Starting /dee2/code/volunteer_pipeline.sh SRR12690172 current disk space = 3056896753664 free memory = 1483408680 SRR12690172 SRAfilesize 95de11b3a8014e03709e6c6eaea9d667 SRR12690172.sra SRR12690172.sra file validated SRR12690172 is paired end SRR12690172 is conventional basespace SRR12690172 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690172_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6385 37.0 37.0 37.0 37.0 37.0 2 36.28025 37.0 37.0 37.0 37.0 37.0 3 36.572 37.0 37.0 37.0 37.0 37.0 4 36.568 37.0 37.0 37.0 37.0 37.0 5 36.6005 37.0 37.0 37.0 37.0 37.0 6 36.6675 37.0 37.0 37.0 37.0 37.0 7 36.531 37.0 37.0 37.0 37.0 37.0 8 36.583 37.0 37.0 37.0 37.0 37.0 9 36.56 37.0 37.0 37.0 37.0 37.0 10-14 36.5897 37.0 37.0 37.0 37.0 37.0 15-19 36.593599999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.6005 37.0 37.0 37.0 37.0 37.0 25-29 36.5197 37.0 37.0 37.0 37.0 37.0 30-34 36.483700000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4743 37.0 37.0 37.0 37.0 37.0 40-44 36.4928 37.0 37.0 37.0 37.0 37.0 45-49 36.4306 37.0 37.0 37.0 37.0 37.0 50-54 36.38719999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.3764 37.0 37.0 37.0 37.0 37.0 60-64 36.35209999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.305899999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.3157 37.0 37.0 37.0 37.0 37.0 75-79 36.3191 37.0 37.0 37.0 37.0 37.0 80-84 36.2214 37.0 37.0 37.0 37.0 37.0 85-89 36.2738 37.0 37.0 37.0 37.0 37.0 90-94 36.2233 37.0 37.0 37.0 37.0 37.0 95-99 36.1748 37.0 37.0 37.0 37.0 37.0 100-104 36.1192 37.0 37.0 37.0 37.0 37.0 105-109 36.136399999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.13870000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.1112 37.0 37.0 37.0 37.0 37.0 120-124 36.054100000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.9846 37.0 37.0 37.0 37.0 37.0 130-134 35.984 37.0 37.0 37.0 37.0 37.0 135-139 35.9736 37.0 37.0 37.0 37.0 37.0 140-144 35.6411 37.0 37.0 37.0 37.0 37.0 145-149 35.53339999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.33625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 1.0 26 3.0 27 13.0 28 11.0 29 15.0 30 14.0 31 39.0 32 54.0 33 67.0 34 114.0 35 346.0 36 2992.0 37 327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.25 13.825000000000001 7.625 36.3 2 22.051797837566003 12.698013578073924 35.856172994719635 29.394015589640432 3 18.075 16.125 27.175 38.625 4 22.75 23.3 24.2 29.75 5 22.85 30.95 24.099999999999998 22.1 6 21.224999999999998 33.175 22.650000000000002 22.95 7 16.125 26.150000000000002 40.8 16.925 8 18.275 25.85 31.924999999999997 23.95 9 16.975 24.775 35.275 22.975 10-14 19.794999999999998 29.065 27.905 23.235 15-19 20.16 27.295 27.96 24.585 20-24 19.814999999999998 28.08 28.17 23.935000000000002 25-29 20.244999999999997 28.38 27.36 24.015 30-34 20.465 28.754999999999995 27.105 23.674999999999997 35-39 20.775 27.139999999999997 27.779999999999998 24.305 40-44 20.575 28.189999999999998 27.46 23.775 45-49 20.735 27.860000000000003 27.325 24.08 50-54 21.240000000000002 28.389999999999997 26.865 23.505000000000003 55-59 20.46 28.38 27.134999999999998 24.025 60-64 20.285 28.189999999999998 27.465 24.060000000000002 65-69 20.080000000000002 27.075 28.965000000000003 23.880000000000003 70-74 20.845 27.82 27.46 23.875 75-79 