Starting /dee2/code/volunteer_pipeline.sh SRR12690170 current disk space = 3056109101056 free memory = 1150398296 SRR12690170 SRAfilesize e05276380ab4708c6fa5ca56ae01176d SRR12690170.sra SRR12690170.sra file validated SRR12690170 is paired end SRR12690170 is conventional basespace SRR12690170 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690170_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.575 37.0 37.0 37.0 37.0 37.0 2 36.32625 37.0 37.0 37.0 37.0 37.0 3 36.5535 37.0 37.0 37.0 37.0 37.0 4 36.5855 37.0 37.0 37.0 37.0 37.0 5 36.681 37.0 37.0 37.0 37.0 37.0 6 36.6465 37.0 37.0 37.0 37.0 37.0 7 36.594 37.0 37.0 37.0 37.0 37.0 8 36.604 37.0 37.0 37.0 37.0 37.0 9 36.5175 37.0 37.0 37.0 37.0 37.0 10-14 36.62349999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5847 37.0 37.0 37.0 37.0 37.0 20-24 36.5714 37.0 37.0 37.0 37.0 37.0 25-29 36.4991 37.0 37.0 37.0 37.0 37.0 30-34 36.533 37.0 37.0 37.0 37.0 37.0 35-39 36.52040000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.5338 37.0 37.0 37.0 37.0 37.0 45-49 36.4701 37.0 37.0 37.0 37.0 37.0 50-54 36.425 37.0 37.0 37.0 37.0 37.0 55-59 36.400600000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.415099999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3605 37.0 37.0 37.0 37.0 37.0 70-74 36.3558 37.0 37.0 37.0 37.0 37.0 75-79 36.331500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.27669999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2663 37.0 37.0 37.0 37.0 37.0 90-94 36.286 37.0 37.0 37.0 37.0 37.0 95-99 36.218900000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.1824 37.0 37.0 37.0 37.0 37.0 105-109 36.1361 37.0 37.0 37.0 37.0 37.0 110-114 36.116 37.0 37.0 37.0 37.0 37.0 115-119 36.048700000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0004 37.0 37.0 37.0 37.0 37.0 125-129 35.9584 37.0 37.0 37.0 37.0 37.0 130-134 35.96489999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.867999999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.6847 37.0 37.0 37.0 37.0 37.0 145-149 35.637899999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.298500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 5.0 27 12.0 28 8.0 29 13.0 30 22.0 31 39.0 32 55.0 33 70.0 34 143.0 35 295.0 36 2940.0 37 396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.45 11.5 6.550000000000001 36.5 2 21.233391827525697 13.111055402356481 35.59789420907495 30.057658561042867 3 16.650000000000002 16.3 30.95 36.1 4 21.925 24.925 24.825 28.325 5 23.400000000000002 31.85 23.724999999999998 21.025 6 21.5 33.275 24.425 20.8 7 16.400000000000002 26.6 39.925 17.075000000000003 8 17.375 25.974999999999998 31.474999999999998 25.174999999999997 9 17.025000000000002 24.8 35.775 22.400000000000002 10-14 20.055 28.71 27.445000000000004 23.79 15-19 20.665 27.815 27.55 23.97 20-24 20.485 28.38 26.97 24.165 25-29 21.135 28.175 27.13 23.56 30-34 20.369999999999997 28.384999999999998 27.565 23.68 35-39 20.24 28.53 27.74 23.49 40-44 20.45 28.499999999999996 27.415 23.635 45-49 20.59 28.43 27.195000000000004 23.785 50-54 20.605 28.33 27.515 23.549999999999997 55-59 20.419999999999998 28.27 28.18 23.13 60-64 20.97 28.08 27.305 23.645 65-69 21.08 27.79 27.529999999999998 23.599999999999998 70-74 20.695 28.59 27.255000000000003 23.46 75-79 20.96 28.34 27.27 23.43 80-84 20.674999999999997 28.849999999999998 27.08 23.395 85-89 20.785 28.660000000000004 27.250000000000004 23.305 90-94 20.605 