Starting /dee2/code/volunteer_pipeline.sh SRR12690175 current disk space = 3057040314368 free memory = 1578274104 SRR12690175 SRAfilesize c1a48f6750c73ec42d5faac5b7162196 SRR12690175.sra SRR12690175.sra file validated SRR12690175 is paired end SRR12690175 is conventional basespace SRR12690175 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690175_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.604 37.0 37.0 37.0 37.0 37.0 2 36.35425 37.0 37.0 37.0 37.0 37.0 3 36.5975 37.0 37.0 37.0 37.0 37.0 4 36.562 37.0 37.0 37.0 37.0 37.0 5 36.6325 37.0 37.0 37.0 37.0 37.0 6 36.6185 37.0 37.0 37.0 37.0 37.0 7 36.4985 37.0 37.0 37.0 37.0 37.0 8 36.566 37.0 37.0 37.0 37.0 37.0 9 36.584 37.0 37.0 37.0 37.0 37.0 10-14 36.58389999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.607000000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.5903 37.0 37.0 37.0 37.0 37.0 25-29 36.518100000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4547 37.0 37.0 37.0 37.0 37.0 35-39 36.4812 37.0 37.0 37.0 37.0 37.0 40-44 36.47279999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.449299999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.3953 37.0 37.0 37.0 37.0 37.0 55-59 36.349 37.0 37.0 37.0 37.0 37.0 60-64 36.3959 37.0 37.0 37.0 37.0 37.0 65-69 36.3485 37.0 37.0 37.0 37.0 37.0 70-74 36.3173 37.0 37.0 37.0 37.0 37.0 75-79 36.342400000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2164 37.0 37.0 37.0 37.0 37.0 85-89 36.258 37.0 37.0 37.0 37.0 37.0 90-94 36.2459 37.0 37.0 37.0 37.0 37.0 95-99 36.220299999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.124199999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.162800000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1123 37.0 37.0 37.0 37.0 37.0 115-119 36.095800000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0108 37.0 37.0 37.0 37.0 37.0 125-129 36.032300000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.9739 37.0 37.0 37.0 37.0 37.0 135-139 36.002700000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.8264 37.0 37.0 37.0 37.0 37.0 145-149 35.7608 37.0 37.0 37.0 37.0 37.0 150-151 35.58625 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 0.0 25 4.0 26 5.0 27 5.0 28 15.0 29 12.0 30 27.0 31 37.0 32 39.0 33 70.0 34 120.0 35 280.0 36 3028.0 37 354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.575 11.924999999999999 7.775 37.724999999999994 2 20.050188205771644 13.199498117942285 34.27854454203263 32.47176913425346 3 18.125 15.775 28.775000000000002 37.325 4 21.224999999999998 23.150000000000002 25.650000000000002 29.975 5 23.75 28.075 25.650000000000002 22.525000000000002 6 23.025000000000002 31.6 23.95 21.425 7 16.6 25.8 39.975 17.625 8 18.275 27.325 31.275 23.125 9 18.3 23.175 34.9 23.625 10-14 20.19 28.560000000000002 28.1 23.150000000000002 15-19 20.505000000000003 27.37 27.715 24.41 20-24 20.34 27.435 28.17 24.055 25-29 20.345 27.900000000000002 28.065 23.69 30-34 20.025000000000002 28.435 27.529999999999998 24.01 35-39 20.65 27.825 27.115000000000002 24.41 40-44 19.950000000000003 28.005000000000003 27.744999999999997 24.3 45-49 20.955 28.139999999999997 27.229999999999997 23.674999999999997 50-54 20.32 27.894999999999996 27.575 24.21 55-59 20.715 27.575 27.845 23.865 60-64 20.57 28.15 27.49 23.79 65-69 20.630000000000003 27.68 27.96 23.73 70-74 21.115000000000002 27.145000000000003 27.955000000000002 23.785 75-79 20.72 28.110000000000003 27.685 23.485 80-84 20.985 27.98 26.66 24.375 85-89 21.154999999999998 28.27 27.334999999999997 23.24 90-94 21.790000000000003 26.974999999999998 27.58 23.655 95-99 20.599999999999998 27.79 28.23 23.380000000000003 100-104 21.295 27.61 27.68 23.415 105-109 21.02 27.41 27.465 24.104999999999997 110-114 20.815 27.55 27.765 23.87 115-119 20.95 28.325 27.134999999999998 23.59 120-124 20.745 27.655 27.500000000000004 24.099999999999998 125-129 20.74 27.900000000000002 27.305 24.055 130-134 20.875 27.57 27.01 24.545 135-139 21.349999999999998 28.185 26.650000000000002 23.815 140-144 21.495 27.435 27.474999999999998 23.595 145-149 21.665 27.169999999999998 27.095000000000002 24.07 150-151 21.3625 28.0875 26.6 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 3.5 24 3.0 25 2.0 26 3.0 27 6.5 28 10.0 29 10.0 30 11.5 31 14.5 32 21.0 33 35.0 34 43.0 35 59.0 36 80.0 37 94.5 38 116.5 39 138.0 40 166.5 41 201.0 42 226.0 43 244.0 44 258.5 45 270.5 46 272.0 47 256.5 48 232.0 49 204.0 50 189.5 51 171.0 52 126.5 53 104.0 54 102.0 55 81.5 56 65.5 57 51.0 58 35.0 59 28.0 60 16.0 61 11.0 62 12.5 63 9.5 64 5.0 65 2.0 66 1.