Starting /dee2/code/volunteer_pipeline.sh SRR12690173 current disk space = 3056015847424 free memory = 1448836780 SRR12690173 SRAfilesize c0e682d29664d6999c3f70c164b11ac9 SRR12690173.sra SRR12690173.sra file validated SRR12690173 is paired end SRR12690173 is conventional basespace SRR12690173 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690173_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.529 37.0 37.0 37.0 37.0 37.0 2 36.364 37.0 37.0 37.0 37.0 37.0 3 36.5745 37.0 37.0 37.0 37.0 37.0 4 36.599 37.0 37.0 37.0 37.0 37.0 5 36.6125 37.0 37.0 37.0 37.0 37.0 6 36.6615 37.0 37.0 37.0 37.0 37.0 7 36.54 37.0 37.0 37.0 37.0 37.0 8 36.574 37.0 37.0 37.0 37.0 37.0 9 36.556 37.0 37.0 37.0 37.0 37.0 10-14 36.595800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5955 37.0 37.0 37.0 37.0 37.0 20-24 36.5943 37.0 37.0 37.0 37.0 37.0 25-29 36.5296 37.0 37.0 37.0 37.0 37.0 30-34 36.511900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.477 37.0 37.0 37.0 37.0 37.0 40-44 36.4717 37.0 37.0 37.0 37.0 37.0 45-49 36.4327 37.0 37.0 37.0 37.0 37.0 50-54 36.398300000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.3253 37.0 37.0 37.0 37.0 37.0 60-64 36.3491 37.0 37.0 37.0 37.0 37.0 65-69 36.3279 37.0 37.0 37.0 37.0 37.0 70-74 36.2984 37.0 37.0 37.0 37.0 37.0 75-79 36.369800000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2301 37.0 37.0 37.0 37.0 37.0 85-89 36.24920000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.2399 37.0 37.0 37.0 37.0 37.0 95-99 36.196000000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.13960000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.1156 37.0 37.0 37.0 37.0 37.0 110-114 36.1371 37.0 37.0 37.0 37.0 37.0 115-119 36.1068 37.0 37.0 37.0 37.0 37.0 120-124 36.0036 37.0 37.0 37.0 37.0 37.0 125-129 35.995 37.0 37.0 37.0 37.0 37.0 130-134 35.945800000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.9536 37.0 37.0 37.0 37.0 37.0 140-144 35.7504 37.0 37.0 37.0 37.0 37.0 145-149 35.6423 37.0 37.0 37.0 37.0 37.0 150-151 35.51625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 3.0 26 5.0 27 10.0 28 9.0 29 13.0 30 24.0 31 37.0 32 46.0 33 65.0 34 131.0 35 322.0 36 2973.0 37 360.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.324999999999996 11.625 10.674999999999999 39.375 2 20.933734939759034 12.32429718875502 33.93574297188755 32.8062248995984 3 17.224999999999998 16.75 26.924999999999997 39.1 4 21.975 24.474999999999998 24.6 28.95 5 23.150000000000002 30.049999999999997 24.099999999999998 22.7 6 23.05 34.225 21.75 20.974999999999998 7 17.1 28.249999999999996 37.574999999999996 17.075000000000003 8 20.775 28.000000000000004 28.799999999999997 22.425 9 17.9 25.15 34.25 22.7 10-14 20.34 28.685 27.625 23.35 15-19 20.455000000000002 28.144999999999996 27.439999999999998 23.96 20-24 19.925 28.105000000000004 27.26 24.709999999999997 25-29 20.46 28.044999999999998 27.72 23.775 30-34 19.7 28.98 27.365000000000002 23.955000000000002 35-39 20.595 27.965 27.615000000000002 23.825 40-44 20.43 28.084999999999997 27.400000000000002 24.085 45-49 20.825 28.62 26.855 23.7 50-54 20.424999999999997 27.994999999999997 27.915 23.665 55-59 20.27 27.775 27.685 24.27 60-64 20.75 28.345 27.205000000000002 23.7 65-69 20.54 28.315 27.13 24.015 70-74 21.255 27.82 27.435 23.49 75-79 20.669999999999998 28.08 26.8 24.45 80-84 20.865000000000002 28.694999999999997 27.255000000000003 23.185 85-89 20.71 29.049999999999997 26.795 23.445 90-94 21.45 27.584999999999997 27.775 23.189999999999998 95-99 20.674999999999997 27.52 27.42 24.385 100-104 21.245 28.244999999999997 27.169999999999998 