Starting /dee2/code/volunteer_pipeline.sh SRR12690176 current disk space = 3056850673664 free memory = 1121396020 SRR12690176 SRAfilesize 3afc5d7a828f771d6ee03b08d58e11fd SRR12690176.sra SRR12690176.sra file validated SRR12690176 is paired end SRR12690176 is conventional basespace SRR12690176 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690176_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.644 37.0 37.0 37.0 37.0 37.0 2 36.4815 37.0 37.0 37.0 37.0 37.0 3 36.679 37.0 37.0 37.0 37.0 37.0 4 36.616 37.0 37.0 37.0 37.0 37.0 5 36.6815 37.0 37.0 37.0 37.0 37.0 6 36.6635 37.0 37.0 37.0 37.0 37.0 7 36.597 37.0 37.0 37.0 37.0 37.0 8 36.6685 37.0 37.0 37.0 37.0 37.0 9 36.615 37.0 37.0 37.0 37.0 37.0 10-14 36.633700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.6291 37.0 37.0 37.0 37.0 37.0 20-24 36.605399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5457 37.0 37.0 37.0 37.0 37.0 30-34 36.5166 37.0 37.0 37.0 37.0 37.0 35-39 36.48629999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.450700000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.869200000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.2656 37.0 37.0 37.0 37.0 37.0 55-59 35.6772 37.0 37.0 37.0 37.0 37.0 60-64 35.5709 37.0 37.0 37.0 37.0 37.0 65-69 35.3355 37.0 37.0 37.0 37.0 37.0 70-74 35.681799999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.3053 37.0 37.0 37.0 37.0 37.0 80-84 36.263 37.0 37.0 37.0 37.0 37.0 85-89 36.324799999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2718 37.0 37.0 37.0 37.0 37.0 95-99 36.2136 37.0 37.0 37.0 37.0 37.0 100-104 36.1894 37.0 37.0 37.0 37.0 37.0 105-109 36.2025 37.0 37.0 37.0 37.0 37.0 110-114 36.1764 37.0 37.0 37.0 37.0 37.0 115-119 36.136700000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0955 37.0 37.0 37.0 37.0 37.0 125-129 36.05970000000001 37.0 37.0 37.0 37.0 37.0 130-134 36.061899999999994 37.0 37.0 37.0 37.0 37.0 135-139 36.0221 37.0 37.0 37.0 37.0 37.0 140-144 35.8538 37.0 37.0 37.0 37.0 37.0 145-149 35.843 37.0 37.0 37.0 37.0 37.0 150-151 35.63275 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.0 25 2.0 26 5.0 27 8.0 28 11.0 29 16.0 30 27.0 31 31.0 32 42.0 33 117.0 34 257.0 35 260.0 36 2862.0 37 357.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.199999999999996 10.875 8.35 38.574999999999996 2 19.04164576016056 17.13497240341194 33.416959357752134 30.406422478675367 3 16.950000000000003 15.425 31.3 36.325 4 20.525 23.200000000000003 23.775 32.5 5 27.200000000000003 29.099999999999998 23.825 19.875 6 24.75 33.15 22.125 19.975 7 15.174999999999999 29.15 38.475 17.2 8 16.85 30.225 30.975 21.95 9 21.825 23.75 33.625 20.8 10-14 20.105 29.34 26.450000000000003 24.104999999999997 15-19 19.915 27.57 27.295 25.22 20-24 20.02 29.42 26.91 23.65 25-29 20.09 27.87 27.435 24.605 30-34 19.34 27.47 27.22 25.97 35-39 20.075000000000003 27.655 27.405 24.865000000000002 40-44 19.57 27.72 29.12 23.59 45-49 20.645 27.82 28.535 23.0 50-54 21.525 26.424999999999997 27.77 24.279999999999998 55-59 19.55 26.21 29.695 24.545 60-64 20.805 26.619999999999997 28.744999999999997 23.830000000000002 65-69 20.915 30.025000000000002 26.424999999999997 22.634999999999998 70-74 25.430000000000003 26.905 25.655 22.009999999999998 75-79 24.82 26.555 26.155 22.470000000000002 80-84 25.365 26.545 26.27 21.82 85-89 24.605 26.919999999999998 26.015 22.46 90-94 24.65 26.63 25.935000000000002 22.785 95-99 24.765 26.6 26.35 22.285 100-104 25.224999999999998 26.21 26.040000000000003 22.525000000000002 105-109 25.490000000000002 26.224999999999998 25.91 22.375 110-114 25.34 26.950000000000003 26.195 21.515 115-119 25.3 27.250000000000004 25.03 22.42 120-124 24.845 27.68 25.374999999999996 22.1 125-129 24.82 26.795 25.590000000000003 22.795 130-134 25.759999999999998 26.085 25.4 22.755 135-139 24.98 25.825 25.8 23.395 140-144 24.87 26.19 25.86 23.080000000000002 145-149 24.990000000000002 25.729999999999997 26.075 23.205000000000002 150-151 25.3 26.687499999999996 25.337500000000002 22.