28.794999999999998 26.919999999999998 23.68 95-99 20.669999999999998 28.18 27.139999999999997 24.01 100-104 20.79 28.549999999999997 26.985 23.674999999999997 105-109 20.75 28.375 27.224999999999998 23.65 110-114 21.165 28.449999999999996 26.86 23.525 115-119 21.055 27.785 27.67 23.49 120-124 20.255000000000003 28.63 27.310000000000002 23.805 125-129 21.145 27.49 27.405 23.96 130-134 21.279999999999998 28.249999999999996 26.915 23.555 135-139 22.13 27.755000000000003 26.455000000000002 23.66 140-144 21.82 28.365000000000002 26.279999999999998 23.535 145-149 22.575 28.16 25.855 23.41 150-151 22.2 27.9125 26.474999999999998 23.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 1.0 23 1.5 24 1.5 25 2.0 26 3.0 27 4.0 28 13.0 29 14.0 30 11.0 31 21.0 32 32.0 33 40.5 34 51.5 35 70.0 36 80.0 37 93.5 38 118.5 39 131.0 40 163.5 41 199.5 42 216.5 43 254.5 44 276.5 45 279.0 46 282.0 47 258.0 48 228.0 49 214.5 50 191.5 51 155.0 52 130.0 53 105.0 54 82.5 55 64.0 56 41.0 57 39.0 58 39.0 59 28.0 60 18.0 61 14.5 62 14.5 63 8.0 64 2.5 65 1.0 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.35166031573218 84.82499999999999 2 6.668481219379423 12.25 3 0.7893304300489928 2.175 4 0.1360914534567229 0.5 5 0.05443658138268917 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 5 0.125 No Hit TGTATATCTGCCTAATTACTTACACCAAGTCGACCATTGATTTCTACCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.75 0.0 0.0 0.0 0.0 102-103 1.9874999999999998 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.5374999999999996 0.0 0.0 0.0 0.0 108-109 2.9 0.0 0.0 0.0 0.0 110-111 3.325 0.0 0.0 0.0 0.0 112-113 3.625 0.0 0.0 0.0 0.0 114-115 3.9625000000000004 0.0 0.0 0.0 0.0 116-117 4.2625 0.0 0.0 0.0 0.0 118-119 4.625 0.0 0.0 0.0 0.0 120-121 4.975 0.0 0.0 0.0 0.0 122-123 5.3375 0.0 0.0 0.0 0.0 124-125 5.725 0.0 0.0 0.0 0.0 126-127 6.1125 0.0 0.0 0.0 0.0 128-129 6.612500000000001 0.0 0.0 0.0 0.0 130-131 7.3375 0.0 0.0 0.0 0.0 132-133 8.0625 0.0 0.0 0.0 0.0 134-135 8.75 0.0 0.0 0.0 0.0 136-137 9.45 0.0 0.0 0.0 0.0 138-139 10.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 25 4.977651E-4 29.0 115-119 >>END_MODULE SRR12690170 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690170_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.061 37.0 37.0 37.0 37.0 37.0 2 35.5505 37.0 37.0 37.0 37.0 37.0 3 35.8635 37.0 37.0 37.0 37.0 37.0 4 35.8325 37.0 37.0 37.0 37.0 37.0 5 36.0565 37.0 37.0 37.0 37.0 37.0 6 35.913 37.0 37.0 37.0 37.0 37.0 7 36.0105 37.0 37.0 37.0 37.0 37.0 8 36.2 37.0 37.0 37.0 37.0 37.0 9 36.052 37.0 37.0 37.0 37.0 37.0 10-14 36.091 37.0 37.0 37.0 37.0 37.0 15-19 36.049099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.090500000000006 37.0 37.0 37.0 37.0 37.0 25-29 35.9971 37.0 37.0 37.0 37.0 37.0 30-34 35.8979 37.0 37.0 37.0 37.0 37.0 35-39 35.9326 37.0 37.0 37.0 37.0 37.0 40-44 35.8587 37.0 37.0 37.0 37.0 37.0 45-49 35.892 37.0 37.0 37.0 37.0 37.0 50-54 35.8261 37.0 37.0 37.0 37.0 37.0 55-59 35.824200000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.773399999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.763099999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.70889999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.6599 37.0 37.0 37.0 37.0 37.0 80-84 35.6672 37.0 37.0 37.0 37.0 37.0 85-89 35.723 37.0 37.0 37.0 37.0 37.0 90-94 35.540499999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.6113 37.0 37.0 37.0 37.0 37.0 100-104 