23.34 105-109 21.395 28.444999999999997 26.58 23.580000000000002 110-114 21.12 28.599999999999998 26.5 23.78 115-119 21.01 28.475 27.0 23.515 120-124 21.375 27.66 27.08 23.885 125-129 20.89 27.83 26.740000000000002 24.54 130-134 20.919999999999998 28.37 27.005000000000003 23.705000000000002 135-139 21.42 27.97 26.16 24.45 140-144 21.815 27.744999999999997 26.235000000000003 24.205 145-149 21.47 27.889999999999997 26.279999999999998 24.36 150-151 22.3875 27.8375 26.8375 22.9375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 1.5 25 2.5 26 3.5 27 4.0 28 5.0 29 6.0 30 11.5 31 18.5 32 27.5 33 36.5 34 45.5 35 69.5 36 81.0 37 89.0 38 116.0 39 150.5 40 181.0 41 206.0 42 218.0 43 230.0 44 259.5 45 262.5 46 259.5 47 248.0 48 242.0 49 243.0 50 196.5 51 155.5 52 134.5 53 112.0 54 87.5 55 71.0 56 63.5 57 48.0 58 32.0 59 21.0 60 16.5 61 11.0 62 9.0 63 5.5 64 1.5 65 3.5 66 3.5 67 2.5 68 1.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.09024191356346 84.7 2 7.203044305517804 13.25 3 0.5979885838543082 1.6500000000000001 4 0.10872519706441967 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.6 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.9 0.0 0.0 0.0 0.0 88-89 0.9874999999999999 0.0 0.0 0.0 0.0 90-91 1.0750000000000002 0.0 0.0 0.0 0.0 92-93 1.275 0.0 0.0 0.0 0.0 94-95 1.4249999999999998 0.0 0.0 0.0 0.0 96-97 1.6749999999999998 0.0 0.0 0.0 0.0 98-99 1.975 0.0 0.0 0.0 0.0 100-101 2.3125 0.0 0.0 0.0 0.0 102-103 2.7249999999999996 0.0 0.0 0.0 0.0 104-105 3.1125 0.0 0.0 0.0 0.0 106-107 3.3499999999999996 0.0 0.0 0.0 0.0 108-109 3.8375000000000004 0.0 0.0 0.0 0.0 110-111 4.3625 0.0 0.0 0.0 0.0 112-113 4.875 0.0 0.0 0.0 0.0 114-115 5.5625 0.0 0.0 0.0 0.0 116-117 5.85 0.0 0.0 0.0 0.0 118-119 6.300000000000001 0.0 0.0 0.0 0.0 120-121 6.925 0.0 0.0 0.0 0.0 122-123 7.5 0.0 0.0 0.0 0.0 124-125 7.8625 0.0 0.0 0.0 0.0 126-127 8.2 0.0 0.0 0.0 0.0 128-129 8.8625 0.0 0.0 0.0 0.0 130-131 9.3125 0.0 0.0 0.0 0.0 132-133 9.7625 0.0 0.0 0.0 0.0 134-135 10.4375 0.0 0.0 0.0 0.0 136-137 11.075 0.0 0.0 0.0 0.0 138-139 11.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATGC 10 0.006830828 145.0 1 TGCGAAC 10 0.006830828 145.0 5 GCGAACA 10 0.006830828 145.0 6 ATGCGAA 10 0.006830828 145.0 4 CGAACAG 10 0.006830828 145.0 7 GCATGCG 10 0.006830828 145.0 2 GAACAGG 10 0.006830828 145.0 8 >>END_MODULE SRR12690173 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690173_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.233 37.0 37.0 37.0 37.0 37.0 2 36.0075 37.0 37.0 37.0 37.0 37.0 3 36.006 37.0 37.0 37.0 37.0 37.0 4 36.1855 37.0 37.0 37.0 37.0 37.0 5 36.244 37.0 37.0 37.0 37.0 37.0 6 36.0835 37.0 37.0 37.0 37.0 37.0 7 36.2215 37.0 37.0 37.0 37.0 37.0 8 36.353 37.0 37.0 37.0 37.0 37.0 9 36.334 37.0 37.0 37.0 37.0 37.0 10-14 36.178000000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.1795 37.0 37.0 37.0 37.0 37.0 20-24 36.1598 37.0 37.0 37.0 37.0 37.0 25-29 36.137600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.11390000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.025800000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.041700000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.996700000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.977 37.0 37.0 37.0 37.0 37.0 55-59 36.0014 37.0 37.0 37.0 37.0 37.0 60-64 35.934900000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.869699999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.864999999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.8601 37.0 37.0 37.0 37.0 37.0 80-84 35.857899999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.833600000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.7198 