Starting /dee2/code/volunteer_pipeline.sh SRR12690171 current disk space = 3057007267840 free memory = 1577800428 SRR12690171 SRAfilesize b379742797b52271b72be458cd7303b5 SRR12690171.sra SRR12690171.sra file validated SRR12690171 is paired end SRR12690171 is conventional basespace SRR12690171 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690171_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.57 37.0 37.0 37.0 37.0 37.0 2 36.4275 37.0 37.0 37.0 37.0 37.0 3 36.5835 37.0 37.0 37.0 37.0 37.0 4 36.4675 37.0 37.0 37.0 37.0 37.0 5 36.57 37.0 37.0 37.0 37.0 37.0 6 36.592 37.0 37.0 37.0 37.0 37.0 7 36.513 37.0 37.0 37.0 37.0 37.0 8 36.633 37.0 37.0 37.0 37.0 37.0 9 36.665 37.0 37.0 37.0 37.0 37.0 10-14 36.6225 37.0 37.0 37.0 37.0 37.0 15-19 36.6057 37.0 37.0 37.0 37.0 37.0 20-24 36.553999999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.5016 37.0 37.0 37.0 37.0 37.0 30-34 36.5239 37.0 37.0 37.0 37.0 37.0 35-39 36.4769 37.0 37.0 37.0 37.0 37.0 40-44 36.464600000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4591 37.0 37.0 37.0 37.0 37.0 50-54 36.4119 37.0 37.0 37.0 37.0 37.0 55-59 36.392300000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3796 37.0 37.0 37.0 37.0 37.0 65-69 36.32719999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.3215 37.0 37.0 37.0 37.0 37.0 75-79 36.2988 37.0 37.0 37.0 37.0 37.0 80-84 36.2279 37.0 37.0 37.0 37.0 37.0 85-89 36.278200000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.267999999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.2231 37.0 37.0 37.0 37.0 37.0 100-104 36.163599999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1505 37.0 37.0 37.0 37.0 37.0 110-114 36.1183 37.0 37.0 37.0 37.0 37.0 115-119 36.1237 37.0 37.0 37.0 37.0 37.0 120-124 36.031400000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.0623 37.0 37.0 37.0 37.0 37.0 130-134 35.99679999999999 37.0 37.0 37.0 37.0 37.0 135-139 36.0087 37.0 37.0 37.0 37.0 37.0 140-144 35.9012 37.0 37.0 37.0 37.0 37.0 145-149 35.756899999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.552 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 1.0 25 3.0 26 6.0 27 6.0 28 8.0 29 15.0 30 22.0 31 40.0 32 41.0 33 72.0 34 109.0 35 319.0 36 2982.0 37 373.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.8 12.375 6.7250000000000005 40.1 2 19.87981972959439 13.219829744616925 36.955433149724584 29.944917376064094 3 18.5 15.35 27.400000000000002 38.75 4 21.05 24.825 23.849999999999998 30.275000000000002 5 22.725 30.025000000000002 26.450000000000003 20.8 6 21.175 32.85 24.65 21.325 7 15.8 28.499999999999996 37.325 18.375 8 18.375 26.974999999999998 31.55 23.1 9 18.8 22.775000000000002 35.475 22.95 10-14 19.794999999999998 29.73 27.165 23.31 15-19 20.380000000000003 27.944999999999997 27.73 23.945 20-24 20.57 28.050000000000004 27.810000000000002 23.57 25-29 19.8 28.884999999999998 27.200000000000003 24.115000000000002 30-34 20.165 28.349999999999998 27.150000000000002 24.335 35-39 20.345 28.84 27.589999999999996 23.225 40-44 20.165 28.775000000000002 27.015 24.044999999999998 45-49 20.46 28.294999999999998 27.33 23.915 50-54 20.665 27.889999999999997 28.02 23.425 55-59 20.19 29.020000000000003 27.029999999999998 23.76 60-64 21.205 27.794999999999998 27.345000000000002 23.655 65-69 20.555 28.115000000000002 27.839999999999996 23.49 70-74 20.765 28.28 27.229999999999997 