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 1.5 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 2.5 26 2.5 27 4.0 28 7.0 29 7.5 30 10.0 31 15.0 32 24.5 33 34.0 34 46.0 35 75.5 36 89.0 37 94.5 38 124.0 39 149.0 40 177.5 41 199.0 42 212.5 43 228.5 44 237.0 45 238.0 46 254.5 47 259.5 48 226.0 49 205.0 50 172.5 51 130.5 52 113.0 53 99.0 54 79.5 55 64.0 56 56.5 57 39.0 58 27.5 59 23.0 60 15.5 61 11.5 62 6.0 63 5.0 64 6.5 65 32.5 66 63.5 67 58.5 68 36.5 69 16.0 70 4.5 71 3.5 72 1.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.95 #Duplication Level Percentage of deduplicated Percentage of total 1 90.92495636998254 78.14999999999999 2 7.678883071553229 13.200000000000001 3 1.0471204188481675 2.7 4 0.29086678301337987 1.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.029086678301337987 1.4500000000000002 >100 0.029086678301337987 3.5000000000000004 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTCAGTTATCTCGTAT 140 3.5000000000000004 TruSeq Adapter, Index 23 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTCAGTTATCGCGTAT 58 1.4500000000000002 TruSeq Adapter, Index 23 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.2125 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.7125 0.0 0.0 0.0 0.0 98-99 2.05 0.0 0.0 0.0 0.0 100-101 2.3625 0.0 0.0 0.0 0.0 102-103 2.575 0.0 0.0 0.0 0.0 104-105 2.9 0.0 0.0 0.0 0.0 106-107 3.4375 0.0 0.0 0.0 0.0 108-109 4.075 0.0 0.0 0.0 0.0 110-111 4.4625 0.0 0.0 0.0 0.0 112-113 4.949999999999999 0.0 0.0 0.0 0.0 114-115 5.4375 0.0 0.0 0.0 0.0 116-117 6.15 0.0 0.0 0.0 0.0 118-119 6.9125 0.0 0.0 0.0 0.0 120-121 7.6625 0.0 0.0 0.0 0.0 122-123 8.175 0.0 0.0 0.0 0.0 124-125 8.6375 0.0 0.0 0.0 0.0 126-127 9.3875 0.0 0.0 0.0 0.0 128-129 10.05 0.0 0.0 0.0 0.0 130-131 10.7 0.0 0.0 0.0 0.0 132-133 11.25 0.0 0.0 0.0 0.0 134-135 11.9 0.0 0.0 0.0 0.0 136-137 12.625 0.0 0.0 0.0 0.0 138-139 13.162500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 65 6.491996E-4 44.615383 6 AAGAGCA 70 9.353284E-4 41.428574 7 GATCGGA 70 9.353284E-4 41.428574 1 TCGGAAG 70 9.353284E-4 41.428574 3 GAGCACA 70 9.353284E-4 41.428574 9 CGGAAGA 70 9.353284E-4 41.428574 4 AGAGCAC 70 9.353284E-4 41.428574 8 ATCGGAA 75 0.0013135396 38.666668 2 GGAAGAG 80 0.0018040554 36.25 5 >>END_MODULE SRR12690176 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690176_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2505 37.0 37.0 37.0 37.0 37.0 2 36.015 37.0 37.0 37.0 37.0 37.0 3 35.9765 37.0 37.0 37.0 37.0 37.0 4 36.0565 37.0 37.0 37.0 37.0 37.0 5 36.157 37.0 37.0 37.0 37.0 37.0 6 36.1155 37.0 37.0 37.0 37.0 37.0 7 35.859 37.0 37.0 37.0 37.0 37.0 8 35.5975 37.0 37.0 37.0 37.0 37.0 9 35.7855 37.0 37.0 37.0 37.0 37.0 10-14 35.615300000000005 37.0 37.0 37.0 37.0 37.0 15-19 35.5892 37.0 37.0 37.0 37.0 37.0 20-24 35.504099999999994 37.0 37.0 37.0 37.0 37.0 25-29 34.99640000000001 37.0 37.0 37.0 37.0 37.0 30-34 34.9251 37.0 37.0 37.0 29.8 37.0 35-39 34.8206 37.0 37.0 37.0 27.4 37.0 40-44 34.8538 37.0 37.0 37.0 29.8 37.0 45-49 34.8663 37.0 37.0 37.0 25.0 37.0 50-54 34.78959999999999 37.0 37.0 37.0 25.0 37.0 55-59 34.898399999999995 37.0 37.0 37.0 27.4 37.0 60-64 35.0256 37.0 37.0 37.0 27.4 37.0 65-69 34.844300000000004 