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.5775075987842 81.95 2 8.317214700193423 15.049999999999999 3 1.1052777010223818 3.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.7250000000000001 0.0 0.0 0.0 0.0 100-101 0.8374999999999999 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.8625 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.35 0.0 0.0 0.0 0.0 120-121 2.6500000000000004 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.225 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 4.075 0.0 0.0 0.0 0.0 130-131 4.425 0.0 0.0 0.0 0.0 132-133 4.75 0.0 0.0 0.0 0.0 134-135 5.262499999999999 0.0 0.0 0.0 0.0 136-137 5.8125 0.0 0.0 0.0 0.0 138-139 6.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGGA 10 0.006830828 145.0 9 GCACAGA 10 0.006830828 145.0 1 >>END_MODULE SRR12690175 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690175_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2335 37.0 37.0 37.0 37.0 37.0 2 36.076 37.0 37.0 37.0 37.0 37.0 3 36.1915 37.0 37.0 37.0 37.0 37.0 4 36.1255 37.0 37.0 37.0 37.0 37.0 5 36.2235 37.0 37.0 37.0 37.0 37.0 6 36.2015 37.0 37.0 37.0 37.0 37.0 7 36.163 37.0 37.0 37.0 37.0 37.0 8 36.255 37.0 37.0 37.0 37.0 37.0 9 36.292 37.0 37.0 37.0 37.0 37.0 10-14 36.229699999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.208099999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.2054 37.0 37.0 37.0 37.0 37.0 25-29 36.1032 37.0 37.0 37.0 37.0 37.0 30-34 36.1923 37.0 37.0 37.0 37.0 37.0 35-39 36.1514 37.0 37.0 37.0 37.0 37.0 40-44 36.0849 37.0 37.0 37.0 37.0 37.0 45-49 36.0828 37.0 37.0 37.0 37.0 37.0 50-54 36.027499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.010200000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.974399999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.9351 37.0 37.0 37.0 37.0 37.0 70-74 35.8692 37.0 37.0 37.0 37.0 37.0 75-79 35.912400000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.902100000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.9279 37.0 37.0 37.0 37.0 37.0 90-94 35.7937 37.0 37.0 37.0 37.0 37.0 95-99 35.8892 37.0 37.0 37.0 37.0 37.0 100-104 35.8205 37.0 37.0 37.0 37.0 37.0 105-109 35.8155 37.0 37.0 37.0 37.0 37.0 110-114 35.7252 37.0 37.0 37.0 37.0 37.0 115-119 35.7137 37.0 37.0 37.0 37.0 37.0 120-124 35.631099999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.5406 37.0 37.0 37.0 37.0 37.0 130-134 35.4572 37.0 37.0 37.0 37.0 37.0 135-139 35.42810000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.472 37.0 37.0 37.0 37.0 37.0 145-149 35.2771 37.0 37.0 37.0 29.8 37.0 150-151 34.86975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 3.0 15 2.0 16 0.0 17 1.0 18 1.0 19 1.0 20 0.0 21 2.0 22 7.0 23 7.0 24 6.0 25 6.0 26 10.0 27 15.0 28 13.0 29 26.0 30 29.0 31 39.0 32 56.0 33 102.0 34 191.0 35 534.0 36 2658.0 37 286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.1 25.4 10.025 26.474999999999998 2 28.025 26.825 27.474999999999998 17.675 3 20.05 27.575 31.6 20.775 4 23.974999999999998 34.525 22.650000000000002 18.85 5 24.5 36.35 21.675 17.474999999999998 6 20.674999999999997 39.85 21.675 17.8 7 21.2 23.575 36.775000000000006 18.45 8 20.325 26.6 27.400000000000002 25.674999999999997 9 22.275 24.45 30.3 22.975 10-14 23.5 30.014999999999997 25.380000000000003 21.105 15-19 23.244999999999997 28.720000000000002 27.08 20.955 20-24 23.26 28.694999999999997 26.715 21.33 25-29 22.99 28.87 27.395000000000003 20.745 30-34 22.98 28.075 27.42 21.525 35-39 23.135 27.955000000000002 27.650000000000002 21.26 40-44 22.535 28.57 27.365000000000002 21.529999999999998 45-49 