Starting /dee2/code/volunteer_pipeline.sh SRR12690174 current disk space = 3057010020352 free memory = 1578282584 SRR12690174 SRAfilesize 7427f346f9ccfa429de4ca6875cb5f03 SRR12690174.sra SRR12690174.sra file validated SRR12690174 is paired end SRR12690174 is conventional basespace SRR12690174 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690174_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.662 37.0 37.0 37.0 37.0 37.0 2 36.46175 37.0 37.0 37.0 37.0 37.0 3 36.562 37.0 37.0 37.0 37.0 37.0 4 36.62 37.0 37.0 37.0 37.0 37.0 5 36.653 37.0 37.0 37.0 37.0 37.0 6 36.7095 37.0 37.0 37.0 37.0 37.0 7 36.5575 37.0 37.0 37.0 37.0 37.0 8 36.5905 37.0 37.0 37.0 37.0 37.0 9 36.564 37.0 37.0 37.0 37.0 37.0 10-14 36.601800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5945 37.0 37.0 37.0 37.0 37.0 20-24 36.5793 37.0 37.0 37.0 37.0 37.0 25-29 36.5432 37.0 37.0 37.0 37.0 37.0 30-34 36.468900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.439699999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.427800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4191 37.0 37.0 37.0 37.0 37.0 50-54 36.3459 37.0 37.0 37.0 37.0 37.0 55-59 36.273 37.0 37.0 37.0 37.0 37.0 60-64 36.325199999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.2661 37.0 37.0 37.0 37.0 37.0 70-74 36.2769 37.0 37.0 37.0 37.0 37.0 75-79 36.2908 37.0 37.0 37.0 37.0 37.0 80-84 36.2461 37.0 37.0 37.0 37.0 37.0 85-89 36.2584 37.0 37.0 37.0 37.0 37.0 90-94 36.199799999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.177499999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.152899999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1031 37.0 37.0 37.0 37.0 37.0 110-114 36.114399999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0552 37.0 37.0 37.0 37.0 37.0 120-124 35.9936 37.0 37.0 37.0 37.0 37.0 125-129 36.003699999999995 37.0 37.0 37.0 37.0 37.0 130-134 36.008 37.0 37.0 37.0 37.0 37.0 135-139 36.0169 37.0 37.0 37.0 37.0 37.0 140-144 35.7757 37.0 37.0 37.0 37.0 37.0 145-149 35.7877 37.0 37.0 37.0 37.0 37.0 150-151 35.6215 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 0.0 22 1.0 23 1.0 24 0.0 25 1.0 26 4.0 27 8.0 28 6.0 29 18.0 30 30.0 31 35.0 32 58.0 33 86.0 34 130.0 35 262.0 36 3008.0 37 350.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.95 10.75 6.950000000000001 38.35 2 19.65854883253829 12.37760482048707 36.40472006025609 31.559126286718552 3 16.575 14.524999999999999 30.099999999999998 38.800000000000004 4 20.625 23.0 24.825 31.55 5 22.45 29.049999999999997 25.6 22.900000000000002 6 22.725 33.225 22.825 21.224999999999998 7 17.5 26.174999999999997 38.75 17.575 8 18.475 27.55 31.075000000000003 22.900000000000002 9 16.825000000000003 24.975 34.699999999999996 23.5 10-14 19.91 28.549999999999997 27.74 23.799999999999997 15-19 19.97 27.455000000000002 28.389999999999997 24.185000000000002 20-24 21.33 28.005000000000003 27.24 23.425 25-29 21.11 27.16 27.515 24.215 30-34 20.325 27.810000000000002 27.22 24.645 35-39 21.105 27.405 27.61 23.880000000000003 40-44 20.25 28.275 28.12 23.355 45-49 20.76 27.38 27.555000000000003 24.305 50-54 21.044999999999998 27.57 27.800000000000004 23.585 55-59 20.995 27.665 27.775 23.565 60-64 20.635 27.13 28.625 23.61 65-69 21.175 27.224999999999998 27.71 23.89 70-74 21.04 27.565 27.675 23.72 75-79 21.235 27.205000000000002 27.560000000000002 24.0 80-84 21.15 