37.0 37.0 37.0 37.0 37.0 95-99 35.7656 37.0 37.0 37.0 37.0 37.0 100-104 35.767399999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.8189 37.0 37.0 37.0 37.0 37.0 110-114 35.662699999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.5935 37.0 37.0 37.0 37.0 37.0 120-124 35.5737 37.0 37.0 37.0 37.0 37.0 125-129 35.4271 37.0 37.0 37.0 37.0 37.0 130-134 35.3169 37.0 37.0 37.0 37.0 37.0 135-139 35.1611 37.0 37.0 37.0 27.4 37.0 140-144 35.041199999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.88539999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.3755 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 4.0 14 2.0 15 4.0 16 1.0 17 2.0 18 0.0 19 1.0 20 2.0 21 3.0 22 1.0 23 4.0 24 8.0 25 8.0 26 10.0 27 13.0 28 16.0 29 24.0 30 27.0 31 39.0 32 66.0 33 130.0 34 243.0 35 603.0 36 2501.0 37 285.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.3 22.2 12.15 27.35 2 26.625 28.449999999999996 28.1 16.825000000000003 3 21.875 27.575 30.5 20.05 4 24.65 33.85 22.7 18.8 5 24.025 35.475 21.975 18.525 6 19.7 38.125 23.150000000000002 19.025 7 20.599999999999998 22.725 37.25 19.425 8 20.7 26.8 27.650000000000002 24.85 9 21.825 25.35 29.349999999999998 23.474999999999998 10-14 23.515 28.815 26.529999999999998 21.14 15-19 23.085 27.875 27.685 21.355 20-24 23.13 27.565 27.705000000000002 21.6 25-29 22.88 28.549999999999997 27.565 21.005 30-34 22.755 28.615000000000002 27.26 21.37 35-39 23.435 27.925 27.435 21.205 40-44 23.215 27.355 28.349999999999998 21.08 45-49 22.61 28.015 27.575 21.8 50-54 23.05 28.000000000000004 27.694999999999997 21.255 55-59 23.0 27.529999999999998 27.435 22.035 60-64 23.205000000000002 27.175 28.1 21.52 65-69 23.369999999999997 27.51 27.965 21.154999999999998 70-74 23.849999999999998 28.005000000000003 27.445000000000004 20.7 75-79 23.24 27.465 27.534999999999997 21.759999999999998 80-84 23.605 28.084999999999997 26.795 21.515 85-89 23.985 28.144999999999996 27.07 20.8 90-94 24.21 27.935 27.310000000000002 20.544999999999998 95-99 23.875 28.105000000000004 26.99 21.029999999999998 100-104 24.065 27.810000000000002 27.67 20.455000000000002 105-109 24.23 27.49 27.43 20.849999999999998 110-114 24.275 27.92 27.13 20.674999999999997 115-119 24.21 27.815 26.605 21.37 120-124 25.35 27.200000000000003 27.05 20.4 125-129 25.069999999999997 27.810000000000002 26.875 20.244999999999997 130-134 25.245 27.21 26.840000000000003 20.705000000000002 135-139 25.765 27.405 27.1 19.73 140-144 26.69 27.27 26.16 19.88 145-149 26.47 27.43 26.025 20.075000000000003 150-151 27.0125 27.3 26.4125 19.275000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 1.0 10 1.0 11 0.0 12 0.0 13 2.0 14 2.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 2.5 23 3.0 24 1.5 25 2.0 26 2.5 27 2.5 28 2.5 29 4.5 30 13.5 31 17.5 32 24.0 33 34.5 34 44.5 35 57.5 36 77.0 37 92.0 38 122.0 39 178.5 40 202.5 41 204.0 42 227.5 43 250.5 44 258.5 45 282.0 46 285.0 47 270.5 48 244.5 49 207.5 50 175.0 51 136.5 52 111.0 53 94.5 54 83.0 55 66.5 56 52.0 57 41.0 58 31.5 59 23.0 60 13.0 61 7.5 62 5.0 63 5.5 64 4.5 65 2.