Starting /dee2/code/volunteer_pipeline.sh SRR12690169 current disk space = 3056062402560 free memory = 1158014852 SRR12690169 SRAfilesize fbaeace9610086ae9f352266bee5d2c9 SRR12690169.sra SRR12690169.sra file validated SRR12690169 is paired end SRR12690169 is conventional basespace SRR12690169 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690169_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.569 37.0 37.0 37.0 37.0 37.0 2 36.311 37.0 37.0 37.0 37.0 37.0 3 36.6395 37.0 37.0 37.0 37.0 37.0 4 36.5725 37.0 37.0 37.0 37.0 37.0 5 36.6105 37.0 37.0 37.0 37.0 37.0 6 36.627 37.0 37.0 37.0 37.0 37.0 7 36.4845 37.0 37.0 37.0 37.0 37.0 8 36.628 37.0 37.0 37.0 37.0 37.0 9 36.581 37.0 37.0 37.0 37.0 37.0 10-14 36.581900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.544799999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5647 37.0 37.0 37.0 37.0 37.0 25-29 36.521 37.0 37.0 37.0 37.0 37.0 30-34 36.499900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.478500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4473 37.0 37.0 37.0 37.0 37.0 45-49 36.4114 37.0 37.0 37.0 37.0 37.0 50-54 36.424400000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.394600000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.374700000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.30820000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3743 37.0 37.0 37.0 37.0 37.0 75-79 36.3275 37.0 37.0 37.0 37.0 37.0 80-84 36.2329 37.0 37.0 37.0 37.0 37.0 85-89 36.250800000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.266299999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.21849999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.206900000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1266 37.0 37.0 37.0 37.0 37.0 110-114 36.092000000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.1404 37.0 37.0 37.0 37.0 37.0 120-124 36.0503 37.0 37.0 37.0 37.0 37.0 125-129 35.9337 37.0 37.0 37.0 37.0 37.0 130-134 35.9615 37.0 37.0 37.0 37.0 37.0 135-139 35.9995 37.0 37.0 37.0 37.0 37.0 140-144 35.7539 37.0 37.0 37.0 37.0 37.0 145-149 35.7141 37.0 37.0 37.0 37.0 37.0 150-151 35.56725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 0.0 24 1.0 25 1.0 26 0.0 27 5.0 28 14.0 29 17.0 30 31.0 31 36.0 32 36.0 33 73.0 34 95.0 35 359.0 36 2976.0 37 352.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.074999999999996 12.6 6.175 36.15 2 20.230923694779115 12.449799196787147 36.77208835341366 30.547188755020084 3 16.075 16.725 28.625 38.574999999999996 4 20.175 23.95 25.75 30.125 5 22.975 30.65 23.849999999999998 22.525000000000002 6 21.325 34.775 22.35 21.55 7 15.15 27.55 39.574999999999996 17.724999999999998 8 17.625 26.1 31.924999999999997 24.349999999999998 9 16.975 23.549999999999997 35.775 23.7 10-14 20.135 29.270000000000003 26.985 23.61 15-19 20.24 28.07 27.639999999999997 24.05 20-24 19.470000000000002 28.315 28.07 24.145 25-29 19.945 28.854999999999997 27.555000000000003 23.645 30-34 19.85 28.325 28.105000000000004 23.72 35-39 20.04 27.425 28.82 23.715 40-44 20.32 27.51 28.599999999999998 23.57 45-49 20.345 28.02 28.03 23.605 50-54 20.75 27.985 27.544999999999998 23.72 55-59 20.335 28.299999999999997 27.355 24.01 60-64 20.11 27.925 27.839999999999996 24.125 65-69 19.935 28.410000000000004 28.155 23.5 70-74 20.064999999999998 