23.724999999999998 75-79 19.66 28.305000000000003 28.185 23.849999999999998 80-84 20.74 28.754999999999995 27.16 23.345 85-89 20.745 27.944999999999997 27.41 23.9 90-94 20.865000000000002 28.18 27.145000000000003 23.810000000000002 95-99 21.37 27.839999999999996 27.529999999999998 23.26 100-104 21.0 28.62 27.49 22.89 105-109 20.8 28.355000000000004 27.615000000000002 23.23 110-114 20.86 28.125 27.439999999999998 23.575 115-119 20.845 28.58 27.375 23.200000000000003 120-124 21.404999999999998 27.445000000000004 26.895000000000003 24.255 125-129 20.765 28.560000000000002 26.965 23.71 130-134 21.044999999999998 28.475 27.235 23.244999999999997 135-139 21.33 28.22 26.625 23.825 140-144 21.14 27.805000000000003 27.055 24.0 145-149 21.105 27.775 26.945000000000004 24.175 150-151 20.65 27.224999999999998 28.0875 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 2.5 21 2.0 22 1.0 23 2.0 24 1.5 25 3.5 26 8.5 27 7.0 28 7.5 29 13.5 30 13.0 31 19.0 32 34.5 33 42.0 34 45.5 35 57.0 36 72.5 37 85.5 38 111.5 39 142.5 40 174.0 41 192.0 42 224.0 43 250.5 44 252.5 45 262.5 46 257.0 47 256.5 48 256.0 49 246.5 50 231.5 51 189.5 52 128.5 53 93.0 54 79.5 55 58.5 56 44.5 57 37.0 58 23.0 59 21.5 60 18.0 61 10.5 62 8.5 63 3.0 64 2.5 65 2.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.0866574965612 82.775 2 8.033012379642365 14.6 3 0.7152682255845942 1.95 4 0.11004126547455295 0.4 5 0.027510316368638238 0.125 6 0.027510316368638238 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGCTGTTGCAACCCTAATGTCAATGACACTCCACCACCATTGAAGTTCT 6 0.15 No Hit GCCATTGGTTTGATGGACAATTCTCTGTTCAGTTTACTTGGAGCCCCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.45 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.225 0.0 0.0 0.0 0.0 122-123 3.4000000000000004 0.0 0.0 0.0 0.0 124-125 3.8125 0.0 0.0 0.0 0.0 126-127 4.199999999999999 0.0 0.0 0.0 0.0 128-129 4.55 0.0 0.0 0.0 0.0 130-131 5.175000000000001 0.0 0.0 0.0 0.0 132-133 5.7625 0.0 0.0 0.0 0.0 134-135 6.324999999999999 0.0 0.0 0.0 0.0 136-137 6.875 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGGCA 10 0.006830828 145.0 2 GGTGGGC 10 0.006830828 145.0 1 >>END_MODULE SRR12690171 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690171_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.30325 37.0 37.0 37.0 37.0 37.0 2 35.9885 37.0 37.0 37.0 37.0 37.0 3 36.112 37.0 37.0 37.0 37.0 37.0 4 36.125 37.0 37.0 37.0 37.0 37.0 5 36.2275 37.0 37.0 37.0 37.0 37.0 6 36.105 37.0 37.0 37.0 37.0 37.0 7 36.2545 37.0 37.0 37.0 37.0 37.0 8 36.288 37.0 37.0 37.0 37.0 37.0 9 36.1885 37.0 37.0 37.0 37.0 37.0 10-14 36.22449999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.2219 37.0 37.0 37.0 37.0 37.0 20-24 36.1367 37.0 37.0 37.0 37.0 37.0 25-29 36.10080000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.1155 37.0 37.0 37.0 37.0 37.0 35-39 36.063 37.0 37.0 37.0 37.0 37.0 40-44 36.0284 37.0 37.0 37.0 37.0 37.0 45-49 36.064499999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.9948 37.0 37.0 37.0 37.0 37.0 55-59 35.983 37.0 37.0 37.0 37.0 37.0 60-64 35.971500000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.961400000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.8332 37.0 37.0 37.0 37.0 37.0 75-79 35.8384 37.0 37.0 37.0 37.0 37.0 80-84 35.831 37.0 37.0 37.0 37.0 37.0 85-89 35.8706 37.0 37.0 37.0 37.0 37.0 90-94 