37.0 37.0 37.0 25.0 37.0 70-74 34.6284 37.0 37.0 37.0 25.0 37.0 75-79 34.7168 37.0 37.0 37.0 25.0 37.0 80-84 34.7371 37.0 37.0 37.0 25.0 37.0 85-89 35.064 37.0 37.0 37.0 29.8 37.0 90-94 35.319500000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.5637 37.0 37.0 37.0 37.0 37.0 100-104 35.679100000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.6014 37.0 37.0 37.0 37.0 37.0 110-114 35.58140000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.6043 37.0 37.0 37.0 37.0 37.0 120-124 35.5248 37.0 37.0 37.0 37.0 37.0 125-129 35.511700000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.398900000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.2933 37.0 37.0 37.0 32.2 37.0 140-144 35.0441 37.0 37.0 37.0 27.4 37.0 145-149 34.919799999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.451750000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 4.0 13 5.0 14 8.0 15 2.0 16 7.0 17 4.0 18 9.0 19 10.0 20 7.0 21 12.0 22 11.0 23 17.0 24 32.0 25 37.0 26 55.0 27 32.0 28 33.0 29 19.0 30 27.0 31 40.0 32 63.0 33 101.0 34 180.0 35 570.0 36 2488.0 37 226.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.349999999999994 21.175 11.025 26.450000000000003 2 32.0 25.8 27.125 15.075 3 26.174999999999997 26.6 28.799999999999997 18.425 4 27.650000000000002 32.45 21.7 18.2 5 28.625 34.925 20.175 16.275000000000002 6 24.9 37.95 20.95 16.2 7 24.75 21.275 34.925 19.05 8 25.85 24.575 26.924999999999997 22.650000000000002 9 25.45 23.200000000000003 28.525 22.825 10-14 27.310000000000002 27.985 24.805 19.900000000000002 15-19 26.645000000000003 26.729999999999997 26.669999999999998 19.955000000000002 20-24 27.38 27.055 25.72 19.845 25-29 27.139999999999997 27.37 26.145000000000003 19.345000000000002 30-34 26.395000000000003 27.310000000000002 26.43 19.865 35-39 25.805 27.07 27.1 20.025000000000002 40-44 25.46 27.245 27.334999999999997 19.96 45-49 25.505 26.27 28.26 19.965 50-54 26.295 26.61 27.565 19.53 55-59 26.419999999999998 26.375 27.01 20.195 60-64 27.515 26.215 26.565 19.705000000000002 65-69 27.495000000000005 26.474999999999998 26.02 20.01 70-74 26.345000000000002 27.82 26.590000000000003 19.245 75-79 25.045 26.924999999999997 27.79 20.24 80-84 26.02 27.165 27.36 19.455 85-89 27.1 26.35 26.26 20.29 90-94 27.655 26.755000000000003 25.775 19.814999999999998 95-99 28.17 26.775 25.435000000000002 19.62 100-104 28.560000000000002 26.534999999999997 25.585 19.32 105-109 28.49 26.284999999999997 25.695 19.53 110-114 28.754999999999995 26.8 25.885 18.56 115-119 28.655 26.655 25.745 18.945 120-124 29.134999999999998 25.979999999999997 25.540000000000003 19.345000000000002 125-129 29.645 26.36 24.48 19.515 130-134 29.7 25.019999999999996 25.95 19.33 135-139 29.630000000000003 26.26 25.245 18.865000000000002 140-144 30.455 25.695 25.174999999999997 18.675 145-149 31.014999999999997 25.695 25.369999999999997 17.919999999999998 150-151 31.4625 24.762500000000003 25.624999999999996 18.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.0 25 1.5 26 2.0 27 3.0 28 7.5 29 14.5 30 15.0 31 21.0 32 32.5 33 35.5 34 53.0 35 70.5 36 75.5 37 89.5 38 125.5 39 156.5 40 184.5 41 218.0 42 242.0 43 250.5 44 238.0 45 250.0 46 247.5 47 227.0 48 224.5 49 204.5 50 155.0 51 123.5 52 112.5 53 96.5 54 76.0 55 45.5 56 35.5 57 33.5 58 26.0 59 19.0 60 14.0 61 14.0 62 12.5 63 8.0 64 3.5 65 3.0 66 3.5 67 4.0 68 3.5 69 3.0 70 3.0 71 3.5 72 2.5 73 0.5 74 1.5 75 1.5 76 0.5 77 1.5 78 3.0 79 3.0 80 3.0 81 3.5 82 4.0 83 3.5 84 1.0 85 1.0 86 3.0 87 3.0 88 1.5 89 4.0 90 6.0 91 6.5 92 8.5 93 9.5 94 8.5 95 11.0 96 14.0 97 16.0 98 21.0 99 20.0 100 20.