27.224999999999998 28.299999999999997 23.325000000000003 85-89 21.23 27.97 27.27 23.53 90-94 21.275 27.839999999999996 27.485 23.400000000000002 95-99 21.22 26.865 27.939999999999998 23.974999999999998 100-104 21.345 28.13 26.995 23.53 105-109 21.83 27.785 27.055 23.330000000000002 110-114 21.785 27.875 27.515 22.825 115-119 21.66 27.955000000000002 27.425 22.96 120-124 21.240000000000002 27.88 27.595 23.285 125-129 21.39 27.395000000000003 27.67 23.544999999999998 130-134 21.54 27.944999999999997 26.974999999999998 23.54 135-139 21.490000000000002 27.694999999999997 27.05 23.765 140-144 21.775 27.465 26.87 23.89 145-149 21.58 27.88 26.955000000000002 23.585 150-151 21.625 28.000000000000004 26.137500000000003 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.0 23 0.5 24 1.5 25 2.0 26 1.5 27 5.5 28 7.5 29 8.5 30 10.5 31 13.5 32 21.5 33 30.0 34 38.5 35 56.5 36 82.0 37 87.5 38 102.0 39 141.0 40 168.0 41 192.0 42 226.5 43 254.5 44 268.0 45 274.0 46 266.0 47 252.5 48 239.0 49 214.0 50 193.0 51 172.0 52 136.5 53 116.0 54 102.5 55 79.5 56 58.0 57 47.0 58 35.0 59 27.5 60 21.5 61 11.5 62 8.0 63 2.0 64 1.5 65 3.5 66 5.5 67 4.0 68 2.5 69 1.5 70 0.0 71 1.0 72 1.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 91.6460566089585 83.375 2 7.227260236328662 13.15 3 0.8793624622148941 2.4 4 0.1923605386095081 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.02748007694421544 0.17500000000000002 8 0.02748007694421544 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTTAACATCTCGTAT 8 0.2 TruSeq Adapter, Index 2 (97% over 37bp) GTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.4875 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.15 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.487500000000001 0.0 0.0 0.0 0.0 130-131 5.0125 0.0 0.0 0.0 0.0 132-133 5.4 0.0 0.0 0.0 0.0 134-135 5.7625 0.0 0.0 0.0 0.0 136-137 6.4 0.0 0.0 0.0 0.0 138-139 7.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATTCC 10 0.006830828 145.0 4 CGAGAAA 10 0.006830828 145.0 1 CCTTGTT 30 0.0017973486 72.5 1 >>END_MODULE SRR12690174 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690174_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3825 37.0 37.0 37.0 37.0 37.0 2 35.99 37.0 37.0 37.0 37.0 37.0 3 36.126 37.0 37.0 37.0 37.0 37.0 4 36.129 37.0 37.0 37.0 37.0 37.0 5 36.32 37.0 37.0 37.0 37.0 37.0 6 36.2465 37.0 37.0 37.0 37.0 37.0 7 36.2655 37.0 37.0 37.0 37.0 37.0 8 36.409 37.0 37.0 37.0 37.0 37.0 9 36.348 37.0 37.0 37.0 37.0 37.0 10-14 36.307300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.305800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.238600000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.2112 37.0 37.0 37.0 37.0 37.0 30-34 36.13889999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.215199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1531 37.0 37.0 37.0 37.0 37.0 45-49 36.1587 37.0 37.0 37.0 37.0 37.0 50-54 36.1185 37.0 37.0 37.0 37.0 37.0 55-59 36.124399999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.0507 37.0 37.0 37.0 37.0 37.0 65-69 36.05550000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.95869999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.0523 37.0 37.0 37.0 37.0 37.0 80-84 35.9627 37.0 37.0 37.0 37.0 37.0 85-89 35.9771 37.0 37.0 37.0 37.0 37.0 90-94 35.9221 37.0 37.0 37.0 37.0 37.0 95-99 35.9414 37.0 37.0 37.0 37.0 37.0 100-104 35.9625 37.0 