Starting /dee2/code/volunteer_pipeline.sh SRR12690177 current disk space = 3056925294592 free memory = 1233828224 SRR12690177 SRAfilesize 73ff6683ff6d79760d1cd1740543a08d SRR12690177.sra SRR12690177.sra file validated SRR12690177 is paired end SRR12690177 is conventional basespace SRR12690177 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690177_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.681 37.0 37.0 37.0 37.0 37.0 2 36.48925 37.0 37.0 37.0 37.0 37.0 3 36.6445 37.0 37.0 37.0 37.0 37.0 4 36.64 37.0 37.0 37.0 37.0 37.0 5 36.6545 37.0 37.0 37.0 37.0 37.0 6 36.663 37.0 37.0 37.0 37.0 37.0 7 36.479 37.0 37.0 37.0 37.0 37.0 8 36.5685 37.0 37.0 37.0 37.0 37.0 9 36.6475 37.0 37.0 37.0 37.0 37.0 10-14 36.62259999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.608799999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.6226 37.0 37.0 37.0 37.0 37.0 25-29 36.5635 37.0 37.0 37.0 37.0 37.0 30-34 36.5832 37.0 37.0 37.0 37.0 37.0 35-39 36.5089 37.0 37.0 37.0 37.0 37.0 40-44 36.5033 37.0 37.0 37.0 37.0 37.0 45-49 36.489700000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.4887 37.0 37.0 37.0 37.0 37.0 55-59 36.4213 37.0 37.0 37.0 37.0 37.0 60-64 36.4289 37.0 37.0 37.0 37.0 37.0 65-69 36.3311 37.0 37.0 37.0 37.0 37.0 70-74 36.3354 37.0 37.0 37.0 37.0 37.0 75-79 36.3592 37.0 37.0 37.0 37.0 37.0 80-84 36.2958 37.0 37.0 37.0 37.0 37.0 85-89 36.321 37.0 37.0 37.0 37.0 37.0 90-94 36.3192 37.0 37.0 37.0 37.0 37.0 95-99 36.2479 37.0 37.0 37.0 37.0 37.0 100-104 36.2201 37.0 37.0 37.0 37.0 37.0 105-109 36.2055 37.0 37.0 37.0 37.0 37.0 110-114 36.2334 37.0 37.0 37.0 37.0 37.0 115-119 36.138400000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0923 37.0 37.0 37.0 37.0 37.0 125-129 36.123400000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.001599999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.077000000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.798199999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.7955 37.0 37.0 37.0 37.0 37.0 150-151 35.498999999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 1.0 26 3.0 27 7.0 28 12.0 29 11.0 30 21.0 31 38.0 32 52.0 33 69.0 34 87.0 35 265.0 36 3036.0 37 395.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.074999999999996 11.025 6.825 37.075 2 19.62897969415894 12.233642516921535 35.246929054900974 32.89044873401855 3 16.1 15.75 28.000000000000004 40.150000000000006 4 20.8 22.775000000000002 25.924999999999997 30.5 5 23.375 29.425 23.7 23.5 6 19.75 33.7 24.725 21.825 7 17.275 26.8 39.625 16.3 8 17.599999999999998 26.625 30.375000000000004 25.4 9 17.45 24.275 34.625 23.65 10-14 20.424999999999997 29.13 27.38 23.064999999999998 15-19 19.855 27.38 28.42 24.345 20-24 20.595 27.195000000000004 28.194999999999997 24.015 25-29 20.185 28.57 27.295 23.95 30-34 20.145 28.27 27.284999999999997 24.3 35-39 19.939999999999998 27.61 28.125 24.325 40-44 21.21 27.425 28.17 23.195 45-49 20.44 27.445000000000004 28.605000000000004 23.51 50-54 20.995 27.655 27.595 23.755000000000003 55-59 19.915 28.465 27.29 24.33 60-64 20.630000000000003 27.655 27.97 23.745 65-69 20.215 28.015 27.83 23.94 70-74 21.095 27.51 27.425 23.97 75-79 20.385 27.55 27.595 24.47 80-84 20.474999999999998 27.700000000000003 27.55 24.275 85-89 21.13 27.794999999999998 27.32 23.755000000000003 90-94 20.76 28.51 