35.57869999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.5598 37.0 37.0 37.0 37.0 37.0 110-114 35.4546 37.0 37.0 37.0 37.0 37.0 115-119 35.339999999999996 37.0 37.0 37.0 34.6 37.0 120-124 35.2995 37.0 37.0 37.0 32.2 37.0 125-129 35.232099999999996 37.0 37.0 37.0 27.4 37.0 130-134 35.13 37.0 37.0 37.0 25.0 37.0 135-139 34.9541 37.0 37.0 37.0 27.4 37.0 140-144 34.8086 37.0 37.0 37.0 25.0 37.0 145-149 34.5904 37.0 37.0 37.0 25.0 37.0 150-151 34.02575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 1.0 16 2.0 17 3.0 18 0.0 19 4.0 20 3.0 21 2.0 22 3.0 23 6.0 24 10.0 25 8.0 26 6.0 27 19.0 28 15.0 29 33.0 30 44.0 31 54.0 32 93.0 33 140.0 34 279.0 35 718.0 36 2375.0 37 177.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.225 23.625 8.825 24.325 2 28.65 25.45 29.325000000000003 16.575 3 21.825 27.325 29.7 21.15 4 23.225 34.775 23.3 18.7 5 24.375 37.65 21.375 16.6 6 22.35 38.875 21.7 17.075000000000003 7 20.5 22.15 37.824999999999996 19.525000000000002 8 20.7 26.575 28.15 24.575 9 21.7 24.175 28.625 25.5 10-14 23.375 28.895 26.085 21.645 15-19 22.805 28.13 27.744999999999997 21.32 20-24 23.494999999999997 28.194999999999997 27.339999999999996 20.97 25-29 22.475 28.365000000000002 27.35 21.81 30-34 22.564999999999998 28.310000000000002 28.415000000000003 20.71 35-39 22.814999999999998 27.605 28.225 21.355 40-44 23.21 27.855 27.51 21.425 45-49 23.400000000000002 27.72 27.694999999999997 21.185000000000002 50-54 22.535 27.725 28.705000000000002 21.035 55-59 23.794999999999998 27.315 27.35 21.54 60-64 23.145 28.02 27.779999999999998 21.055 65-69 23.105 26.86 28.53 21.505 70-74 23.555 27.325 27.52 21.6 75-79 22.725 27.889999999999997 27.794999999999998 21.59 80-84 23.085 27.994999999999997 27.115000000000002 21.805 85-89 23.78 28.16 27.134999999999998 20.925 90-94 23.1 27.800000000000004 27.435 21.665 95-99 23.849999999999998 27.32 27.6 21.23 100-104 23.82 27.43 27.3 21.45 105-109 23.515 27.295 27.915 21.275 110-114 24.495 27.47 27.295 20.74 115-119 24.035 27.889999999999997 26.979999999999997 21.095 120-124 24.6 27.075 27.1 21.224999999999998 125-129 24.905 27.644999999999996 27.279999999999998 20.169999999999998 130-134 25.174999999999997 27.705000000000002 26.900000000000002 20.22 135-139 25.345000000000002 27.075 26.745 20.835 140-144 26.075 26.71 26.979999999999997 20.235 145-149 26.305 26.445 26.715 20.535 150-151 27.275 26.85 26.474999999999998 19.400000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 1.0 16 1.5 17 1.5 18 1.0 19 0.5 20 0.5 21 0.5 22 1.5 23 3.5 24 4.5 25 3.0 26 3.5 27 4.5 28 6.5 29 9.0 30 8.5 31 14.5 32 26.5 33 36.0 34 50.0 35 64.0 36 72.5 37 91.5 38 126.5 39 158.5 40 186.0 41 218.0 42 245.5 43 254.0 44 262.0 45 279.0 46 285.0 47 269.5 48 229.5 49 201.5 50 170.5 51 133.5 52 114.5 53 98.5 54 79.0 55 66.0 56 51.5 57 35.0 58 32.0 59 28.5 60 18.5 61 12.5 62 9.5 63 5.5 64 4.0 65 1.5 66 1.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 1.0 97 0.0 98 0.0 99 1.