37.0 37.0 37.0 37.0 105-109 35.9732 37.0 37.0 37.0 37.0 37.0 110-114 35.888600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.83970000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.743 37.0 37.0 37.0 37.0 37.0 125-129 35.7157 37.0 37.0 37.0 37.0 37.0 130-134 35.659499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.5473 37.0 37.0 37.0 37.0 37.0 140-144 35.4813 37.0 37.0 37.0 37.0 37.0 145-149 35.2891 37.0 37.0 37.0 34.6 37.0 150-151 34.795249999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 1.0 16 1.0 17 2.0 18 1.0 19 1.0 20 2.0 21 1.0 22 3.0 23 4.0 24 5.0 25 7.0 26 8.0 27 12.0 28 9.0 29 20.0 30 28.0 31 24.0 32 57.0 33 96.0 34 177.0 35 538.0 36 2741.0 37 258.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.875 26.0 10.6 24.525 2 26.8 28.15 29.725 15.325 3 20.65 28.199999999999996 31.7 19.45 4 22.650000000000002 34.9 23.225 19.225 5 24.95 36.15 22.0 16.900000000000002 6 19.225 40.35 22.0 18.425 7 20.8 24.25 36.8 18.15 8 21.15 25.650000000000002 27.825 25.374999999999996 9 20.925 23.375 30.075000000000003 25.624999999999996 10-14 22.545 29.505 26.375 21.575 15-19 23.44 27.705000000000002 27.615000000000002 21.240000000000002 20-24 22.82 28.610000000000003 26.840000000000003 21.73 25-29 23.119999999999997 28.660000000000004 27.66 20.560000000000002 30-34 22.685 28.449999999999996 27.63 21.235 35-39 22.865 28.225 27.27 21.64 40-44 23.155 28.360000000000003 27.650000000000002 20.835 45-49 23.535 27.825 27.205000000000002 21.435000000000002 50-54 23.105 27.939999999999998 27.48 21.475 55-59 23.31 27.634999999999998 27.400000000000002 21.654999999999998 60-64 23.04 27.355 27.395000000000003 22.21 65-69 23.07 27.02 27.884999999999998 22.025 70-74 23.355 27.605 27.235 21.805 75-79 23.055 27.48 27.51 21.955 80-84 23.125 28.02 27.515 21.34 85-89 23.535 27.700000000000003 27.229999999999997 21.535 90-94 23.815 27.625 26.615 21.945 95-99 22.925 28.13 27.169999999999998 21.775 100-104 24.21 27.395000000000003 27.07 21.325 105-109 24.265 27.544999999999998 26.745 21.445 110-114 24.555 28.125 26.22 21.099999999999998 115-119 24.27 27.965 26.27 21.495 120-124 24.445 28.12 26.705000000000002 20.73 125-129 25.005 28.645 25.825 20.525 130-134 25.595000000000002 28.205000000000002 26.115 20.085 135-139 25.09 27.87 26.279999999999998 20.76 140-144 25.555 27.525 25.955000000000002 20.965 145-149 26.090000000000003 27.68 26.355 19.875 150-151 26.025 28.050000000000004 25.674999999999997 20.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 0.5 25 4.0 26 5.0 27 2.0 28 4.0 29 7.5 30 8.5 31 11.5 32 23.5 33 37.0 34 45.0 35 50.5 36 67.5 37 99.5 38 137.5 39 173.5 40 205.5 41 228.0 42 244.5 43 270.5 44 292.5 45 271.5 46 252.0 47 249.0 48 230.0 49 216.5 50 180.5 51 136.0 52 107.5 53 83.5 54 69.0 55 59.5 56 50.0 57 43.0 58 31.5 59 23.0 60 18.0 61 11.0 62 7.0 63 3.0 64 1.5 65 0.5 66 0.5 67 1.0 68 0.5 69 2.0 70 2.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.5 87 1.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 1.0 99 1.0 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.41121237227286 82.75 2 7.263186964926815 13.15 3 1.0494338580502625 2.85 4 0.13808340237503453 0.5 5 0.08285004142502071 0.375 6 0.027616680475006903 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027616680475006903 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 6 0.15 No Hit GAAAAACAAAATATACAAGAGAGAACACGATGGCTCAAACCATGGTGCTC 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.7374999999999998 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.9000000000000004 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.2875 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 5.1125 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 5.8625 0.0 0.0 0.0 0.0 136-137 6.475 0.0 0.0 0.0 0.0 138-139 7.