27.384999999999998 23.345 95-99 20.23 28.185 27.750000000000004 23.835 100-104 21.025 28.345 26.745 23.885 105-109 21.335 27.74 27.24 23.685000000000002 110-114 21.145 27.839999999999996 26.905 24.11 115-119 21.395 28.345 26.77 23.49 120-124 21.81 27.93 27.36 22.900000000000002 125-129 21.07 27.67 27.250000000000004 24.01 130-134 21.78 28.065 26.66 23.494999999999997 135-139 21.41 27.589999999999996 26.484999999999996 24.515 140-144 21.08 27.279999999999998 27.295 24.345 145-149 21.465 27.944999999999997 27.034999999999997 23.555 150-151 20.5875 28.3375 27.500000000000004 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.0 22 1.0 23 2.0 24 1.0 25 0.5 26 3.0 27 3.5 28 8.5 29 17.5 30 19.0 31 19.0 32 26.0 33 32.5 34 35.5 35 60.5 36 94.5 37 103.5 38 113.0 39 136.0 40 169.0 41 203.0 42 228.5 43 240.5 44 246.5 45 249.0 46 254.0 47 269.5 48 240.5 49 208.0 50 193.0 51 163.0 52 142.0 53 114.0 54 88.0 55 78.0 56 63.5 57 44.0 58 32.0 59 27.0 60 22.5 61 12.0 62 5.5 63 6.0 64 3.0 65 4.0 66 4.0 67 1.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.625 #Duplication Level Percentage of deduplicated Percentage of total 1 90.26499302649931 80.9 2 8.200836820083682 14.7 3 1.2552301255230125 3.375 4 0.2510460251046025 0.8999999999999999 5 0.02789400278940028 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTATACATGTGACCCGCTACCAGGAAAAGAATTGCAATAGCTAAATG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.75 0.0 0.0 0.0 0.0 112-113 3.125 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 3.7249999999999996 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.7125 0.0 0.0 0.0 0.0 122-123 5.1625 0.0 0.0 0.0 0.0 124-125 5.725 0.0 0.0 0.0 0.0 126-127 6.175 0.0 0.0 0.0 0.0 128-129 6.875 0.0 0.0 0.0 0.0 130-131 7.5125 0.0 0.0 0.0 0.0 132-133 7.9750000000000005 0.0 0.0 0.0 0.0 134-135 8.4875 0.0 0.0 0.0 0.0 136-137 9.2 0.0 0.0 0.0 0.0 138-139 10.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690177 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690177_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3815 37.0 37.0 37.0 37.0 37.0 2 36.0895 37.0 37.0 37.0 37.0 37.0 3 36.28 37.0 37.0 37.0 37.0 37.0 4 36.3005 37.0 37.0 37.0 37.0 37.0 5 36.3555 37.0 37.0 37.0 37.0 37.0 6 36.2935 37.0 37.0 37.0 37.0 37.0 7 36.3695 37.0 37.0 37.0 37.0 37.0 8 36.3435 37.0 37.0 37.0 37.0 37.0 9 36.375 37.0 37.0 37.0 37.0 37.0 10-14 36.2902 37.0 37.0 37.0 37.0 37.0 15-19 36.2858 37.0 37.0 37.0 37.0 37.0 20-24 36.2582 37.0 37.0 37.0 37.0 37.0 25-29 36.2179 37.0 37.0 37.0 37.0 37.0 30-34 36.189299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1438 37.0 37.0 37.0 37.0 37.0 40-44 36.10510000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.1866 37.0 37.0 37.0 37.0 37.0 50-54 36.104 37.0 37.0 37.0 37.0 37.0 55-59 36.1405 37.0 37.0 37.0 37.0 37.0 60-64 36.0959 37.0 37.0 37.0 37.0 37.0 65-69 36.055600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.0276 37.0 37.0 37.0 37.0 37.0 75-79 36.0151 37.0 37.0 37.0 37.0 37.0 80-84 35.9863 37.0 37.0 37.0 37.0 37.0 85-89 35.984 37.0 37.0 37.0 37.0 37.0 90-94 35.8895 37.0 37.0 37.0 37.0 37.0 95-99 35.931799999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.9251 37.0 37.0 37.0 37.0 37.0 105-109 35.879900000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.915800000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.7903 37.0 37.0 