Starting /dee2/code/volunteer_pipeline.sh SRR12690178 current disk space = 3056615518208 free memory = 1274597008 SRR12690178 SRAfilesize 19ec9aca45232eda115cade2ad9d346a SRR12690178.sra SRR12690178.sra file validated SRR12690178 is paired end SRR12690178 is conventional basespace SRR12690178 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690178_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5695 37.0 37.0 37.0 37.0 37.0 2 36.40875 37.0 37.0 37.0 37.0 37.0 3 36.592 37.0 37.0 37.0 37.0 37.0 4 36.573 37.0 37.0 37.0 37.0 37.0 5 36.6005 37.0 37.0 37.0 37.0 37.0 6 36.589 37.0 37.0 37.0 37.0 37.0 7 36.528 37.0 37.0 37.0 37.0 37.0 8 36.5705 37.0 37.0 37.0 37.0 37.0 9 36.615 37.0 37.0 37.0 37.0 37.0 10-14 36.5954 37.0 37.0 37.0 37.0 37.0 15-19 36.5983 37.0 37.0 37.0 37.0 37.0 20-24 36.556200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.53340000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.543800000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.47 37.0 37.0 37.0 37.0 37.0 40-44 36.4951 37.0 37.0 37.0 37.0 37.0 45-49 36.403800000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4216 37.0 37.0 37.0 37.0 37.0 55-59 36.3994 37.0 37.0 37.0 37.0 37.0 60-64 36.400800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3432 37.0 37.0 37.0 37.0 37.0 70-74 36.3426 37.0 37.0 37.0 37.0 37.0 75-79 36.3466 37.0 37.0 37.0 37.0 37.0 80-84 36.242200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2284 37.0 37.0 37.0 37.0 37.0 90-94 36.2169 37.0 37.0 37.0 37.0 37.0 95-99 36.122699999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.132799999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.08969999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.0945 37.0 37.0 37.0 37.0 37.0 115-119 36.031400000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0132 37.0 37.0 37.0 37.0 37.0 125-129 36.0585 37.0 37.0 37.0 37.0 37.0 130-134 35.928399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.990899999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.7505 37.0 37.0 37.0 37.0 37.0 145-149 35.7572 37.0 37.0 37.0 37.0 37.0 150-151 35.61425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 2.0 24 0.0 25 4.0 26 8.0 27 10.0 28 16.0 29 16.0 30 29.0 31 33.0 32 34.0 33 64.0 34 93.0 35 293.0 36 3003.0 37 393.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.225 13.0 5.949999999999999 37.824999999999996 2 20.361536530253577 12.603565151895557 34.44639718804921 32.58850112980166 3 16.175 15.625 29.575000000000003 38.625 4 21.55 22.900000000000002 24.4 31.15 5 24.099999999999998 29.45 23.775 22.675 6 21.7 32.925 23.525 21.85 7 17.675 26.650000000000002 38.275 17.4 8 17.5 27.075 31.674999999999997 23.75 9 17.974999999999998 23.7 35.449999999999996 22.875 10-14 19.945 29.439999999999998 27.305 23.31 15-19 20.44 27.185 28.12 24.255 20-24 20.535 27.875 27.41 24.18 25-29 20.375 27.82 27.18 24.625 30-34 20.775 27.155 27.450000000000003 24.62 35-39 20.415 27.735 27.875 23.974999999999998 40-44 20.75 27.785 27.48 23.985 45-49 20.77 27.834999999999997 27.13 24.265 50-54 20.505000000000003 27.49 27.87 24.135 55-59 20.875 27.85 26.740000000000002 24.535 60-64 20.355 28.315 27.310000000000002 24.02 65-69 21.37 