35.73760000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.7524 37.0 37.0 37.0 37.0 37.0 100-104 35.78000000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.7797 37.0 37.0 37.0 37.0 37.0 110-114 35.6757 37.0 37.0 37.0 37.0 37.0 115-119 35.6265 37.0 37.0 37.0 37.0 37.0 120-124 35.5437 37.0 37.0 37.0 37.0 37.0 125-129 35.5017 37.0 37.0 37.0 37.0 37.0 130-134 35.471500000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.34179999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.3392 37.0 37.0 37.0 34.6 37.0 145-149 35.1325 37.0 37.0 37.0 29.8 37.0 150-151 34.52525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 3.0 15 2.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 6.0 23 4.0 24 3.0 25 7.0 26 12.0 27 14.0 28 20.0 29 26.0 30 34.0 31 42.0 32 47.0 33 119.0 34 215.0 35 575.0 36 2627.0 37 235.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.45986496624156 24.48112028007002 9.527381845461365 26.531632908227053 2 27.425 27.1 30.375000000000004 15.1 3 20.325 27.474999999999998 31.874999999999996 20.325 4 23.275000000000002 34.150000000000006 23.65 18.925 5 24.75 37.05 22.325 15.875 6 20.9 39.2 22.2 17.7 7 21.275 22.675 36.825 19.225 8 20.549999999999997 26.950000000000003 28.199999999999996 24.3 9 21.575 24.975 29.625 23.825 10-14 23.72 28.744999999999997 26.865 20.669999999999998 15-19 22.905 28.32 27.46 21.315 20-24 23.095 27.985 28.185 20.735 25-29 22.555 28.315 28.34 20.79 30-34 22.685 27.595 28.575 21.145 35-39 22.465 28.21 27.755000000000003 21.57 40-44 23.200000000000003 28.785 27.275 20.74 45-49 22.685 27.73 28.02 21.565 50-54 22.67 28.365000000000002 27.534999999999997 21.43 55-59 23.055 27.655 28.144999999999996 21.145 60-64 22.75 28.09 27.894999999999996 21.265 65-69 23.425 27.91 27.205000000000002 21.46 70-74 23.155 27.365000000000002 27.884999999999998 21.595 75-79 22.830000000000002 27.905 27.650000000000002 21.615000000000002 80-84 23.265 27.905 27.529999999999998 21.3 85-89 23.325000000000003 27.860000000000003 27.305 21.51 90-94 22.96 27.560000000000002 27.805000000000003 21.675 95-99 23.565 27.250000000000004 27.48 21.705 100-104 23.585 27.779999999999998 27.445000000000004 21.19 105-109 23.86 27.500000000000004 28.09 20.549999999999997 110-114 24.085 27.615000000000002 27.96 20.34 115-119 23.974999999999998 27.845 27.1 21.08 120-124 24.265 28.139999999999997 27.33 20.265 125-129 23.830000000000002 28.27 26.619999999999997 21.279999999999998 130-134 24.68 27.47 27.105 20.745 135-139 25.135 27.985 27.089999999999996 19.79 140-144 24.86 28.26 26.14 20.74 145-149 26.064999999999998 27.544999999999998 26.31 20.080000000000002 150-151 25.174999999999997 27.825 27.037499999999998 19.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.5 13 1.5 14 1.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.0 24 1.5 25 3.0 26 6.5 27 6.5 28 8.0 29 12.0 30 14.0 31 15.5 32 23.5 33 30.5 34 42.0 35 63.0 36 74.5 37 98.0 38 130.0 39 158.5 40 194.0 41 215.0 42 252.5 43 281.0 44 270.0 45 272.0 46 271.0 47 252.0 48 235.0 49 207.0 50 174.0 51 152.0 52 123.0 53 99.0 54 76.0 55 55.5 56 49.0 57 35.0 58 22.5 59 16.5 60 13.5 61 11.0 62 5.0 63 3.5 64 2.5 65 2.0 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 91.42150123728348 83.125 2 7.478691229034919 13.600000000000001 3 0.9073412152873247 2.475 4 0.10998075336816059 0.4 5 0.05499037668408029 0.25 6 0.027495188342040146 