20.205000000000002 27.384999999999998 27.950000000000003 24.46 80-84 20.599999999999998 28.09 27.29 24.02 85-89 21.005 28.73 26.645000000000003 23.62 90-94 21.125 27.584999999999997 27.32 23.97 95-99 20.72 28.285 27.235 23.76 100-104 20.93 28.720000000000002 26.810000000000002 23.54 105-109 21.09 27.615000000000002 27.589999999999996 23.705000000000002 110-114 21.154999999999998 27.79 27.500000000000004 23.555 115-119 21.75 28.265 27.01 22.975 120-124 21.5 28.15 26.740000000000002 23.61 125-129 21.615000000000002 27.915 27.145000000000003 23.325000000000003 130-134 21.43 27.99 26.445 24.135 135-139 21.98 28.235 26.169999999999998 23.615 140-144 21.77 27.725 26.43 24.075 145-149 21.59 27.965 26.369999999999997 24.075 150-151 21.25 28.325 26.0 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 0.5 23 2.0 24 3.0 25 1.5 26 4.0 27 8.5 28 7.5 29 8.5 30 14.0 31 16.0 32 23.0 33 30.0 34 31.0 35 54.5 36 85.0 37 98.5 38 120.5 39 144.0 40 159.0 41 198.5 42 236.0 43 247.5 44 248.5 45 267.0 46 269.0 47 265.5 48 256.5 49 208.0 50 186.0 51 171.5 52 142.5 53 123.5 54 94.5 55 68.0 56 54.5 57 43.0 58 30.5 59 20.5 60 18.5 61 11.0 62 6.5 63 4.5 64 2.0 65 1.5 66 1.0 67 1.5 68 1.5 69 1.5 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 90.79636263433453 82.375 2 8.211628547809314 14.899999999999999 3 0.9644530173601543 2.625 4 0.027555800496004413 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.9750000000000001 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.3375 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.15 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 3.7875 0.0 0.0 0.0 0.0 116-117 4.25 0.0 0.0 0.0 0.0 118-119 4.7125 0.0 0.0 0.0 0.0 120-121 5.074999999999999 0.0 0.0 0.0 0.0 122-123 5.475 0.0 0.0 0.0 0.0 124-125 5.9375 0.0 0.0 0.0 0.0 126-127 6.4 0.0 0.0 0.0 0.0 128-129 6.925000000000001 0.0 0.0 0.0 0.0 130-131 7.362500000000001 0.0 0.0 0.0 0.0 132-133 7.8875 0.0 0.0 0.0 0.0 134-135 8.2125 0.0 0.0 0.0 0.0 136-137 8.7625 0.0 0.0 0.0 0.0 138-139 9.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAAAA 10 0.006830828 145.0 6 CCCTTCT 10 0.006830828 145.0 1 >>END_MODULE SRR12690172 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690172_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2455 37.0 37.0 37.0 37.0 37.0 2 36.1755 37.0 37.0 37.0 37.0 37.0 3 36.137 37.0 37.0 37.0 37.0 37.0 4 36.2555 37.0 37.0 37.0 37.0 37.0 5 36.311 37.0 37.0 37.0 37.0 37.0 6 36.218 37.0 37.0 37.0 37.0 37.0 7 36.394 37.0 37.0 37.0 37.0 37.0 8 36.2865 37.0 37.0 37.0 37.0 37.0 9 36.4645 37.0 37.0 37.0 37.0 37.0 10-14 36.326299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2638 37.0 37.0 37.0 37.0 37.0 20-24 36.263999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1913 37.0 37.0 37.0 37.0 37.0 30-34 36.1659 37.0 37.0 37.0 37.0 37.0 35-39 36.196299999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.1501 37.0 37.0 37.0 37.0 37.0 45-49 36.1924 37.0 37.0 37.0 37.0 37.0 50-54 36.1153 37.0 37.0 37.0 37.0 37.0 55-59 36.1114 37.0 37.0 37.0 37.0 37.0 60-64 35.9982 37.0 37.0 37.0 37.0 37.0 65-69 36.016000000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.9825 37.0 37.0 37.0 37.0 37.0 75-79 35.945800000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.951 37.0 37.0 37.0 37.0 37.0 85-89 35.9282 37.0 37.0 37.0 37.0 37.0 90-94 