27.589999999999996 27.025 24.015 70-74 20.94 28.244999999999997 26.55 24.265 75-79 20.54 27.589999999999996 27.72 24.15 80-84 20.064999999999998 27.994999999999997 27.525 24.415 85-89 20.73 27.55 27.855 23.865 90-94 21.375 26.974999999999998 27.825 23.825 95-99 20.665 27.775 27.845 23.715 100-104 21.555 27.389999999999997 27.339999999999996 23.715 105-109 21.32 27.150000000000002 27.63 23.9 110-114 21.395 27.029999999999998 27.595 23.98 115-119 21.23 28.115000000000002 27.089999999999996 23.565 120-124 20.97 27.72 27.060000000000002 24.25 125-129 21.12 27.77 27.034999999999997 24.075 130-134 21.73 28.144999999999996 26.015 24.11 135-139 21.790000000000003 27.35 26.795 24.065 140-144 22.21 27.955000000000002 25.785000000000004 24.05 145-149 21.205 28.175 25.83 24.79 150-151 21.275 27.800000000000004 26.187500000000004 24.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.5 22 2.0 23 0.5 24 1.0 25 2.5 26 3.0 27 6.0 28 6.5 29 7.0 30 8.0 31 12.5 32 19.5 33 30.5 34 42.5 35 47.5 36 56.0 37 88.5 38 124.5 39 147.0 40 174.0 41 200.5 42 216.5 43 245.0 44 267.0 45 256.5 46 254.0 47 254.0 48 249.0 49 241.0 50 199.5 51 154.0 52 128.0 53 119.0 54 108.0 55 79.0 56 66.0 57 51.0 58 35.5 59 30.5 60 22.0 61 14.0 62 8.5 63 5.5 64 4.5 65 3.0 66 1.5 67 0.5 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.95 #Duplication Level Percentage of deduplicated Percentage of total 1 91.45134689389775 83.175 2 7.449147883452446 13.55 3 0.8521165475536009 2.325 4 0.19241341396371633 0.7000000000000001 5 0.054975261132490384 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCGGCAATAAAGCTGATGCACTGCACTTGACGCGTGTTGTCGAATCCGA 5 0.125 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.2249999999999996 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.6 0.0 0.0 0.0 0.0 122-123 4.95 0.0 0.0 0.0 0.0 124-125 5.4625 0.0 0.0 0.0 0.0 126-127 6.074999999999999 0.0 0.0 0.0 0.0 128-129 6.5125 0.0 0.0 0.0 0.0 130-131 7.025 0.0 0.0 0.0 0.0 132-133 7.550000000000001 0.0 0.0 0.0 0.0 134-135 8.3 0.0 0.0 0.0 0.0 136-137 8.962499999999999 0.0 0.0 0.0 0.0 138-139 9.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690178 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690178_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3645 37.0 37.0 37.0 37.0 37.0 2 36.1715 37.0 37.0 37.0 37.0 37.0 3 36.1375 37.0 37.0 37.0 37.0 37.0 4 36.2345 37.0 37.0 37.0 37.0 37.0 5 36.3535 37.0 37.0 37.0 37.0 37.0 6 36.1805 37.0 37.0 37.0 37.0 37.0 7 36.2405 37.0 37.0 37.0 37.0 37.0 8 36.211 37.0 37.0 37.0 37.0 37.0 9 36.3775 37.0 37.0 37.0 37.0 37.0 10-14 36.239000000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2269 37.0 37.0 37.0 37.0 37.0 20-24 36.2331 37.0 37.0 37.0 37.0 37.0 25-29 36.1776 37.0 37.0 37.0 37.0 37.0 30-34 36.125099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1048 37.0 37.0 37.0 37.0 37.0 40-44 36.053900000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.09400000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.0449 37.0 37.0 37.0 37.0 37.0 55-59 36.053000000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.954899999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.98049999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.876799999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9135 