28.294999999999998 27.694999999999997 23.945 75-79 20.235 28.815 27.02 23.93 80-84 20.455000000000002 28.860000000000003 26.855 23.830000000000002 85-89 20.455000000000002 28.694999999999997 27.384999999999998 23.465 90-94 20.22 27.66 27.675 24.445 95-99 20.07 27.975 28.084999999999997 23.87 100-104 20.86 28.29 27.284999999999997 23.565 105-109 20.87 28.04 27.265 23.825 110-114 20.405 28.32 28.345 22.93 115-119 21.15 27.68 27.474999999999998 23.695 120-124 21.26 27.450000000000003 27.47 23.82 125-129 20.965 28.73 26.939999999999998 23.365 130-134 21.285 28.360000000000003 27.265 23.09 135-139 21.065 27.73 27.205000000000002 24.0 140-144 20.955 28.32 27.005000000000003 23.72 145-149 21.27 28.035 27.02 23.674999999999997 150-151 21.375 27.3125 26.6 24.712500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.5 25 3.0 26 4.0 27 6.5 28 12.5 29 18.0 30 18.5 31 24.0 32 35.5 33 40.0 34 55.0 35 72.5 36 86.0 37 92.5 38 119.5 39 152.5 40 160.0 41 192.5 42 223.5 43 247.0 44 274.0 45 264.0 46 250.5 47 246.0 48 227.5 49 227.0 50 203.0 51 171.5 52 138.0 53 102.5 54 86.0 55 62.0 56 48.0 57 35.5 58 26.5 59 24.0 60 17.0 61 8.0 62 5.5 63 4.0 64 2.5 65 2.0 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 91.2290349188892 82.95 2 7.69865273577124 14.000000000000002 3 0.9348364036293648 2.55 4 0.13747594171020072 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.1749999999999998 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.675 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.325 0.0 0.0 0.0 0.0 122-123 4.6375 0.0 0.0 0.0 0.0 124-125 5.0875 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 5.8875 0.0 0.0 0.0 0.0 130-131 6.275 0.0 0.0 0.0 0.0 132-133 6.8375 0.0 0.0 0.0 0.0 134-135 7.1625 0.0 0.0 0.0 0.0 136-137 7.637499999999999 0.0 0.0 0.0 0.0 138-139 8.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGATAC 10 0.006830828 145.0 4 >>END_MODULE SRR12690169 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690169_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0555 37.0 37.0 37.0 37.0 37.0 2 35.8605 37.0 37.0 37.0 37.0 37.0 3 35.9565 37.0 37.0 37.0 37.0 37.0 4 35.9445 37.0 37.0 37.0 37.0 37.0 5 36.2185 37.0 37.0 37.0 37.0 37.0 6 35.9835 37.0 37.0 37.0 37.0 37.0 7 36.071 37.0 37.0 37.0 37.0 37.0 8 36.226 37.0 37.0 37.0 37.0 37.0 9 36.2185 37.0 37.0 37.0 37.0 37.0 10-14 36.129599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.1352 37.0 37.0 37.0 37.0 37.0 20-24 36.1113 37.0 37.0 37.0 37.0 37.0 25-29 36.0284 37.0 37.0 37.0 37.0 37.0 30-34 36.0649 37.0 37.0 37.0 37.0 37.0 35-39 36.018 37.0 37.0 37.0 37.0 37.0 40-44 35.9807 37.0 37.0 37.0 37.0 37.0 45-49 35.986599999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.930400000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.897800000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.8976 37.0 37.0 37.0 37.0 37.0 65-69 35.824400000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.7236 37.0 37.0 37.0 37.0 37.0 75-79 35.7586 37.0 37.0 37.0 37.0 37.0 80-84 35.77420000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.723400000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.6657 37.0 37.0 37.0 37.0 37.0 95-99 35.6977 37.0 37.0 37.0 37.0 37.0 100-104 35.7078 37.0 37.0 37.0 37.0 37.0 105-109 35.708600000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.5505 37.0 