 10.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATGAT 10 0.006830828 145.0 1 >>END_MODULE SRR12690168 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690168_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.369 37.0 37.0 37.0 37.0 37.0 2 36.072 37.0 37.0 37.0 37.0 37.0 3 36.0765 37.0 37.0 37.0 37.0 37.0 4 36.242 37.0 37.0 37.0 37.0 37.0 5 36.339 37.0 37.0 37.0 37.0 37.0 6 36.337 37.0 37.0 37.0 37.0 37.0 7 36.3045 37.0 37.0 37.0 37.0 37.0 8 36.3825 37.0 37.0 37.0 37.0 37.0 9 36.3995 37.0 37.0 37.0 37.0 37.0 10-14 36.314499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.294799999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.210300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.152100000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.192099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.100500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.084500000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.0106 37.0 37.0 37.0 37.0 37.0 50-54 35.97699999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.9784 37.0 37.0 37.0 37.0 37.0 60-64 35.9182 37.0 37.0 37.0 37.0 37.0 65-69 35.9342 37.0 37.0 37.0 37.0 37.0 70-74 35.894600000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.8816 37.0 37.0 37.0 37.0 37.0 80-84 35.858999999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.9134 37.0 37.0 37.0 37.0 37.0 90-94 35.8066 37.0 37.0 37.0 37.0 37.0 95-99 35.817699999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.845 37.0 37.0 37.0 37.0 37.0 105-109 35.8455 37.0 37.0 37.0 37.0 37.0 110-114 35.761900000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.715199999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.595800000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.511199999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4268 37.0 37.0 37.0 37.0 37.0 135-139 35.365300000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.2613 37.0 37.0 37.0 32.2 37.0 145-149 35.0514 37.0 37.0 37.0 27.4 37.0 150-151 34.6895 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 2.0 15 1.0 16 2.0 17 1.0 18 4.0 19 1.0 20 0.0 21 0.0 22 9.0 23 7.0 24 7.0 25 6.0 26 9.0 27 7.0 28 13.0 29 20.0 30 32.0 31 40.0 32 68.0 33 105.0 34 222.0 35 554.0 36 2597.0 37 290.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.075 25.15 9.700000000000001 25.074999999999996 2 27.950000000000003 27.375 28.525 16.150000000000002 3 20.200000000000003 28.725 31.674999999999997 19.400000000000002 4 22.875 33.225 23.849999999999998 20.05 5 23.875 38.125 20.5 17.5 6 21.7 40.050000000000004 20.95 17.299999999999997 7 20.1 22.650000000000002 37.9 19.35 8 22.025 25.624999999999996 26.125 26.224999999999998 9 21.099999999999998 25.25 29.025000000000002 24.625 10-14 23.315 29.25 25.840000000000003 21.595 15-19 23.095 28.560000000000002 26.924999999999997 21.42 20-24 22.35 29.37 26.87 21.41 25-29 22.95 28.754999999999995 27.055 21.240000000000002 30-34 22.24 27.76 28.04 21.959999999999997 35-39 22.765 27.905 27.71 21.62 40-44 22.785 28.025 27.675 21.515 45-49 22.84 27.355 28.29 21.515 50-54 23.45 26.86 28.084999999999997 21.605 55-59 23.25 27.675 27.675 21.4 60-64 22.314999999999998 27.82 28.275 21.59 65-69 23.064999999999998 27.439999999999998 27.800000000000004 21.695 70-74 22.900000000000002 27.57 27.62 21.91 75-79 22.605 27.515 27.345000000000002 22.535 80-84 22.900000000000002 27.22 28.01 21.87 85-89 23.025000000000002 27.855 27.084999999999997 22.035 90-94 23.11 28.13 27.015 21.745 95-99 23.05 28.01 26.93 22.009999999999998 100-104 24.45 27.51 27.060000000000002 20.979999999999997 105-109 24.169999999999998 27.82 26.865 21.145 110-114 24.135 27.66 27.150000000000002 21.055 115-119 24.325 28.04 26.07 21.565 120-124 24.245 27.805000000000003 27.295 20.655 125-129 25.19 27.445000000000004 26.919999999999998 20.445 130-134 25.485000000000003 27.584999999999997 26.39 20.54 135-139 25.945 27.48 26.314999999999998 20.26 140-144 26.22 27.52 25.94 20.32 145-149 26.450000000000003 27.215 26.22 20.115 150-151 26.8625 27.425 25.974999999999998 19.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 2.0 18 2.