37.0 37.0 37.0 37.0 37.0 80-84 35.8948 37.0 37.0 37.0 37.0 37.0 85-89 35.9323 37.0 37.0 37.0 37.0 37.0 90-94 35.821000000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.81 37.0 37.0 37.0 37.0 37.0 100-104 35.794200000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.8491 37.0 37.0 37.0 37.0 37.0 110-114 35.73330000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.6733 37.0 37.0 37.0 37.0 37.0 120-124 35.6323 37.0 37.0 37.0 37.0 37.0 125-129 35.5672 37.0 37.0 37.0 37.0 37.0 130-134 35.513400000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.368700000000004 37.0 37.0 37.0 34.6 37.0 140-144 35.2729 37.0 37.0 37.0 32.2 37.0 145-149 35.0267 37.0 37.0 37.0 27.4 37.0 150-151 34.657 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 7.0 15 3.0 16 3.0 17 1.0 18 2.0 19 4.0 20 3.0 21 1.0 22 6.0 23 5.0 24 9.0 25 6.0 26 6.0 27 15.0 28 15.0 29 14.0 30 32.0 31 29.0 32 53.0 33 79.0 34 154.0 35 558.0 36 2713.0 37 276.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.875 26.125 10.25 24.75 2 28.675 26.950000000000003 27.725 16.650000000000002 3 20.7 29.049999999999997 30.599999999999998 19.650000000000002 4 24.125 33.575 22.125 20.175 5 23.974999999999998 37.25 21.875 16.900000000000002 6 21.825 39.825 20.7 17.65 7 20.025000000000002 23.724999999999998 37.325 18.925 8 22.85 26.224999999999998 27.775 23.150000000000002 9 22.625 24.5 29.275000000000002 23.599999999999998 10-14 24.18 29.255 25.319999999999997 21.245 15-19 23.145 28.59 26.86 21.404999999999998 20-24 23.135 28.465 26.88 21.52 25-29 23.09 28.58 26.279999999999998 22.05 30-34 23.02 27.939999999999998 27.095000000000002 21.945 35-39 23.7 28.405 26.985 20.91 40-44 23.29 27.735 27.275 21.7 45-49 23.665 28.01 27.065 21.26 50-54 23.315 27.575 27.36 21.75 55-59 23.535 27.675 27.089999999999996 21.7 60-64 23.75 27.415 27.22 21.615000000000002 65-69 23.849999999999998 27.58 27.075 21.495 70-74 22.645 27.810000000000002 26.985 22.56 75-79 23.535 26.674999999999997 27.27 22.52 80-84 23.76 27.595 26.729999999999997 21.915000000000003 85-89 23.32 27.905 26.919999999999998 21.855 90-94 23.145 27.639999999999997 26.72 22.495 95-99 23.515 27.6 27.33 21.555 100-104 24.32 28.03 26.57 21.08 105-109 24.165 28.549999999999997 26.400000000000002 20.885 110-114 24.425 28.225 26.115 21.235 115-119 23.995 27.994999999999997 26.795 21.215 120-124 24.065 27.794999999999998 27.075 21.065 125-129 24.7 28.01 26.045 21.245 130-134 25.019999999999996 28.03 26.314999999999998 20.635 135-139 25.205 27.49 26.695 20.61 140-144 26.265 28.075 25.685000000000002 19.975 145-149 27.060000000000002 27.08 25.715 20.145 150-151 26.9625 27.8125 24.887500000000003 20.3375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.5 6 1.0 7 0.0 8 0.5 9 1.0 10 1.0 11 1.5 12 2.0 13 1.5 14 1.0 15 0.5 16 1.0 17 2.0 18 1.5 19 1.5 20 1.0 21 0.5 22 1.5 23 1.0 24 0.0 25 1.0 26 2.0 27 3.0 28 2.0 29 3.5 30 9.5 31 17.0 32 19.0 33 19.0 34 31.5 35 48.0 36 68.0 37 91.5 38 112.5 39 146.0 40 178.0 41 202.5 42 232.0 43 251.5 44 281.0 45 278.5 46 257.0 47 263.0 48 241.0 49 217.0 50 192.0 51 159.5 52 138.0 53 120.0 54 97.5 55 71.0 56 52.5 57 36.0 58 26.5 59 23.0 60 23.5 61 20.0 62 10.0 63 3.5 64 3.0 65 3.0 66 1.0 67 0.5 68 1.0 69 2.0 70 1.5 71 0.5 72 1.0 73 0.5 74 1.5 75 1.