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGGAACTCGGGTAGAAAGGGGAACAAAAATCAAACAACGAAGAAAGAA 6 0.15 No Hit CTCTCTTCCATTATCTCTAACCCAGATAAAAATGACACCAACAAAAGCAT 5 0.125 No Hit GTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.9749999999999996 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.8375000000000004 0.0 0.0 0.0 0.0 126-127 4.225 0.0 0.0 0.0 0.0 128-129 4.575 0.0 0.0 0.0 0.0 130-131 5.199999999999999 0.0 0.0 0.0 0.0 132-133 5.775 0.0 0.0 0.0 0.0 134-135 6.324999999999999 0.0 0.0 0.0 0.0 136-137 6.875 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726448 spots for SRR12690171.sra Written 726448 spots for SRR12690171.sra Read 726450 spots for SRR12690171.sra Written 726450 spots for SRR12690171.sra SRR ids: ['SRR12690171.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_chzzse8q SRR12690171.sra spots: 14528962 blocks: [[1, 726448], [726449, 1452896], [1452897, 2179344], [2179345, 2905792], [2905793, 3632240], [3632241, 4358688], [4358689, 5085136], [5085137, 5811584], [5811585, 6538032], [6538033, 7264480], [7264481, 7990928], [7990929, 8717376], [8717377, 9443824], [9443825, 10170272], [10170273, 10896720], [10896721, 11623168], [11623169, 12349616], [12349617, 13076064], [13076065, 13802512], [13802513, 14528962]] SRR12690171 file size 4915876 SRR12690171 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690171 SRR12690171_1.fastq SRR12690171_2.fastq Input file: SRR12690171_1.fastq Paired file: SRR12690171_2.fastq trimmed: SRR12690171-trimmed-pair1.fastq, SRR12690171-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:40:27 2025 >> started Mon Feb 10 21:40:49 2025 >> done (22.273s) 14528962 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 1569 ( 0.01%) empty read pairs filtered out after trimming by size control 14527357 (99.99%) read pairs available; of these: 1578646 (10.87%) trimmed read pairs available after processing 12948711 (89.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 8 0.00% 22 4 0.00% 23 2 0.00% 24 6 0.00% 25 7 0.00% 26 8 0.00% 27 12 0.00% 28 7 0.00% 29 9 0.00% 30 6 0.00% 31 10 0.00% 32 6 0.00% 33 17 0.00% 34 19 0.00% 35 13 0.00% 36 19 0.00% 37 23 0.00% 38 11 0.00% 39 9 0.00% 40 32 0.00% 41 22 0.00% 42 29 0.00% 43 35 0.00% 44 26 0.00% 45 26 0.00% 46 32 0.00% 47 35 0.00% 48 53 0.00% 49 56 0.00% 50 57 0.00% 51 64 0.00% 52 88 0.00% 53 74 0.00% 54 98 0.00% 55 82 0.00% 56 108 0.00% 57 130 0.00% 58 137 0.00% 59 176 0.00% 60 209 0.00% 61 241 0.00% 62 249 0.00% 63 295 0.00% 64 341 0.00% 65 341 0.00% 66 387 0.00% 67 450 0.00% 68 499 0.00% 69 609 0.00% 70 658 0.00% 71 751 0.01% 72 911 0.01% 73 983 0.01% 74 1064 0.01% 75 1164 0.01% 76 1381 0.01% 77 1507 0.01% 78 1581 0.01% 79 1861 0.01% 80 1993 0.01% 81 2234 0.02% 82 2627 0.02% 83 2775 0.02% 84 3042 0.02% 85 3484 0.02% 86 3670 0.03% 87 4087 0.03% 88 4512 0.03% 89 4825 0.03% 90 5330 0.04% 91 5656 0.04% 92 6186 0.04% 93 6559 0.05% 94 7192 0.05% 95 7635 0.05% 96 8168 0.06% 97 8632 0.06% 98 9276 0.06% 99 9687 0.07% 100 10573 0.07% 101 10861 0.07% 102 11524 0.08% 103 12179 0.08% 104 12870 0.09% 105 13394 0.09% 106 14169 0.10% 107 14627 0.10% 108 15259 0.11% 109 15978 0.11% 110 16410 0.11% 111 17454 0.12% 112 18189 0.13% 113 18386 0.13% 114 19363 0.13% 115 20210 0.14% 116 21084 0.15% 117 21788 0.15% 118 22226 0.15% 119 23035 0.16% 120 24184 0.17% 121 25174 0.17% 122 25422 0.17% 123 26341 0.18% 124 27244 