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 2.5 26 5.5 27 6.5 28 5.0 29 5.0 30 10.5 31 16.5 32 21.0 33 32.0 34 39.5 35 53.5 36 89.5 37 112.5 38 117.5 39 143.5 40 200.0 41 233.5 42 241.0 43 263.0 44 271.0 45 283.5 46 269.0 47 232.5 48 220.0 49 204.0 50 173.5 51 144.0 52 124.0 53 107.0 54 95.0 55 73.5 56 55.0 57 34.5 58 19.0 59 21.0 60 18.5 61 10.5 62 6.5 63 5.0 64 4.5 65 3.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.96435479414204 82.3 2 7.90273556231003 14.299999999999999 3 0.911854103343465 2.475 4 0.11052777010223819 0.4 5 0.08289582757667864 0.375 6 0.027631942525559547 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GCATCCTATTAAACATTTCATTGGTTATAATTGAACATCCTTTCTTCCTT 5 0.125 No Hit GCCTTGCTGTAGCTTGTGGTATCCAAAACAAGTACGTAAAGCTTTCAGGA 5 0.125 No Hit AATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.225 0.0 0.0 0.0 0.0 2 0.225 0.0 0.0 0.0 0.0 3 0.225 0.0 0.0 0.0 0.0 4 0.225 0.0 0.0 0.0 0.0 5 0.225 0.0 0.0 0.0 0.0 6 0.225 0.0 0.0 0.0 0.0 7 0.225 0.0 0.0 0.0 0.0 8 0.225 0.0 0.0 0.0 0.0 9 0.225 0.0 0.0 0.0 0.0 10-11 0.225 0.0 0.0 0.0 0.0 12-13 0.225 0.0 0.0 0.0 0.0 14-15 0.225 0.0 0.0 0.0 0.0 16-17 0.225 0.0 0.0 0.0 0.0 18-19 0.225 0.0 0.0 0.0 0.0 20-21 0.225 0.0 0.0 0.0 0.0 22-23 0.225 0.0 0.0 0.0 0.0 24-25 0.225 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.225 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.225 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.45 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.8374999999999999 0.0 0.0 0.0 0.0 88-89 0.9625 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.525 0.0 0.0 0.0 0.0 98-99 1.8 0.0 0.0 0.0 0.0 100-101 2.0250000000000004 0.0 0.0 0.0 0.0 102-103 2.1875 0.0 0.0 0.0 0.0 104-105 2.4 0.0 0.0 0.0 0.0 106-107 2.75 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.5374999999999996 0.0 0.0 0.0 0.0 112-113 3.9125 0.0 0.0 0.0 0.0 114-115 4.25 0.0 0.0 0.0 0.0 116-117 4.800000000000001 0.0 0.0 0.0 0.0 118-119 5.2625 0.0 0.0 0.0 0.0 120-121 5.925 0.0 0.0 0.0 0.0 122-123 6.3875 0.0 0.0 0.0 0.0 124-125 6.675 0.0 0.0 0.0 0.0 126-127 7.199999999999999 0.0 0.0 0.0 0.0 128-129 7.9125000000000005 0.0 0.0 0.0 0.0 130-131 8.6125 0.0 0.0 0.0 0.0 132-133 9.2 0.0 0.0 0.0 0.0 134-135 9.95 0.0 0.0 0.0 0.0 136-137 10.425 0.0 0.0 0.0 0.0 138-139 10.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTTTG 10 0.006830828 145.0 6 >>END_MODULE Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116513 spots for SRR12690168.sra Written 1116513 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra Read 1116504 spots for SRR12690168.sra Written 1116504 spots for SRR12690168.sra SRR ids: ['SRR12690168.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3v9a5_t1 SRR12690168.sra spots: 22330089 blocks: [[1, 1116504], [1116505, 2233008], [2233009, 3349512], [3349513, 4466016], [4466017, 5582520], [5582521, 6699024], [6699025, 7815528], [7815529, 8932032], [8932033, 10048536], [10048537, 11165040], [11165041, 12281544], [12281545, 13398048], [13398049, 14514552], [14514553, 15631056], [15631057, 16747560], [16747561, 17864064], [17864065, 18980568], [18980569, 20097072], [20097073, 21213576], [21213577, 22330089]] SRR12690168 file size 7567040 SRR12690168 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690168 SRR12690168_1.fastq SRR12690168_2.fastq Input file: SRR12690168_1.fastq Paired file: SRR12690168_2.fastq trimmed: SRR12690168-trimmed-pair1.fastq, SRR12690168-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:31:40 2025 >> started Mon Feb 10 20:32:13 2025 >> done (32.647s) 22330089 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 53932 ( 0.24%) empty read pairs filtered out after trimming by size control 22276077 (99.76%) read pairs available; of these: 3134905 (14.07%) trimmed read pairs available after processing 19141172 (85.