35.7983 37.0 37.0 37.0 37.0 37.0 95-99 35.8772 37.0 37.0 37.0 37.0 37.0 100-104 35.8389 37.0 37.0 37.0 37.0 37.0 105-109 35.874700000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.751 37.0 37.0 37.0 37.0 37.0 115-119 35.745999999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.6463 37.0 37.0 37.0 37.0 37.0 125-129 35.64110000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.5513 37.0 37.0 37.0 37.0 37.0 135-139 35.4254 37.0 37.0 37.0 37.0 37.0 140-144 35.40410000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.1823 37.0 37.0 37.0 27.4 37.0 150-151 34.784000000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 0.0 15 4.0 16 1.0 17 1.0 18 0.0 19 2.0 20 0.0 21 0.0 22 3.0 23 7.0 24 4.0 25 4.0 26 10.0 27 14.0 28 8.0 29 21.0 30 28.0 31 32.0 32 59.0 33 95.0 34 217.0 35 558.0 36 2672.0 37 255.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.125 25.4 10.299999999999999 24.175 2 28.749999999999996 26.700000000000003 29.349999999999998 15.2 3 20.525 27.35 32.625 19.5 4 22.55 33.45 24.8 19.2 5 24.099999999999998 37.175000000000004 21.525 17.2 6 20.7 39.95 22.2 17.150000000000002 7 21.325 22.825 36.85 19.0 8 21.55 27.3 27.425 23.724999999999998 9 23.9 24.75 29.525000000000002 21.825 10-14 23.669999999999998 29.744999999999997 25.825 20.76 15-19 22.525000000000002 29.29 26.91 21.275 20-24 22.814999999999998 29.365000000000002 27.284999999999997 20.535 25-29 23.31 27.900000000000002 27.52 21.27 30-34 22.605 28.205000000000002 27.875 21.315 35-39 22.43 28.025 27.839999999999996 21.705 40-44 22.68 27.79 27.83 21.7 45-49 22.6 28.084999999999997 27.794999999999998 21.52 50-54 22.925 27.685 27.485 21.905 55-59 23.11 27.485 27.48 21.925 60-64 23.015 27.500000000000004 27.634999999999998 21.85 65-69 24.025 27.060000000000002 27.825 21.09 70-74 23.330000000000002 27.334999999999997 27.425 21.91 75-79 22.81 27.839999999999996 27.400000000000002 21.95 80-84 23.76 27.21 27.1 21.93 85-89 23.01 27.950000000000003 27.255000000000003 21.785 90-94 23.494999999999997 27.800000000000004 26.855 21.85 95-99 23.89 27.425 26.784999999999997 21.9 100-104 24.85 27.905 26.515 20.73 105-109 23.705000000000002 27.38 27.04 21.875 110-114 23.849999999999998 27.68 27.284999999999997 21.185000000000002 115-119 24.990000000000002 27.71 26.55 20.75 120-124 24.945 27.694999999999997 26.619999999999997 20.74 125-129 24.884999999999998 28.13 26.26 20.724999999999998 130-134 25.465 27.82 26.115 20.599999999999998 135-139 24.845 27.894999999999996 26.865 20.395 140-144 25.5 27.58 26.8 20.119999999999997 145-149 26.07 28.025 25.669999999999998 20.235 150-151 27.400000000000002 27.6125 25.637500000000003 19.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 0.5 20 1.5 21 2.0 22 0.5 23 0.5 24 3.0 25 4.0 26 3.5 27 6.5 28 9.0 29 9.5 30 15.0 31 17.5 32 18.5 33 37.0 34 58.5 35 59.5 36 62.5 37 98.5 38 132.0 39 158.5 40 183.5 41 214.5 42 247.5 43 248.5 44 253.5 45 263.5 46 258.0 47 247.0 48 220.5 49 215.0 50 193.5 51 151.0 52 127.0 53 104.5 54 87.5 55 71.0 56 54.5 57 35.5 58 27.0 59 23.0 60 16.0 61 10.0 62 8.5 63 9.5 64 7.0 65 2.0 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 1.0 75 1.