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTACC 10 0.006830828 145.0 6 >>END_MODULE Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690768 spots for SRR12690174.sra Written 690768 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra Read 690764 spots for SRR12690174.sra Written 690764 spots for SRR12690174.sra SRR ids: ['SRR12690174.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4xcylp1y SRR12690174.sra spots: 13815284 blocks: [[1, 690764], [690765, 1381528], [1381529, 2072292], [2072293, 2763056], [2763057, 3453820], [3453821, 4144584], [4144585, 4835348], [4835349, 5526112], [5526113, 6216876], [6216877, 6907640], [6907641, 7598404], [7598405, 8289168], [8289169, 8979932], [8979933, 9670696], [9670697, 10361460], [10361461, 11052224], [11052225, 11742988], [11742989, 12433752], [12433753, 13124516], [13124517, 13815284]] SRR12690174 file size 4673337 SRR12690174 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690174 SRR12690174_1.fastq SRR12690174_2.fastq Input file: SRR12690174_1.fastq Paired file: SRR12690174_2.fastq trimmed: SRR12690174-trimmed-pair1.fastq, SRR12690174-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:55:51 2025 >> started Mon Feb 10 21:56:07 2025 >> done (15.854s) 13815284 read pairs processed; of these: 39 ( 0.00%) short read pairs filtered out after trimming by size control 30960 ( 0.22%) empty read pairs filtered out after trimming by size control 13784285 (99.78%) read pairs available; of these: 1471736 (10.68%) trimmed read pairs available after processing 12312549 (89.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 5 0.00% 21 9 0.00% 22 12 0.00% 23 9 0.00% 24 12 0.00% 25 15 0.00% 26 22 0.00% 27 22 0.00% 28 18 0.00% 29 29 0.00% 30 18 0.00% 31 22 0.00% 32 21 0.00% 33 31 0.00% 34 16 0.00% 35 21 0.00% 36 21 0.00% 37 24 0.00% 38 24 0.00% 39 23 0.00% 40 20 0.00% 41 27 0.00% 42 31 0.00% 43 26 0.00% 44 45 0.00% 45 26 0.00% 46 33 0.00% 47 30 0.00% 48 40 0.00% 49 50 0.00% 50 61 0.00% 51 77 0.00% 52 78 0.00% 53 79 0.00% 54 59 0.00% 55 84 0.00% 56 93 0.00% 57 116 0.00% 58 117 0.00% 59 137 0.00% 60 167 0.00% 61 189 0.00% 62 203 0.00% 63 248 0.00% 64 224 0.00% 65 285 0.00% 66 296 0.00% 67 346 0.00% 68 347 0.00% 69 397 0.00% 70 480 0.00% 71 523 0.00% 72 637 0.00% 73 708 0.01% 74 764 0.01% 75 858 0.01% 76 955 0.01% 77 979 0.01% 78 1167 0.01% 79 1353 0.01% 80 1537 0.01% 81 1651 0.01% 82 1882 0.01% 83 2131 0.02% 84 2312 0.02% 85 2610 0.02% 86 2773 0.02% 87 3144 0.02% 88 3224 0.02% 89 3583 0.03% 90 3944 0.03% 91 4356 0.03% 92 4701 0.03% 93 5141 0.04% 94 5512 0.04% 95 6228 0.05% 96 6560 0.05% 97 6920 0.05% 98 7221 0.05% 99 7761 0.06% 100 8413 0.06% 101 8683 0.06% 102 9352 0.07% 103 10034 0.07% 104 10572 0.08% 105 11030 0.08% 106 11997 0.09% 107 12374 0.09% 108 13033 0.09% 109 13606 0.10% 110 14135 0.10% 111 14686 0.11% 112 15477 0.11% 113 16123 0.12% 114 17134 0.12% 115 17712 0.13% 116 18527 0.13% 117 19325 0.14% 118 19886 0.14% 119 20569 0.15% 120 21697 0.16% 