22.439999999999998 28.02 27.73 21.81 50-54 22.900000000000002 27.665 27.22 22.215 55-59 23.56 27.165 27.675 21.6 60-64 23.265 28.075 27.07 21.59 65-69 23.875 27.57 27.12 21.435000000000002 70-74 23.355 27.49 26.884999999999998 22.27 75-79 23.285 27.650000000000002 26.855 22.21 80-84 23.380000000000003 27.83 26.905 21.884999999999998 85-89 23.32 27.52 27.075 22.085 90-94 23.365 28.294999999999998 26.765 21.575 95-99 23.369999999999997 28.410000000000004 26.345000000000002 21.875 100-104 23.61 27.91 26.939999999999998 21.54 105-109 23.82 27.279999999999998 27.875 21.025 110-114 23.805 28.425 27.22 20.549999999999997 115-119 24.099999999999998 27.875 26.85 21.175 120-124 23.98 28.29 26.77 20.96 125-129 24.310000000000002 27.650000000000002 27.12 20.919999999999998 130-134 24.47 27.615000000000002 27.389999999999997 20.525 135-139 25.185000000000002 27.555000000000003 26.91 20.349999999999998 140-144 25.180000000000003 27.839999999999996 26.465 20.515 145-149 25.69 27.165 26.905 20.24 150-151 26.637499999999996 27.6875 25.924999999999997 19.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 1.0 18 2.0 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.5 25 3.0 26 2.0 27 3.0 28 5.0 29 7.5 30 9.5 31 20.0 32 26.0 33 24.5 34 34.5 35 56.0 36 78.0 37 103.5 38 122.5 39 142.0 40 199.0 41 228.5 42 229.5 43 252.0 44 262.5 45 267.5 46 268.5 47 244.0 48 220.0 49 206.5 50 184.0 51 154.5 52 125.5 53 107.0 54 94.5 55 76.0 56 54.5 57 40.5 58 28.5 59 22.0 60 22.5 61 16.0 62 11.0 63 9.5 64 7.0 65 3.0 66 2.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.79856313898867 82.15 2 7.930367504835589 14.35 3 1.21580547112462 3.3000000000000003 4 0.055263885051119094 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.11249999999999999 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 1.4500000000000002 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.7375 0.0 0.0 0.0 0.0 122-123 3.0250000000000004 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.725 0.0 0.0 0.0 0.0 128-129 4.2 0.0 0.0 0.0 0.0 130-131 4.575 0.0 0.0 0.0 0.0 132-133 4.949999999999999 0.0 0.0 0.0 0.0 134-135 5.4625 0.0 0.0 0.0 0.0 136-137 5.9875 0.0 0.0 0.0 0.0 138-139 6.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGCAA 10 0.006830828 145.0 5 >>END_MODULE Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721556 spots for SRR12690175.sra Written 721556 spots for SRR12690175.sra Read 721569 spots for SRR12690175.sra Written 721569 spots for SRR12690175.sra SRR ids: ['SRR12690175.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u5hlzwn9 SRR12690175.sra spots: 14431133 blocks: [[1, 721556], [721557, 1443112], [1443113, 2164668], [2164669, 2886224], [2886225, 3607780], [3607781, 4329336], [4329337, 5050892], [5050893, 5772448], [5772449, 6494004], [6494005, 7215560], [7215561, 7937116], [7937117, 8658672], [8658673, 9380228], [9380229, 10101784], [10101785, 10823340], [10823341, 11544896], [11544897, 12266452], [12266453, 12988008], [12988009, 13709564], [13709565, 14431133]] SRR12690175 file size 4882629 SRR12690175 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690175 SRR12690175_1.fastq SRR12690175_2.fastq Input file: SRR12690175_1.fastq Paired file: SRR12690175_2.fastq trimmed: SRR12690175-trimmed-pair1.fastq, SRR12690175-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:57:48 2025 >> started Mon Feb 10 21:58:11 2025 >> done (22.431s) 14431133 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 4685 ( 0.03%) empty read pairs filtered out after trimming by size control 14426431 (99.97%) read pairs available; of these: 1390681 ( 9.64%) trimmed read pairs available after processing 13035750 (90.