37.0 37.0 37.0 120-124 35.7692 37.0 37.0 37.0 37.0 37.0 125-129 35.658100000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.5893 37.0 37.0 37.0 37.0 37.0 135-139 35.5606 37.0 37.0 37.0 37.0 37.0 140-144 35.4508 37.0 37.0 37.0 37.0 37.0 145-149 35.32719999999999 37.0 37.0 37.0 32.2 37.0 150-151 34.93475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 6.0 15 6.0 16 1.0 17 0.0 18 1.0 19 0.0 20 1.0 21 2.0 22 2.0 23 8.0 24 3.0 25 4.0 26 4.0 27 14.0 28 14.0 29 18.0 30 21.0 31 32.0 32 45.0 33 96.0 34 173.0 35 478.0 36 2775.0 37 292.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.375 25.3 9.4 25.924999999999997 2 28.275 27.950000000000003 27.950000000000003 15.825 3 22.15 27.625 30.2 20.025000000000002 4 22.5 36.0 22.775000000000002 18.725 5 23.1 37.15 21.275 18.475 6 22.650000000000002 39.800000000000004 20.674999999999997 16.875 7 20.225 23.474999999999998 36.65 19.650000000000002 8 21.925 25.924999999999997 27.150000000000002 25.0 9 21.8 26.825 29.525000000000002 21.85 10-14 23.145 28.975 26.055 21.825 15-19 23.48 28.744999999999997 26.87 20.905 20-24 22.645 28.535 28.12 20.7 25-29 22.86 28.499999999999996 27.415 21.224999999999998 30-34 23.255 28.634999999999998 27.245 20.865000000000002 35-39 23.494999999999997 27.96 27.49 21.055 40-44 23.26 28.21 27.310000000000002 21.22 45-49 23.03 28.34 27.495000000000005 21.135 50-54 23.135 27.855 27.665 21.345 55-59 23.22 27.805000000000003 27.944999999999997 21.029999999999998 60-64 23.135 27.560000000000002 27.150000000000002 22.155 65-69 23.555 28.560000000000002 27.215 20.669999999999998 70-74 23.085 28.155 27.295 21.465 75-79 23.06 27.765 27.405 21.77 80-84 23.16 28.015 27.91 20.915 85-89 23.400000000000002 27.54 27.744999999999997 21.315 90-94 23.98 27.994999999999997 26.93 21.095 95-99 23.57 28.43 27.07 20.93 100-104 23.595 27.639999999999997 27.589999999999996 21.175 105-109 23.380000000000003 28.54 26.93 21.15 110-114 24.22 27.815 27.175 20.79 115-119 23.985 28.775000000000002 26.534999999999997 20.705000000000002 120-124 24.490000000000002 27.99 26.915 20.605 125-129 24.8 28.799999999999997 26.02 20.380000000000003 130-134 25.080000000000002 28.28 26.415 20.225 135-139 25.83 28.139999999999997 26.13 19.900000000000002 140-144 26.445 27.265 26.71 19.580000000000002 145-149 26.685 27.560000000000002 26.46 19.295 150-151 27.500000000000004 26.2875 25.324999999999996 20.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.5 15 1.0 16 0.5 17 0.5 18 0.5 19 1.0 20 2.5 21 3.0 22 2.5 23 1.5 24 1.5 25 2.5 26 4.5 27 4.0 28 7.0 29 12.5 30 11.5 31 18.5 32 26.0 33 30.0 34 45.5 35 58.5 36 74.0 37 114.5 38 128.5 39 136.0 40 195.5 41 221.5 42 247.0 43 288.0 44 286.5 45 266.5 46 249.5 47 239.0 48 229.5 49 218.5 50 169.5 51 131.0 52 114.0 53 96.0 54 80.0 55 61.0 56 52.0 57 43.0 58 26.5 59 22.0 60 19.0 61 12.0 62 11.0 63 5.5 64 4.0 65 3.5 66 2.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 1.0 77 1.5 78 0.5 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 1.0 97 1.