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.36871508379888 81.77499999999999 2 7.067039106145251 12.65 3 1.0893854748603353 2.9250000000000003 4 0.36312849162011174 1.3 5 0.055865921787709494 0.25 6 0.027932960893854747 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027932960893854747 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 38 0.95 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGGGGG 6 0.15 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.5625 0.0 0.0 0.0 0.0 96-97 1.8375 0.0 0.0 0.0 0.0 98-99 2.1875 0.0 0.0 0.0 0.0 100-101 2.5125 0.0 0.0 0.0 0.0 102-103 2.7249999999999996 0.0 0.0 0.0 0.0 104-105 3.05 0.0 0.0 0.0 0.0 106-107 3.5875000000000004 0.0 0.0 0.0 0.0 108-109 4.225 0.0 0.0 0.0 0.0 110-111 4.6125 0.0 0.0 0.0 0.0 112-113 5.125 0.0 0.0 0.0 0.0 114-115 5.6125 0.0 0.0 0.0 0.0 116-117 6.325 0.0 0.0 0.0 0.0 118-119 7.0875 0.0 0.0 0.0 0.0 120-121 7.8500000000000005 0.0 0.0 0.0 0.0 122-123 8.412500000000001 0.0 0.0 0.0 0.0 124-125 8.899999999999999 0.0 0.0 0.0 0.0 126-127 9.6625 0.0 0.0 0.0 0.0 128-129 10.3625 0.0 0.0 0.0 0.0 130-131 11.0 0.0 0.0 0.0 0.0 132-133 11.5625 0.0 0.0 0.0 0.0 134-135 12.225 0.0 0.0 0.0 0.0 136-137 12.95 0.0 0.0 0.0 0.0 138-139 13.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615209 spots for SRR12690176.sra Written 615209 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra Read 615190 spots for SRR12690176.sra Written 615190 spots for SRR12690176.sra SRR ids: ['SRR12690176.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y32snznr SRR12690176.sra spots: 12303819 blocks: [[1, 615190], [615191, 1230380], [1230381, 1845570], [1845571, 2460760], [2460761, 3075950], [3075951, 3691140], [3691141, 4306330], [4306331, 4921520], [4921521, 5536710], [5536711, 6151900], [6151901, 6767090], [6767091, 7382280], [7382281, 7997470], [7997471, 8612660], [8612661, 9227850], [9227851, 9843040], [9843041, 10458230], [10458231, 11073420], [11073421, 11688610], [11688611, 12303819]] SRR12690176 file size 4159675 SRR12690176 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690176 SRR12690176_1.fastq SRR12690176_2.fastq Input file: SRR12690176_1.fastq Paired file: SRR12690176_2.fastq trimmed: SRR12690176-trimmed-pair1.fastq, SRR12690176-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:12:30 2025 >> started Mon Feb 10 21:12:44 2025 >> done (13.630s) 12303819 read pairs processed; of these: 343 ( 0.00%) short read pairs filtered out after trimming by size control 575912 ( 4.68%) empty read pairs filtered out after trimming by size control 11727564 (95.32%) read pairs available; of these: 2291894 (19.54%) trimmed read pairs available after processing 9435670 (80.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 3 0.00% 21 6 0.00% 22 8 0.00% 23 8 0.00% 24 6 0.00% 25 14 0.00% 26 12 0.00% 27 13 0.00% 28 8 0.00% 29 16 0.00% 30 16 0.00% 31 13 0.00% 32 17 0.00% 33 26 0.00% 34 22 0.00% 35 33 0.00% 36 22 0.00% 37 32 0.00% 38 36 0.00% 39 34 0.00% 40 37 0.00% 41 47 0.00% 42 45 0.00% 43 65 0.00% 44 67 0.00% 45 83 0.00% 46 76 0.00% 47 97 0.00% 48 113 0.00% 49 110 0.00% 50 135 0.00% 51 155 0.00% 52 182 0.00% 53 197 0.00% 54 200 0.00% 55 216 0.00% 56 258 0.00% 57 268 0.00% 58 311 0.00% 59 408 0.00% 60 478 0.00% 61 549 0.00% 62 571 0.00% 63 685 0.01% 64 785 0.01% 65 755 0.01% 66 893 0.01% 67 982 0.01% 68 1168 0.01% 69 1340 0.01% 70 1441 0.01% 71 1715 0.01% 72 1921 0.02% 73 2107 0.02% 74 2371 0.02% 75 2734 0.02% 76 2906 0.02% 77 3092 0.03% 78 3599 0.03% 79 4023 0.03% 80 4506 0.04% 81 5091 0.04% 82 5538 0.05% 83 6193 0.05% 84 6870 0.06% 85 7513 0.06% 86 8014 0.07% 87 8630 