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 1.5 97 1.0 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.95747001090513 84.325 2 7.279171210468921 13.350000000000001 3 0.5452562704471101 1.5 4 0.19083969465648853 0.7000000000000001 5 0.02726281352235551 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.35 0.0 0.0 0.0 0.0 94-95 1.5 0.0 0.0 0.0 0.0 96-97 1.75 0.0 0.0 0.0 0.0 98-99 2.05 0.0 0.0 0.0 0.0 100-101 2.4 0.0 0.0 0.0 0.0 102-103 2.8499999999999996 0.0 0.0 0.0 0.0 104-105 3.2625 0.0 0.0 0.0 0.0 106-107 3.5 0.0 0.0 0.0 0.0 108-109 3.9875 0.0 0.0 0.0 0.0 110-111 4.5125 0.0 0.0 0.0 0.0 112-113 5.025 0.0 0.0 0.0 0.0 114-115 5.6875 0.0 0.0 0.0 0.0 116-117 5.975 0.0 0.0 0.0 0.0 118-119 6.425000000000001 0.0 0.0 0.0 0.0 120-121 7.075 0.0 0.0 0.0 0.0 122-123 7.65 0.0 0.0 0.0 0.0 124-125 8.0125 0.0 0.0 0.0 0.0 126-127 8.3875 0.0 0.0 0.0 0.0 128-129 9.05 0.0 0.0 0.0 0.0 130-131 9.5 0.0 0.0 0.0 0.0 132-133 9.95 0.0 0.0 0.0 0.0 134-135 10.65 0.0 0.0 0.0 0.0 136-137 11.3 0.0 0.0 0.0 0.0 138-139 11.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTCCA 10 0.006830828 145.0 4 TGATTCC 10 0.006830828 145.0 8 AATTATG 10 0.006830828 145.0 8 GAAAAAT 10 0.006830828 145.0 1 TTCTTGA 10 0.006830828 145.0 4 TCTTGAT 10 0.006830828 145.0 5 TTGGTGC 10 0.006830828 145.0 8 TGGTGCT 10 0.006830828 145.0 9 >>END_MODULE Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974477 spots for SRR12690173.sra Written 974477 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra Read 974465 spots for SRR12690173.sra Written 974465 spots for SRR12690173.sra SRR ids: ['SRR12690173.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gceyy8d5 SRR12690173.sra spots: 19489312 blocks: [[1, 974465], [974466, 1948930], [1948931, 2923395], [2923396, 3897860], [3897861, 4872325], [4872326, 5846790], [5846791, 6821255], [6821256, 7795720], [7795721, 8770185], [8770186, 9744650], [9744651, 10719115], [10719116, 11693580], [11693581, 12668045], [12668046, 13642510], [13642511, 14616975], [14616976, 15591440], [15591441, 16565905], [16565906, 17540370], [17540371, 18514835], [18514836, 19489312]] SRR12690173 file size 6601620 SRR12690173 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690173 SRR12690173_1.fastq SRR12690173_2.fastq Input file: SRR12690173_1.fastq Paired file: SRR12690173_2.fastq trimmed: SRR12690173-trimmed-pair1.fastq, SRR12690173-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:37:20 2025 >> started Mon Feb 10 20:37:42 2025 >> done (21.951s) 19489312 read pairs processed; of these: 100 ( 0.00%) short read pairs filtered out after trimming by size control 22829 ( 0.12%) empty read pairs filtered out after trimming by size control 19466383 (99.88%) read pairs available; of these: 3210643 (16.49%) trimmed read pairs available after processing 16255740 (83.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 3 0.00% 21 7 0.00% 22 9 0.00% 23 7 0.00% 24 6 0.00% 25 9 0.00% 26 17 0.00% 27 13 0.00% 28 19 0.00% 29 21 0.00% 30 10 0.00% 31 31 0.00% 32 23 0.00% 33 20 0.00% 34 52 0.00% 35 31 0.00% 36 44 0.00% 37 54 0.00% 38 64 0.00% 39 78 0.00% 40 108 0.00% 41 104 0.00% 42 110 0.00% 43 143 0.00% 44 125 0.00% 45 127 0.00% 46 156 0.00% 47 198 0.00% 48 208 0.00% 49 249 0.00% 50 359 0.00% 51 418 0.00% 52 461 0.00% 53 510 0.00% 54 531 0.00% 55 529 0.00% 56 559 0.00% 57 759 0.00% 58 836 0.00% 59 915 0.00% 60 1214 0.01% 61 1311 0.01% 62 1446 0.01% 63 1635 0.01% 64 1865 0.01% 65 2029 0.01% 66 2161 0.01% 67 2302 0.01% 68 2676 0.01% 69 3172 0.02% 70 3567 0.02% 71 3999 0.02% 72 4563 0.02% 73 5083 0.03% 74 5459 0.03% 75 6067 0.03% 76 6585 0.03% 77 7211 0.04% 78 7677 0.04% 79 8552 0.04% 80 9170 0.05% 81 10560 0.05% 82 11295 0.06% 83 12557 0.06% 84 13367 0.07% 85 14808 0.08% 86 15601 0.08% 87 16594 0.09% 88 17357 0.09% 89 18416 0.09% 90 19884 0.10% 91 21127 0.11% 92 22430 0.12% 93 23744 0.12% 94 25038 0.13% 95 26509 0.14% 96 27365 0.14% 97 28633 0.15% 98 29218 0.15% 99 30442 0.16% 100 32028 0.16% 101 32881 0.17% 102 33570 0.17% 103 35131 0.18% 104 36310 0.19% 105 37272 0.19% 106 38154 0.20% 107 39354 