37.0 37.0 37.0 37.0 115-119 35.5536 37.0 37.0 37.0 37.0 37.0 120-124 35.4137 37.0 37.0 37.0 37.0 37.0 125-129 35.396100000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.268 37.0 37.0 37.0 29.8 37.0 135-139 35.1813 37.0 37.0 37.0 29.8 37.0 140-144 35.1115 37.0 37.0 37.0 27.4 37.0 145-149 34.985 37.0 37.0 37.0 25.0 37.0 150-151 34.55575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 2.0 15 3.0 16 0.0 17 0.0 18 0.0 19 3.0 20 3.0 21 3.0 22 0.0 23 7.0 24 5.0 25 8.0 26 10.0 27 14.0 28 24.0 29 29.0 30 34.0 31 54.0 32 73.0 33 132.0 34 238.0 35 617.0 36 2503.0 37 233.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.199999999999996 26.3 7.85 24.65 2 26.950000000000003 29.275000000000002 28.575 15.2 3 21.4 28.325 30.875000000000004 19.400000000000002 4 24.325 34.55 23.35 17.775 5 24.349999999999998 38.375 21.125 16.150000000000002 6 20.625 41.175 21.175 17.025000000000002 7 21.575 24.075 35.525 18.825 8 20.849999999999998 27.500000000000004 27.200000000000003 24.45 9 21.75 25.15 29.875 23.225 10-14 23.294999999999998 29.78 25.929999999999996 20.995 15-19 23.165 28.405 27.24 21.19 20-24 22.54 28.34 27.155 21.965 25-29 22.855 28.42 27.615000000000002 21.11 30-34 21.94 28.110000000000003 27.975 21.975 35-39 23.03 28.360000000000003 27.63 20.979999999999997 40-44 23.24 28.875 26.735 21.15 45-49 22.445 28.725 27.91 20.919999999999998 50-54 22.830000000000002 28.51 27.13 21.529999999999998 55-59 23.45 27.189999999999998 28.084999999999997 21.275 60-64 23.119999999999997 27.88 27.689999999999998 21.310000000000002 65-69 22.775000000000002 27.61 28.28 21.335 70-74 23.810000000000002 28.01 27.334999999999997 20.845 75-79 22.89 28.015 27.61 21.485000000000003 80-84 23.669999999999998 28.199999999999996 27.224999999999998 20.905 85-89 23.400000000000002 28.470000000000002 26.784999999999997 21.345 90-94 24.01 26.99 27.439999999999998 21.560000000000002 95-99 23.645 27.279999999999998 27.715 21.36 100-104 23.549999999999997 28.035 27.68 20.735 105-109 23.66 27.925 27.27 21.145 110-114 23.56 28.610000000000003 27.175 20.655 115-119 24.75 27.939999999999998 27.55 19.759999999999998 120-124 24.490000000000002 27.834999999999997 27.16 20.515 125-129 24.675 28.095 27.060000000000002 20.169999999999998 130-134 24.88 27.500000000000004 27.07 20.549999999999997 135-139 25.285000000000004 28.205000000000002 26.775 19.735 140-144 25.22 27.71 26.435 20.635 145-149 25.2 27.855 26.834999999999997 20.11 150-151 26.1625 27.85 26.375 19.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.5 15 1.0 16 1.5 17 1.5 18 1.5 19 1.0 20 0.5 21 0.5 22 1.5 23 3.0 24 2.5 25 2.5 26 4.0 27 6.0 28 9.5 29 12.5 30 11.0 31 14.5 32 25.5 33 35.5 34 46.0 35 66.0 36 93.5 37 115.0 38 140.0 39 164.5 40 186.0 41 220.0 42 250.0 43 261.5 44 267.5 45 260.0 46 248.0 47 246.0 48 227.0 49 195.5 50 171.5 51 158.5 52 131.0 53 86.5 54 63.0 55 60.0 56 48.5 57 33.0 58 30.0 59 25.5 60 17.0 61 8.5 62 3.0 63 5.5 64 5.0 65 1.0 66 0.5 67 1.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 1.5 91 1.5 92 0.0 93 0.0 94 0.0 95 1.0 96 1.0 97 0.0 98 0.0 99 0.