0.07% 88 9231 0.08% 89 10108 0.09% 90 10754 0.09% 91 11750 0.10% 92 12743 0.11% 93 13833 0.12% 94 14779 0.13% 95 15928 0.14% 96 16598 0.14% 97 17531 0.15% 98 18214 0.16% 99 19388 0.17% 100 20055 0.17% 101 20889 0.18% 102 21896 0.19% 103 23448 0.20% 104 24234 0.21% 105 25286 0.22% 106 26538 0.23% 107 27018 0.23% 108 27402 0.23% 109 28354 0.24% 110 29476 0.25% 111 30126 0.26% 112 30983 0.26% 113 31989 0.27% 114 33031 0.28% 115 34073 0.29% 116 34611 0.30% 117 35352 0.30% 118 36216 0.31% 119 36314 0.31% 120 37596 0.32% 121 38060 0.32% 122 39061 0.33% 123 39842 0.34% 124 41341 0.35% 125 41398 0.35% 126 42607 0.36% 127 43097 0.37% 128 43568 0.37% 129 43945 0.37% 130 44522 0.38% 131 44648 0.38% 132 45540 0.39% 133 46748 0.40% 134 46464 0.40% 135 47043 0.40% 136 48166 0.41% 137 48324 0.41% 138 48318 0.41% 139 49924 0.43% 140 49489 0.42% 141 50493 0.43% 142 50730 0.43% 143 51247 0.44% 144 52727 0.45% 145 52532 0.45% 146 53121 0.45% 147 52925 0.45% 148 53468 0.46% 149 52783 0.45% 150 54122 0.46% 151 9435670 80.46% 11727564 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=8 prefix-density=0.51 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=335.62 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=15.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.64 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=28.05 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.2 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR12690176 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:13:27 Started mapping on | Feb 10 21:13:27 Finished on | Feb 10 21:14:38 Mapping speed, Million of reads per hour | 594.64 Number of input reads | 11727564 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 10950969 Uniquely mapped reads % | 93.38% Average mapped length | 290.24 Number of splices: Total | 10483729 Number of splices: Annotated (sjdb) | 10231788 Number of splices: GT/AG | 10274596 Number of splices: GC/AG | 165348 Number of splices: AT/AC | 7498 Number of splices: Non-canonical | 36287 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262138 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 111652 % of reads mapped to too many loci | 0.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 514457 514457 514457 N_multimapping 262138 262138 262138 N_noFeature 457400 10807894 507387 N_ambiguous 154389 685 60899 UnstrandedReadsAssigned:10339180 PositiveStrandReadsAssigned:142390 NegativeStrandReadsAssigned:10382683 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690176 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690176-trimmed-pair1.fastq SRR12690176-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,727,564 reads, 10,485,946 reads pseudoaligned [quant] estimated average fragment length: 220.753 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 940 rounds 52401 SRR12690176.ke.tsv 34699 SRR12690176.se.tsv 87100 total ==> SRR12690176.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.25 245 12.4958 Potri.005G024800.1.v4.1 1035 815.247 69 7.76262 Potri.004G059700.1.v4.1 961 741.287 6 0.742358 Potri.007G009000.2.v4.1 1416 1196.25 0 0 Potri.003G141000.2.v4.1 2943 2723.25 520.155 17.5184 Potri.016G087400.1.v4.1 270 96.0652 492 469.729 Potri.015G069301.1.v4.1 564 350.403 0 0 Potri.010G195200.1.v4.1 1773 1553.25 10 0.590483 Potri.012G127500.1.v4.1 977 757.272 220 26.6452 ==> SRR12690176.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 283 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 157 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12690176 completed mapping pipeline successfully