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 13 0.00% 20 3 0.00% 21 19 0.00% 22 23 0.00% 23 17 0.00% 24 22 0.00% 25 31 0.00% 26 28 0.00% 27 35 0.00% 28 20 0.00% 29 38 0.00% 30 30 0.00% 31 39 0.00% 32 26 0.00% 33 45 0.00% 34 41 0.00% 35 43 0.00% 36 50 0.00% 37 53 0.00% 38 50 0.00% 39 57 0.00% 40 59 0.00% 41 66 0.00% 42 81 0.00% 43 68 0.00% 44 52 0.00% 45 81 0.00% 46 101 0.00% 47 103 0.00% 48 104 0.00% 49 141 0.00% 50 179 0.00% 51 188 0.00% 52 198 0.00% 53 239 0.00% 54 253 0.00% 55 237 0.00% 56 301 0.00% 57 340 0.00% 58 417 0.00% 59 488 0.00% 60 615 0.00% 61 625 0.00% 62 711 0.00% 63 811 0.00% 64 868 0.00% 65 958 0.00% 66 1070 0.00% 67 1167 0.01% 68 1282 0.01% 69 1500 0.01% 70 1821 0.01% 71 2061 0.01% 72 2260 0.01% 73 2459 0.01% 74 2919 0.01% 75 3162 0.01% 76 3587 0.02% 77 4037 0.02% 78 4538 0.02% 79 4937 0.02% 80 5285 0.02% 81 5848 0.03% 82 6712 0.03% 83 7527 0.03% 84 8169 0.04% 85 9145 0.04% 86 9469 0.04% 87 10445 0.05% 88 11590 0.05% 89 12146 0.05% 90 13016 0.06% 91 14187 0.06% 92 15027 0.07% 93 16487 0.07% 94 17761 0.08% 95 18922 0.08% 96 19867 0.09% 97 21269 0.10% 98 22088 0.10% 99 23164 0.10% 100 24460 0.11% 101 25349 0.11% 102 26903 0.12% 103 28143 0.13% 104 29527 0.13% 105 30972 0.14% 106 31991 0.14% 107 33337 0.15% 108 34022 0.15% 109 35992 0.16% 110 35971 0.16% 111 37514 0.17% 112 39480 0.18% 113 40420 0.18% 114 41765 0.19% 115 43338 0.19% 116 44909 0.20% 117 45933 0.21% 118 47546 0.21% 119 48006 0.22% 120 49572 0.22% 121 50899 0.23% 122 52272 0.23% 123 53928 0.24% 124 55593 0.25% 125 56022 0.25% 126 58031 0.26% 127 59387 0.27% 128 60221 0.27% 129 61446 0.28% 130 62339 0.28% 131 63281 0.28% 132 64735 0.29% 133 66208 0.30% 134 66650 0.30% 135 67431 0.30% 136 69126 0.31% 137 69973 0.31% 138 70976 0.32% 139 73279 0.33% 140 72934 0.33% 141 74442 0.33% 142 76327 0.34% 143 76528 0.34% 144 78324 0.35% 145 79586 0.36% 146 79507 0.36% 147 80058 0.36% 148 81818 0.37% 149 81697 0.37% 150 82843 0.37% 151 19141172 85.93% 22276077 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=0.75 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=106.61 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=2.0 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=23 prefix-density=1.04 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=24 fanout-score=27.20 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=11.5 sequence=AAAGAAAAGAAAA SRR12690168 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:32:54 Started mapping on | Feb 10 20:32:55 Finished on | Feb 10 20:35:10 Mapping speed, Million of reads per hour | 594.03 Number of input reads | 22276077 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21070471 Uniquely mapped reads % | 94.59% Average mapped length | 293.72 Number of splices: Total | 20853722 Number of splices: Annotated (sjdb) | 20428475 Number of splices: GT/AG | 20420350 Number of splices: GC/AG | 364516 Number of splices: AT/AC | 14437 Number of splices: Non-canonical | 54419 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 563789 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 107745 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.24% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 641817 641817 641817 N_multimapping 563789 563789 563789 N_noFeature 646121 20844149 716972 N_ambiguous 283942 1009 127849 UnstrandedReadsAssigned:20140408 PositiveStrandReadsAssigned:225313 NegativeStrandReadsAssigned:20225650 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690168 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690168-trimmed-pair1.fastq SRR12690168-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,276,077 reads, 20,395,646 reads pseudoaligned [quant] estimated average fragment length: 242.425 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR12690168.ke.tsv 34699 SRR12690168.se.tsv 87100 total ==> SRR12690168.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.57 574 15.6518 Potri.005G024800.1.v4.1 1035 793.575 194 11.8427 Potri.004G059700.1.v4.1 961 719.71 34 2.28854 Potri.007G009000.2.v4.1 1416 1174.57 0 0 Potri.003G141000.2.v4.1 2943 2701.57 840.337 15.0686 Potri.016G087400.1.v4.1 270 89.7408 1112 600.278 Potri.015G069301.1.v4.1 564 334.043 0 0 Potri.010G195200.1.v4.1 1773 1531.57 3 0.0948899 Potri.012G127500.1.v4.1 977 735.63 494 32.5315 ==> SRR12690168.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 195 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 309 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR12690168 completed mapping pipeline successfully