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.34509371554576 82.85 2 7.469680264608599 13.55 3 1.0198456449834619 2.775 4 0.13781697905181917 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027563395810363836 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.1749999999999998 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.025 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 2.9625000000000004 0.0 0.0 0.0 0.0 114-115 3.4000000000000004 0.0 0.0 0.0 0.0 116-117 3.675 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.325 0.0 0.0 0.0 0.0 122-123 4.65 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.5875 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.3 0.0 0.0 0.0 0.0 132-133 6.8625 0.0 0.0 0.0 0.0 134-135 7.1875 0.0 0.0 0.0 0.0 136-137 7.65 0.0 0.0 0.0 0.0 138-139 8.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001776 spots for SRR12690169.sra Written 1001776 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra Read 1001765 spots for SRR12690169.sra Written 1001765 spots for SRR12690169.sra SRR ids: ['SRR12690169.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gw21vtgu SRR12690169.sra spots: 20035311 blocks: [[1, 1001765], [1001766, 2003530], [2003531, 3005295], [3005296, 4007060], [4007061, 5008825], [5008826, 6010590], [6010591, 7012355], [7012356, 8014120], [8014121, 9015885], [9015886, 10017650], [10017651, 11019415], [11019416, 12021180], [12021181, 13022945], [13022946, 14024710], [14024711, 15026475], [15026476, 16028240], [16028241, 17030005], [17030006, 18031770], [18031771, 19033535], [19033536, 20035311]] SRR12690169 file size 6787174 SRR12690169 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690169 SRR12690169_1.fastq SRR12690169_2.fastq Input file: SRR12690169_1.fastq Paired file: SRR12690169_2.fastq trimmed: SRR12690169-trimmed-pair1.fastq, SRR12690169-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:30:52 2025 >> started Mon Feb 10 20:31:14 2025 >> done (22.240s) 20035311 read pairs processed; of these: 52 ( 0.00%) short read pairs filtered out after trimming by size control 3966 ( 0.02%) empty read pairs filtered out after trimming by size control 20031293 (99.98%) read pairs available; of these: 2462886 (12.30%) trimmed read pairs available after processing 17568407 (87.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 7 0.00% 21 19 0.00% 22 14 0.00% 23 14 0.00% 24 25 0.00% 25 16 0.00% 26 26 0.00% 27 28 0.00% 28 38 0.00% 29 35 0.00% 30 33 0.00% 31 35 0.00% 32 28 0.00% 33 41 0.00% 34 40 0.00% 35 42 0.00% 36 39 0.00% 37 33 0.00% 38 41 0.00% 39 52 0.00% 40 39 0.00% 41 54 0.00% 42 70 0.00% 43 47 0.00% 44 61 0.00% 45 70 0.00% 46 85 0.00% 47 83 0.00% 48 113 0.00% 49 114 0.00% 50 112 0.00% 51 126 0.00% 52 163 0.00% 53 203 0.00% 54 186 0.00% 55 228 0.00% 56 215 0.00% 57 248 0.00% 58 263 0.00% 59 360 0.00% 60 368 0.00% 61 443 0.00% 62 509 0.00% 63 580 0.00% 64 637 0.00% 65 694 0.00% 66 768 0.00% 67 871 0.00% 68 995 0.00% 69 1181 0.01% 70 1390 0.01% 71 1569 0.01% 72 1735 0.01% 73 2024 0.01% 74 2249 0.01% 75 2456 0.01% 76 2710 0.01% 77 2935 0.01% 78 3210 0.02% 79 3802 0.02% 80 4138 0.02% 81 4814 0.02% 82 5061 0.03% 83 5708 0.03% 84 6254 0.03% 85 6937 0.03% 86 7531 0.04% 87 7913 0.04% 88 8693 0.04% 89 9136 0.05% 90 9770 0.05% 91 10672 0.05% 92 11231 0.06% 93 12132 0.06% 94 13264 0.07% 95 14259 0.07% 96 14857 0.07% 97 15611 0.08% 98 16361 0.08% 99 16963 0.08% 100 18134 0.09% 101 19013 0.09% 102 20075 0.10% 103 21268 0.11% 104 22518 0.11% 105 22767 0.11% 106 24056 0.12% 107 25030 0.12% 108 25575 0.13% 109 26721 0.13% 110 27115 