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.03695532266961 82.525 2 7.859900717043574 14.249999999999998 3 0.9652509652509652 2.625 4 0.05515719801434087 0.2 5 0.05515719801434087 0.25 6 0.027578599007170437 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.9750000000000001 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.7874999999999996 0.0 0.0 0.0 0.0 110-111 3.2 0.0 0.0 0.0 0.0 112-113 3.5375 0.0 0.0 0.0 0.0 114-115 3.8625 0.0 0.0 0.0 0.0 116-117 4.324999999999999 0.0 0.0 0.0 0.0 118-119 4.7875 0.0 0.0 0.0 0.0 120-121 5.125 0.0 0.0 0.0 0.0 122-123 5.5125 0.0 0.0 0.0 0.0 124-125 5.9875 0.0 0.0 0.0 0.0 126-127 6.475 0.0 0.0 0.0 0.0 128-129 7.0625 0.0 0.0 0.0 0.0 130-131 7.5375 0.0 0.0 0.0 0.0 132-133 8.0625 0.0 0.0 0.0 0.0 134-135 8.3875 0.0 0.0 0.0 0.0 136-137 8.925 0.0 0.0 0.0 0.0 138-139 9.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975192 spots for SRR12690172.sra Written 975192 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra Read 975180 spots for SRR12690172.sra Written 975180 spots for SRR12690172.sra SRR ids: ['SRR12690172.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9j92bij_ SRR12690172.sra spots: 19503612 blocks: [[1, 975180], [975181, 1950360], [1950361, 2925540], [2925541, 3900720], [3900721, 4875900], [4875901, 5851080], [5851081, 6826260], [6826261, 7801440], [7801441, 8776620], [8776621, 9751800], [9751801, 10726980], [10726981, 11702160], [11702161, 12677340], [12677341, 13652520], [13652521, 14627700], [14627701, 15602880], [15602881, 16578060], [16578061, 17553240], [17553241, 18528420], [18528421, 19503612]] SRR12690172 file size 6606480 SRR12690172 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690172 SRR12690172_1.fastq SRR12690172_2.fastq Input file: SRR12690172_1.fastq Paired file: SRR12690172_2.fastq trimmed: SRR12690172-trimmed-pair1.fastq, SRR12690172-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:16:00 2025 >> started Mon Feb 10 21:16:21 2025 >> done (21.696s) 19503612 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 6228 ( 0.03%) empty read pairs filtered out after trimming by size control 19497352 (99.97%) read pairs available; of these: 2826095 (14.49%) trimmed read pairs available after processing 16671257 (85.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 5 0.00% 21 6 0.00% 22 3 0.00% 23 19 0.00% 24 12 0.00% 25 16 0.00% 26 16 0.00% 27 13 0.00% 28 27 0.00% 29 22 0.00% 30 28 0.00% 31 14 0.00% 32 30 0.00% 33 30 0.00% 34 28 0.00% 35 27 0.00% 36 24 0.00% 37 45 0.00% 38 37 0.00% 39 41 0.00% 40 50 0.00% 41 48 0.00% 42 49 0.00% 43 57 0.00% 44 51 0.00% 45 51 0.00% 46 86 0.00% 47 81 0.00% 48 88 0.00% 49 123 0.00% 50 130 0.00% 51 159 0.00% 52 165 0.00% 53 176 0.00% 54 194 0.00% 55 250 0.00% 56 262 0.00% 57 283 0.00% 58 326 0.00% 59 412 0.00% 60 447 0.00% 61 524 0.00% 62 629 0.00% 63 690 0.00% 64 765 0.00% 65 824 0.00% 66 942 0.00% 67 1040 0.01% 68 1191 0.01% 69 1348 0.01% 70 1538 0.01% 71 1820 0.01% 72 2053 0.01% 73 2378 0.01% 74 2589 0.01% 75 2844 0.01% 76 3162 0.02% 77 3704 0.02% 78 4057 0.02% 79 4598 0.02% 80 4897 0.03% 81 5484 0.03% 82 6178 0.03% 83 6967 0.04% 84 7620 0.04% 85 8430 0.04% 86 9025 0.05% 87 9917 0.05% 88 10634 0.05% 89 11562 0.06% 90 12092 0.06% 91 13482 0.07% 92 14213 0.07% 93 15422 0.08% 94 16254 0.08% 95 17768 0.09% 96 18424 0.09% 97 19749 0.10% 98 20332 0.10% 99 21292 0.11% 100 22716 0.12% 101 23542 0.12% 102 24600 0.13% 103 26379 0.14% 104 27187 0.14% 105 28753 0.15% 106 29451 0.15% 107 