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.925 #Duplication Level Percentage of deduplicated Percentage of total 1 92.73864563502856 85.25 2 6.309491433233615 11.600000000000001 3 0.7342942616263258 2.025 4 0.08158825129181398 0.3 5 0.027196083763937992 0.125 6 0.054392167527875984 0.3 7 0.0 0.0 8 0.054392167527875984 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GTGGAAGCTACCCATGTTTGGATGCACTGAGGCATCTCAAGTGTTGCTTG 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit AGAAGCGACACAAAGGTTGTTCATTTTGCATTTTGGACGTTGAGAAGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.125 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.875 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.5999999999999996 0.0 0.0 0.0 0.0 114-115 3.9375 0.0 0.0 0.0 0.0 116-117 4.2375 0.0 0.0 0.0 0.0 118-119 4.575 0.0 0.0 0.0 0.0 120-121 4.9125 0.0 0.0 0.0 0.0 122-123 5.275 0.0 0.0 0.0 0.0 124-125 5.65 0.0 0.0 0.0 0.0 126-127 6.0375 0.0 0.0 0.0 0.0 128-129 6.55 0.0 0.0 0.0 0.0 130-131 7.2625 0.0 0.0 0.0 0.0 132-133 7.987500000000001 0.0 0.0 0.0 0.0 134-135 8.65 0.0 0.0 0.0 0.0 136-137 9.3625 0.0 0.0 0.0 0.0 138-139 10.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGAAC 10 0.006830828 145.0 9 >>END_MODULE Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080777 spots for SRR12690170.sra Written 1080777 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra Read 1080763 spots for SRR12690170.sra Written 1080763 spots for SRR12690170.sra SRR ids: ['SRR12690170.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f3hf8v8j SRR12690170.sra spots: 21615274 blocks: [[1, 1080763], [1080764, 2161526], [2161527, 3242289], [3242290, 4323052], [4323053, 5403815], [5403816, 6484578], [6484579, 7565341], [7565342, 8646104], [8646105, 9726867], [9726868, 10807630], [10807631, 11888393], [11888394, 12969156], [12969157, 14049919], [14049920, 15130682], [15130683, 16211445], [16211446, 17292208], [17292209, 18372971], [18372972, 19453734], [19453735, 20534497], [20534498, 21615274]] SRR12690170 file size 7324115 SRR12690170 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690170 SRR12690170_1.fastq SRR12690170_2.fastq Input file: SRR12690170_1.fastq Paired file: SRR12690170_2.fastq trimmed: SRR12690170-trimmed-pair1.fastq, SRR12690170-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:43:23 2025 >> started Mon Feb 10 20:43:57 2025 >> done (34.644s) 21615274 read pairs processed; of these: 55 ( 0.00%) short read pairs filtered out after trimming by size control 3042 ( 0.01%) empty read pairs filtered out after trimming by size control 21612177 (99.99%) read pairs available; of these: 3150737 (14.58%) trimmed read pairs available after processing 18461440 (85.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 9 0.00% 21 14 0.00% 22 11 0.00% 23 18 0.00% 24 16 0.00% 25 20 0.00% 26 22 0.00% 27 21 0.00% 28 27 0.00% 29 32 0.00% 30 18 0.00% 31 35 0.00% 32 29 0.00% 33 23 0.00% 34 30 0.00% 35 30 0.00% 36 50 0.00% 37 36 0.00% 38 51 0.00% 39 53 0.00% 40 68 0.00% 41 47 0.00% 42 47 0.00% 43 63 0.00% 44 65 0.00% 45 75 0.00% 46 73 0.00% 47 103 0.00% 48 107 0.00% 49 129 0.00% 50 136 0.00% 51 180 0.00% 52 204 0.00% 53 221 0.00% 54 192 0.00% 55 212 0.00% 56 248 0.00% 57 299 0.00% 58 380 0.00% 59 430 0.00% 60 460 0.00% 61 589 0.00% 62 545 0.00% 63 684 0.00% 64 787 0.00% 65 865 0.00% 66 940 0.00% 67 1058 0.00% 68 1191 0.01% 69 1392 0.01% 70 1601 0.01% 71 1748 0.01% 72 1985 0.01% 73 2385 0.01% 74 2663 0.01% 75 2924 0.01% 76 3293 0.02% 77 3508 0.02% 78 3918 0.02% 79 4489 0.02% 80 4917 0.02% 81 5490 0.03% 82 6295 0.03% 83 6880 0.03% 84 7605 0.04% 85 8588 0.04% 86 8865 0.04% 87 9709 0.04% 88 10706 0.05% 89 11284 0.05% 90 12376 0.06% 91 13279 0.06% 92 14570 0.07% 93 15796 0.07% 94 17044 0.08% 95 18163 0.08% 96 19201 0.09% 97 20204 0.09% 98 21130 0.10% 99 22294 0.10% 100 23898 0.11% 101 24940 0.12% 102 27064 0.13% 103 28164 0.13% 104 29120 0.13% 105 