0.19% 125 28034 0.19% 126 28954 0.20% 127 29925 0.21% 128 30678 0.21% 129 31560 0.22% 130 32037 0.22% 131 33143 0.23% 132 33521 0.23% 133 34691 0.24% 134 35339 0.24% 135 36351 0.25% 136 36829 0.25% 137 37913 0.26% 138 38296 0.26% 139 39762 0.27% 140 40620 0.28% 141 40968 0.28% 142 42492 0.29% 143 43381 0.30% 144 43897 0.30% 145 45007 0.31% 146 45073 0.31% 147 45654 0.31% 148 46645 0.32% 149 47391 0.33% 150 47925 0.33% 151 12948711 89.13% 14527357 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.67 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=24.33 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.2 sequence=AAGGAAGAAAAACTTGGGACAAATTAAATTACATGCTCAGTAACAGTAGAGATAACAATCATAAAATCCACCCCCCCTGCCGGAACACCACCGACGACACAAACAGAAAGAGATCTTATTTAACCGCTAAACTCTTCCTCTTTGTGTGTCTCGATGACAACATCAGACGTAGGATAAGCAACACAGGTGAGAACCCAGCCTTCCTCTATCTGGTCATCATCAAGGAAGCTAGCATCAGACTGATCCACAGTCCCCTTCACAATCTTGCCAAGACATGAAGAGCATGAGCCAGCCCTGCATGAGTAGGGGAGGTCAATCTCTTCTGCCTCCTCAGCATGGTCAAGGATGTAGATGTCATCGGGGCATGCAAACTCCTTCTCACCATCAGGAGTGATGAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.91 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=42.56 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.6 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12690171 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:41:32 Started mapping on | Feb 10 21:41:33 Finished on | Feb 10 21:42:54 Mapping speed, Million of reads per hour | 645.66 Number of input reads | 14527357 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13757989 Uniquely mapped reads % | 94.70% Average mapped length | 295.81 Number of splices: Total | 13273001 Number of splices: Annotated (sjdb) | 13022074 Number of splices: GT/AG | 13003843 Number of splices: GC/AG | 226224 Number of splices: AT/AC | 10309 Number of splices: Non-canonical | 32625 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403002 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 46933 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 366366 366366 366366 N_multimapping 403002 403002 403002 N_noFeature 434043 13637748 474994 N_ambiguous 163115 493 83539 UnstrandedReadsAssigned:13160831 PositiveStrandReadsAssigned:119748 NegativeStrandReadsAssigned:13199456 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690171 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690171-trimmed-pair1.fastq SRR12690171-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,527,357 reads, 13,325,160 reads pseudoaligned [quant] estimated average fragment length: 249.365 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,219 rounds 52401 SRR12690171.ke.tsv 34699 SRR12690171.se.tsv 87100 total ==> SRR12690171.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.64 339 14.4034 Potri.005G024800.1.v4.1 1035 786.635 129 12.33 Potri.004G059700.1.v4.1 961 712.79 60 6.32904 Potri.007G009000.2.v4.1 1416 1167.64 0 0 Potri.003G141000.2.v4.1 2943 2694.64 356 9.93341 Potri.016G087400.1.v4.1 270 83.2204 821 741.757 Potri.015G069301.1.v4.1 564 328.188 0 0 Potri.010G195200.1.v4.1 1773 1524.64 6 0.295892 Potri.012G127500.1.v4.1 977 728.746 755 77.8967 ==> SRR12690171.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 43 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 129 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR12690171 completed mapping pipeline successfully