0.14% 111 28449 0.14% 112 29766 0.15% 113 30617 0.15% 114 31646 0.16% 115 33305 0.17% 116 34038 0.17% 117 35511 0.18% 118 36027 0.18% 119 36827 0.18% 120 38016 0.19% 121 39484 0.20% 122 40261 0.20% 123 41988 0.21% 124 43199 0.22% 125 44194 0.22% 126 45405 0.23% 127 46421 0.23% 128 47010 0.23% 129 47608 0.24% 130 49183 0.25% 131 50037 0.25% 132 50959 0.25% 133 52232 0.26% 134 53290 0.27% 135 54782 0.27% 136 55385 0.28% 137 56409 0.28% 138 56866 0.28% 139 58682 0.29% 140 58694 0.29% 141 61037 0.30% 142 61734 0.31% 143 62531 0.31% 144 64263 0.32% 145 64791 0.32% 146 65581 0.33% 147 65604 0.33% 148 66830 0.33% 149 67465 0.34% 150 68592 0.34% 151 17568407 87.70% 20031293 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=24 prefix-density=0.50 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=23.88 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=3.4 sequence=GTTTCTTGACTGCTTCTTCCTTGGGCACGGTCACCGTGAGAACCCCATTTTCCATAGAAGCCTTGACCTGATCCA criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=30 prefix-density=0.36 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=237.45 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=19.3 sequence=AGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGG SRR12690169 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:32:09 Started mapping on | Feb 10 20:32:09 Finished on | Feb 10 20:34:12 Mapping speed, Million of reads per hour | 586.28 Number of input reads | 20031293 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18780319 Uniquely mapped reads % | 93.75% Average mapped length | 294.70 Number of splices: Total | 17563372 Number of splices: Annotated (sjdb) | 17109971 Number of splices: GT/AG | 17198858 Number of splices: GC/AG | 299774 Number of splices: AT/AC | 15225 Number of splices: Non-canonical | 49515 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 498776 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 104560 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 752198 752198 752198 N_multimapping 498776 498776 498776 N_noFeature 766318 18545719 849812 N_ambiguous 255630 1405 103584 UnstrandedReadsAssigned:17758371 PositiveStrandReadsAssigned:233195 NegativeStrandReadsAssigned:17826923 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690169 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690169-trimmed-pair1.fastq SRR12690169-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,031,293 reads, 17,993,702 reads pseudoaligned [quant] estimated average fragment length: 252.124 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR12690169.ke.tsv 34699 SRR12690169.se.tsv 87100 total ==> SRR12690169.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.88 450 13.4551 Potri.005G024800.1.v4.1 1035 783.876 145 9.77237 Potri.004G059700.1.v4.1 961 710.011 10 0.74407 Potri.007G009000.2.v4.1 1416 1164.88 0 0 Potri.003G141000.2.v4.1 2943 2691.88 659.406 12.9413 Potri.016G087400.1.v4.1 270 87.1419 1190 721.439 Potri.015G069301.1.v4.1 564 327.973 0 0 Potri.010G195200.1.v4.1 1773 1521.88 5 0.173568 Potri.012G127500.1.v4.1 977 725.937 116 8.44186 ==> SRR12690169.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 214 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 228 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR12690169 completed mapping pipeline successfully