30569 0.14% 106 31854 0.15% 107 32731 0.15% 108 34079 0.16% 109 35650 0.16% 110 35948 0.17% 111 37207 0.17% 112 39500 0.18% 113 40508 0.19% 114 42294 0.20% 115 44117 0.20% 116 44360 0.21% 117 46365 0.21% 118 47718 0.22% 119 47984 0.22% 120 49734 0.23% 121 51400 0.24% 122 52482 0.24% 123 54154 0.25% 124 55786 0.26% 125 56951 0.26% 126 58653 0.27% 127 59894 0.28% 128 60596 0.28% 129 61468 0.28% 130 62755 0.29% 131 63439 0.29% 132 65679 0.30% 133 67833 0.31% 134 68895 0.32% 135 69773 0.32% 136 71078 0.33% 137 71371 0.33% 138 71774 0.33% 139 73679 0.34% 140 73981 0.34% 141 75479 0.35% 142 77613 0.36% 143 78965 0.37% 144 79819 0.37% 145 81566 0.38% 146 82185 0.38% 147 82487 0.38% 148 83767 0.39% 149 83366 0.39% 150 84788 0.39% 151 18461440 85.42% 21612177 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=7 prefix-density=0.83 prefix-fanout=2.4 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=7.20 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=2.9 sequence=GAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTAAACGATGTGCTGACCATGGCGCTGGAGAGGGCTGCTGTGGTGGCCATTCTCTCTG criterion=sequence-density sequence-density=1.27 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=22 prefix-density=1.27 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=54.55 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR12690170 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:44:40 Started mapping on | Feb 10 20:44:40 Finished on | Feb 10 20:46:43 Mapping speed, Million of reads per hour | 632.55 Number of input reads | 21612177 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 20345088 Uniquely mapped reads % | 94.14% Average mapped length | 293.41 Number of splices: Total | 19479992 Number of splices: Annotated (sjdb) | 19118565 Number of splices: GT/AG | 19091788 Number of splices: GC/AG | 325616 Number of splices: AT/AC | 13452 Number of splices: Non-canonical | 49136 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 560256 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 87563 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 706833 706833 706833 N_multimapping 560256 560256 560256 N_noFeature 667371 20155915 733164 N_ambiguous 241716 1020 117595 UnstrandedReadsAssigned:19436001 PositiveStrandReadsAssigned:188153 NegativeStrandReadsAssigned:19494329 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690170 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690170-trimmed-pair1.fastq SRR12690170-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,612,177 reads, 19,676,337 reads pseudoaligned [quant] estimated average fragment length: 233.177 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR12690170.ke.tsv 34699 SRR12690170.se.tsv 87100 total ==> SRR12690170.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.82 448 13.3143 Potri.005G024800.1.v4.1 1035 802.823 151 9.98244 Potri.004G059700.1.v4.1 961 728.901 79 5.75225 Potri.007G009000.2.v4.1 1416 1183.82 0 0 Potri.003G141000.2.v4.1 2943 2710.82 438.164 8.57857 Potri.016G087400.1.v4.1 270 89.477 964 571.801 Potri.015G069301.1.v4.1 564 341.956 0 0 Potri.010G195200.1.v4.1 1773 1540.82 3 0.103335 Potri.012G127500.1.v4.1 977 744.848 2688 191.532 ==> SRR12690170.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 77 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 163 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12690170 completed mapping pipeline successfully