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 9 0.00% 23 14 0.00% 24 7 0.00% 25 2 0.00% 26 7 0.00% 27 17 0.00% 28 11 0.00% 29 16 0.00% 30 24 0.00% 31 14 0.00% 32 23 0.00% 33 15 0.00% 34 15 0.00% 35 18 0.00% 36 26 0.00% 37 21 0.00% 38 20 0.00% 39 30 0.00% 40 27 0.00% 41 29 0.00% 42 30 0.00% 43 35 0.00% 44 37 0.00% 45 35 0.00% 46 29 0.00% 47 38 0.00% 48 43 0.00% 49 51 0.00% 50 77 0.00% 51 67 0.00% 52 87 0.00% 53 86 0.00% 54 106 0.00% 55 93 0.00% 56 116 0.00% 57 118 0.00% 58 129 0.00% 59 151 0.00% 60 149 0.00% 61 220 0.00% 62 214 0.00% 63 250 0.00% 64 300 0.00% 65 302 0.00% 66 303 0.00% 67 377 0.00% 68 406 0.00% 69 541 0.00% 70 541 0.00% 71 643 0.00% 72 712 0.00% 73 821 0.01% 74 856 0.01% 75 919 0.01% 76 1090 0.01% 77 1190 0.01% 78 1285 0.01% 79 1486 0.01% 80 1675 0.01% 81 1827 0.01% 82 1972 0.01% 83 2219 0.02% 84 2489 0.02% 85 2731 0.02% 86 3019 0.02% 87 3283 0.02% 88 3485 0.02% 89 3838 0.03% 90 4198 0.03% 91 4426 0.03% 92 4935 0.03% 93 5258 0.04% 94 5855 0.04% 95 6128 0.04% 96 6292 0.04% 97 6924 0.05% 98 7425 0.05% 99 7798 0.05% 100 8154 0.06% 101 8620 0.06% 102 9220 0.06% 103 9892 0.07% 104 10291 0.07% 105 10950 0.08% 106 11257 0.08% 107 12029 0.08% 108 12493 0.09% 109 13292 0.09% 110 13664 0.09% 111 14268 0.10% 112 14842 0.10% 113 15390 0.11% 114 16208 0.11% 115 16849 0.12% 116 17662 0.12% 117 18435 0.13% 118 19018 0.13% 119 19546 0.14% 120 20546 0.14% 121 21352 0.15% 122 21904 0.15% 123 23043 0.16% 124 23723 0.16% 125 23976 0.17% 126 25363 0.18% 127 26106 0.18% 128 26759 0.19% 129 27103 0.19% 130 28180 0.20% 131 29220 0.20% 132 29642 0.21% 133 30867 0.21% 134 31631 0.22% 135 32590 0.23% 136 33427 0.23% 137 34063 0.24% 138 35152 0.24% 139 36516 0.25% 140 36624 0.25% 141 38066 0.26% 142 38886 0.27% 143 40019 0.28% 144 41134 0.29% 145 42215 0.29% 146 42718 0.30% 147 43112 0.30% 148 43855 0.30% 149 44935 0.31% 150 45807 0.32% 151 13035750 90.36% 14426431 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=21 prefix-density=0.60 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=10.30 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=3.1 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=24 prefix-density=0.80 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=71.27 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.2 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12690175 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:58:53 Started mapping on | Feb 10 21:58:53 Finished on | Feb 10 22:00:37 Mapping speed, Million of reads per hour | 499.38 Number of input reads | 14426431 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13383117 Uniquely mapped reads % | 92.77% Average mapped length | 296.69 Number of splices: Total | 13794066 Number of splices: Annotated (sjdb) | 13518338 Number of splices: GT/AG | 13520079 Number of splices: GC/AG | 225745 Number of splices: AT/AC | 8520 Number of splices: Non-canonical | 39722 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 325204 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 156065 % of reads mapped to too many loci | 1.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718110 718110 718110 N_multimapping 325204 325204 325204 N_noFeature 500302 13200881 549722 N_ambiguous 217298 862 83950 UnstrandedReadsAssigned:12665517 PositiveStrandReadsAssigned:181374 NegativeStrandReadsAssigned:12749445 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690175 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690175-trimmed-pair1.fastq SRR12690175-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,426,431 reads, 12,841,021 reads pseudoaligned [quant] estimated average fragment length: 252.766 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR12690175.ke.tsv 34699 SRR12690175.se.tsv 87100 total ==> SRR12690175.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.23 438 16.4919 Potri.005G024800.1.v4.1 1035 783.234 363 30.822 Potri.004G059700.1.v4.1 961 709.337 4 0.375018 Potri.007G009000.2.v4.1 1416 1164.23 0 0 Potri.003G141000.2.v4.1 2943 2691.23 742 18.3357 Potri.016G087400.1.v4.1 270 81.0667 515 422.484 Potri.015G069301.1.v4.1 564 324.568 0 0 Potri.010G195200.1.v4.1 1773 1521.23 17 0.743187 Potri.012G127500.1.v4.1 977 725.292 35 3.20923 ==> SRR12690175.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 171 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 158 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12690175 completed mapping pipeline successfully