0.20% 108 39919 0.21% 109 40818 0.21% 110 41268 0.21% 111 42323 0.22% 112 43239 0.22% 113 44502 0.23% 114 45614 0.23% 115 46861 0.24% 116 47677 0.24% 117 49154 0.25% 118 49319 0.25% 119 49569 0.25% 120 50395 0.26% 121 51165 0.26% 122 52218 0.27% 123 53029 0.27% 124 54822 0.28% 125 54515 0.28% 126 55501 0.29% 127 57130 0.29% 128 57002 0.29% 129 57892 0.30% 130 58835 0.30% 131 58971 0.30% 132 59524 0.31% 133 60962 0.31% 134 61596 0.32% 135 61734 0.32% 136 62954 0.32% 137 63192 0.32% 138 63981 0.33% 139 64614 0.33% 140 64849 0.33% 141 65599 0.34% 142 65728 0.34% 143 67008 0.34% 144 67589 0.35% 145 68275 0.35% 146 68381 0.35% 147 68913 0.35% 148 69879 0.36% 149 69210 0.36% 150 69595 0.36% 151 16255740 83.51% 19466383 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=9 prefix-density=0.78 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.28 sequence-density-rank=19 fanout-score=6.99 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=4.6 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACCGCCTTTCCGGCTAGCGAAGGGGA criterion=sequence-density sequence-density=1.36 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=1.36 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=50.40 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.3 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTATGGCGATGGTTGTTAGTGCACCTCTAGCAGAAGCTGCCATCTCATGCGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAGGCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12690173 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:38:26 Started mapping on | Feb 10 20:38:26 Finished on | Feb 10 20:40:26 Mapping speed, Million of reads per hour | 583.99 Number of input reads | 19466383 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17987149 Uniquely mapped reads % | 92.40% Average mapped length | 291.06 Number of splices: Total | 17306624 Number of splices: Annotated (sjdb) | 16936238 Number of splices: GT/AG | 16949246 Number of splices: GC/AG | 299422 Number of splices: AT/AC | 12574 Number of splices: Non-canonical | 45382 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 435009 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 105403 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.65% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1044225 1044225 1044225 N_multimapping 435009 435009 435009 N_noFeature 618083 17793041 685615 N_ambiguous 233922 933 106800 UnstrandedReadsAssigned:17135144 PositiveStrandReadsAssigned:193175 NegativeStrandReadsAssigned:17194734 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690173 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690173-trimmed-pair1.fastq SRR12690173-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,466,383 reads, 17,242,823 reads pseudoaligned [quant] estimated average fragment length: 240.591 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR12690173.ke.tsv 34699 SRR12690173.se.tsv 87100 total ==> SRR12690173.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.41 427 14.0304 Potri.005G024800.1.v4.1 1035 795.409 75 5.50989 Potri.004G059700.1.v4.1 961 721.564 33 2.67246 Potri.007G009000.2.v4.1 1416 1176.41 0 0 Potri.003G141000.2.v4.1 2943 2703.41 1120.63 24.2228 Potri.016G087400.1.v4.1 270 95.5394 731 447.103 Potri.015G069301.1.v4.1 564 337.407 0 0 Potri.010G195200.1.v4.1 1773 1533.41 7 0.266755 Potri.012G127500.1.v4.1 977 737.512 308 24.4036 ==> SRR12690173.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 478 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 16 Potri.001G452600.v4.1 0 SRR12690173 completed mapping pipeline successfully