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.67500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.5492054641762 81.2 2 7.945358238081962 14.249999999999998 3 1.19877334820184 3.225 4 0.16727069974909395 0.6 5 0.1115137998327293 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027878449958182325 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit AGCAACCCCATTTTTCACTTTGAATTGGTCAAAATATTCGGAATTTCTTA 5 0.125 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.75 0.0 0.0 0.0 0.0 112-113 3.1375 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 4.2125 0.0 0.0 0.0 0.0 120-121 4.7375 0.0 0.0 0.0 0.0 122-123 5.2125 0.0 0.0 0.0 0.0 124-125 5.775 0.0 0.0 0.0 0.0 126-127 6.175 0.0 0.0 0.0 0.0 128-129 6.875 0.0 0.0 0.0 0.0 130-131 7.5375 0.0 0.0 0.0 0.0 132-133 8.025 0.0 0.0 0.0 0.0 134-135 8.575 0.0 0.0 0.0 0.0 136-137 9.325 0.0 0.0 0.0 0.0 138-139 10.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCTGA 10 0.006830828 145.0 6 GGGGGGG 140 1.0287987E-4 10.357143 140-144 >>END_MODULE Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760677 spots for SRR12690177.sra Written 760677 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra Read 760659 spots for SRR12690177.sra Written 760659 spots for SRR12690177.sra SRR ids: ['SRR12690177.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9pn_yoxo SRR12690177.sra spots: 15213198 blocks: [[1, 760659], [760660, 1521318], [1521319, 2281977], [2281978, 3042636], [3042637, 3803295], [3803296, 4563954], [4563955, 5324613], [5324614, 6085272], [6085273, 6845931], [6845932, 7606590], [7606591, 8367249], [8367250, 9127908], [9127909, 9888567], [9888568, 10649226], [10649227, 11409885], [11409886, 12170544], [12170545, 12931203], [12931204, 13691862], [13691863, 14452521], [14452522, 15213198]] SRR12690177 file size 5148409 SRR12690177 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690177 SRR12690177_1.fastq SRR12690177_2.fastq Input file: SRR12690177_1.fastq Paired file: SRR12690177_2.fastq trimmed: SRR12690177-trimmed-pair1.fastq, SRR12690177-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:17:37 2025 >> started Mon Feb 10 21:18:00 2025 >> done (22.973s) 15213198 read pairs processed; of these: 34 ( 0.00%) short read pairs filtered out after trimming by size control 8001 ( 0.05%) empty read pairs filtered out after trimming by size control 15205163 (99.95%) read pairs available; of these: 2183646 (14.36%) trimmed read pairs available after processing 13021517 (85.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 4 0.00% 21 4 0.00% 22 16 0.00% 23 11 0.00% 24 15 0.00% 25 13 0.00% 26 13 0.00% 27 14 0.00% 28 24 0.00% 29 23 0.00% 30 30 0.00% 31 24 0.00% 32 27 0.00% 33 25 0.00% 34 27 0.00% 35 22 0.00% 36 34 0.00% 37 36 0.00% 38 39 0.00% 39 50 0.00% 40 45 0.00% 41 38 0.00% 42 35 0.00% 43 55 0.00% 44 46 0.00% 45 51 0.00% 46 59 0.00% 47 72 0.00% 48 88 0.00% 49 71 0.00% 50 119 0.00% 51 94 0.00% 52 121 0.00% 53 112 0.00% 54 136 0.00% 55 150 0.00% 56 184 0.00% 57 192 0.00% 58 228 0.00% 59 252 0.00% 60 290 0.00% 61 323 0.00% 62 412 0.00% 63 433 0.00% 64 459 0.00% 65 454 0.00% 66 565 0.00% 67 606 0.00% 68 772 0.01% 69 817 0.01% 70 920 0.01% 71 1051 0.01% 72 1347 0.01% 73 1462 0.01% 74 1590 0.01% 75 1816 0.01% 76 1925 0.01% 77 2188 0.01% 78 2429 0.02% 79 2758 0.02% 80 3101 0.02% 81 3532 0.02% 82 3909 0.03% 83 4360 0.03% 84 4713 0.03% 85 5119 0.03% 86 5840 0.04% 87 6182 0.04% 88 6579 0.04% 89 7299 0.05% 90 7958 0.05% 91 8654 0.06% 92 9266 0.06% 93 10307 0.07% 94 11045 0.07% 95 12158 0.08% 96 12706 0.08% 97 13375 0.09% 98 14087 0.09% 99 14960 0.10% 100 15727 0.10% 101 16720 0.11% 102 17675 0.12% 103 18553 0.12% 104 19692 0.13% 105 20638 