121 22267 0.16% 122 23106 0.17% 123 24425 0.18% 124 24723 0.18% 125 26111 0.19% 126 26604 0.19% 127 27982 0.20% 128 28441 0.21% 129 29683 0.22% 130 30765 0.22% 131 31186 0.23% 132 32642 0.24% 133 33226 0.24% 134 34035 0.25% 135 34808 0.25% 136 36077 0.26% 137 36419 0.26% 138 37385 0.27% 139 38899 0.28% 140 39533 0.29% 141 40418 0.29% 142 42228 0.31% 143 42431 0.31% 144 44189 0.32% 145 45122 0.33% 146 46005 0.33% 147 46836 0.34% 148 48060 0.35% 149 47813 0.35% 150 50028 0.36% 151 12312549 89.32% 13784285 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=12 prefix-density=0.92 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=12.76 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=4.0 sequence=GAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTAAACGATGTGCTGACCATGGCGCTGGAGAGGGCTGCTGTGGTGGCCATTCTCT criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=25 prefix-density=1.11 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=75.08 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=7.2 sequence=AGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTCGCCGGGTGCCAGTGACAAGCCTACGGGCACTTCCCAACGTGGGGGAGTCTCTTCTTGGCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCA SRR12690174 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:56:51 Started mapping on | Feb 10 21:56:51 Finished on | Feb 10 21:58:30 Mapping speed, Million of reads per hour | 501.25 Number of input reads | 13784285 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13029089 Uniquely mapped reads % | 94.52% Average mapped length | 296.36 Number of splices: Total | 13113984 Number of splices: Annotated (sjdb) | 12869473 Number of splices: GT/AG | 12863092 Number of splices: GC/AG | 206259 Number of splices: AT/AC | 8653 Number of splices: Non-canonical | 35980 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 402163 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 80682 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.80% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 353033 353033 353033 N_multimapping 402163 402163 402163 N_noFeature 382267 12877973 423928 N_ambiguous 198205 628 88416 UnstrandedReadsAssigned:12448617 PositiveStrandReadsAssigned:150488 NegativeStrandReadsAssigned:12516745 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690174 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690174-trimmed-pair1.fastq SRR12690174-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,784,285 reads, 12,641,976 reads pseudoaligned [quant] estimated average fragment length: 236.031 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR12690174.ke.tsv 34699 SRR12690174.se.tsv 87100 total ==> SRR12690174.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.97 417 15.3394 Potri.005G024800.1.v4.1 1035 799.969 242 19.8407 Potri.004G059700.1.v4.1 961 725.986 44 3.97502 Potri.007G009000.2.v4.1 1416 1180.97 0 0 Potri.003G141000.2.v4.1 2943 2707.97 574 13.9022 Potri.016G087400.1.v4.1 270 81.0632 613 495.966 Potri.015G069301.1.v4.1 564 333.145 0 0 Potri.010G195200.1.v4.1 1773 1537.97 18 0.767609 Potri.012G127500.1.v4.1 977 741.969 321 28.3749 ==> SRR12690174.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 264 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 171 Potri.001G212900.v4.1 79 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR12690174 completed mapping pipeline successfully