30645 0.16% 108 31662 0.16% 109 32836 0.17% 110 32908 0.17% 111 34687 0.18% 112 35787 0.18% 113 36529 0.19% 114 38293 0.20% 115 39872 0.20% 116 40515 0.21% 117 41931 0.22% 118 42679 0.22% 119 44017 0.23% 120 45592 0.23% 121 46344 0.24% 122 47418 0.24% 123 48669 0.25% 124 49882 0.26% 125 50675 0.26% 126 52228 0.27% 127 52937 0.27% 128 53976 0.28% 129 54881 0.28% 130 55873 0.29% 131 56642 0.29% 132 57540 0.30% 133 59187 0.30% 134 59774 0.31% 135 61196 0.31% 136 61710 0.32% 137 62562 0.32% 138 63132 0.32% 139 64990 0.33% 140 65090 0.33% 141 66280 0.34% 142 67493 0.35% 143 67863 0.35% 144 69150 0.35% 145 69958 0.36% 146 70197 0.36% 147 71062 0.36% 148 72321 0.37% 149 72505 0.37% 150 73596 0.38% 151 16671257 85.51% 19497352 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.84 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=18.60 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=4.1 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=1.38 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=23 prefix-density=1.39 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=51.12 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.1 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12690172 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:17:16 Started mapping on | Feb 10 21:17:16 Finished on | Feb 10 21:19:25 Mapping speed, Million of reads per hour | 544.11 Number of input reads | 19497352 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18170418 Uniquely mapped reads % | 93.19% Average mapped length | 293.43 Number of splices: Total | 18373471 Number of splices: Annotated (sjdb) | 18035153 Number of splices: GT/AG | 17988671 Number of splices: GC/AG | 325396 Number of splices: AT/AC | 10683 Number of splices: Non-canonical | 48721 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 547106 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 118813 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 779828 779828 779828 N_multimapping 547106 547106 547106 N_noFeature 568244 17960176 630669 N_ambiguous 263448 939 115070 UnstrandedReadsAssigned:17338726 PositiveStrandReadsAssigned:209303 NegativeStrandReadsAssigned:17424679 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690172 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690172-trimmed-pair1.fastq SRR12690172-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,497,352 reads, 17,696,794 reads pseudoaligned [quant] estimated average fragment length: 243.472 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR12690172.ke.tsv 34699 SRR12690172.se.tsv 87100 total ==> SRR12690172.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.53 414 12.297 Potri.005G024800.1.v4.1 1035 792.528 140 9.31624 Potri.004G059700.1.v4.1 961 718.684 26 1.90793 Potri.007G009000.2.v4.1 1416 1173.53 0 0 Potri.003G141000.2.v4.1 2943 2700.53 670.513 13.0944 Potri.016G087400.1.v4.1 270 90.9999 764.121 442.842 Potri.015G069301.1.v4.1 564 334.045 0 0 Potri.010G195200.1.v4.1 1773 1530.53 6 0.206746 Potri.012G127500.1.v4.1 977 734.622 177 12.7068 ==> SRR12690172.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 283 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 187 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12690172 completed mapping pipeline successfully