0.14% 106 21223 0.14% 107 22241 0.15% 108 22842 0.15% 109 23976 0.16% 110 24355 0.16% 111 25515 0.17% 112 26986 0.18% 113 27957 0.18% 114 28569 0.19% 115 29935 0.20% 116 31301 0.21% 117 31957 0.21% 118 32504 0.21% 119 33637 0.22% 120 35039 0.23% 121 35643 0.23% 122 36830 0.24% 123 37991 0.25% 124 39152 0.26% 125 39759 0.26% 126 41332 0.27% 127 41893 0.28% 128 42186 0.28% 129 43282 0.28% 130 44640 0.29% 131 44835 0.29% 132 46064 0.30% 133 47322 0.31% 134 47582 0.31% 135 48775 0.32% 136 49395 0.32% 137 49472 0.33% 138 50761 0.33% 139 52720 0.35% 140 52474 0.35% 141 53615 0.35% 142 54954 0.36% 143 54749 0.36% 144 56851 0.37% 145 57461 0.38% 146 58155 0.38% 147 58455 0.38% 148 59881 0.39% 149 59244 0.39% 150 60756 0.40% 151 13021517 85.64% 15205163 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=11 prefix-density=0.54 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=375.21 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGT criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=24 prefix-density=0.70 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=16.60 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.8 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATA SRR12690177 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:18:43 Started mapping on | Feb 10 21:18:43 Finished on | Feb 10 21:20:45 Mapping speed, Million of reads per hour | 448.68 Number of input reads | 15205163 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13971271 Uniquely mapped reads % | 91.89% Average mapped length | 293.79 Number of splices: Total | 13924149 Number of splices: Annotated (sjdb) | 13625068 Number of splices: GT/AG | 13645905 Number of splices: GC/AG | 220059 Number of splices: AT/AC | 9459 Number of splices: Non-canonical | 48726 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 395997 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 244690 % of reads mapped to too many loci | 1.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.59% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 837895 837895 837895 N_multimapping 395997 395997 395997 N_noFeature 522985 13778640 578051 N_ambiguous 227664 961 89460 UnstrandedReadsAssigned:13220622 PositiveStrandReadsAssigned:191670 NegativeStrandReadsAssigned:13303760 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690177 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690177-trimmed-pair1.fastq SRR12690177-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,205,163 reads, 13,416,758 reads pseudoaligned [quant] estimated average fragment length: 234.17 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR12690177.ke.tsv 34699 SRR12690177.se.tsv 87100 total ==> SRR12690177.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.83 580 20.5543 Potri.005G024800.1.v4.1 1035 801.83 516 40.7041 Potri.004G059700.1.v4.1 961 727.876 23 1.99867 Potri.007G009000.2.v4.1 1416 1182.83 0 0 Potri.003G141000.2.v4.1 2943 2709.83 736.064 17.1808 Potri.016G087400.1.v4.1 270 88.3254 612 438.265 Potri.015G069301.1.v4.1 564 337.224 0 0 Potri.010G195200.1.v4.1 1773 1539.83 40.688 1.67134 Potri.012G127500.1.v4.1 977 743.861 231 19.6422 ==> SRR12690177.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 186 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12690177 completed mapping pipeline successfully