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 1.0 94 0.5 95 0.5 96 0.5 97 0.0 98 1.0 99 1.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 91.44899642562552 83.15 2 7.451196040692879 13.55 3 0.8798460269452847 2.4 4 0.192466318394281 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027495188342040146 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.9625 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.5375 0.0 0.0 0.0 0.0 118-119 4.1375 0.0 0.0 0.0 0.0 120-121 4.699999999999999 0.0 0.0 0.0 0.0 122-123 5.05 0.0 0.0 0.0 0.0 124-125 5.512499999999999 0.0 0.0 0.0 0.0 126-127 6.125 0.0 0.0 0.0 0.0 128-129 6.5625 0.0 0.0 0.0 0.0 130-131 7.075 0.0 0.0 0.0 0.0 132-133 7.5625 0.0 0.0 0.0 0.0 134-135 8.3 0.0 0.0 0.0 0.0 136-137 8.975 0.0 0.0 0.0 0.0 138-139 9.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155628 spots for SRR12690178.sra Written 1155628 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra Read 1155624 spots for SRR12690178.sra Written 1155624 spots for SRR12690178.sra SRR ids: ['SRR12690178.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g5xfdml1 SRR12690178.sra spots: 23112484 blocks: [[1, 1155624], [1155625, 2311248], [2311249, 3466872], [3466873, 4622496], [4622497, 5778120], [5778121, 6933744], [6933745, 8089368], [8089369, 9244992], [9244993, 10400616], [10400617, 11556240], [11556241, 12711864], [12711865, 13867488], [13867489, 15023112], [15023113, 16178736], [16178737, 17334360], [17334361, 18489984], [18489985, 19645608], [19645609, 20801232], [20801233, 21956856], [21956857, 23112484]] SRR12690178 file size 7832932 SRR12690178 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690178 SRR12690178_1.fastq SRR12690178_2.fastq Input file: SRR12690178_1.fastq Paired file: SRR12690178_2.fastq trimmed: SRR12690178-trimmed-pair1.fastq, SRR12690178-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:08:46 2025 >> started Mon Feb 10 21:09:12 2025 >> done (26.963s) 23112484 read pairs processed; of these: 55 ( 0.00%) short read pairs filtered out after trimming by size control 14660 ( 0.06%) empty read pairs filtered out after trimming by size control 23097769 (99.94%) read pairs available; of these: 3218864 (13.94%) trimmed read pairs available after processing 19878905 (86.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 11 0.00% 21 13 0.00% 22 23 0.00% 23 19 0.00% 24 18 0.00% 25 23 0.00% 26 23 0.00% 27 49 0.00% 28 31 0.00% 29 36 0.00% 30 27 0.00% 31 50 0.00% 32 56 0.00% 33 37 0.00% 34 44 0.00% 35 59 0.00% 36 53 0.00% 37 50 0.00% 38 60 0.00% 39 58 0.00% 40 50 0.00% 41 66 0.00% 42 80 0.00% 43 79 0.00% 44 86 0.00% 45 85 0.00% 46 112 0.00% 47 117 0.00% 48 122 0.00% 49 130 0.00% 50 143 0.00% 51 182 0.00% 52 184 0.00% 53 192 0.00% 54 220 0.00% 55 236 0.00% 56 247 0.00% 57 290 0.00% 58 311 0.00% 59 343 0.00% 60 466 0.00% 61 498 0.00% 62 491 0.00% 63 633 0.00% 64 703 0.00% 65 748 0.00% 66 862 0.00% 67 934 0.00% 68 1095 0.00% 69 1227 0.01% 70 1473 0.01% 71 1620 0.01% 72 1879 0.01% 73 2011 0.01% 74 2359 0.01% 75 2714 0.01% 76 2877 0.01% 77 3291 0.01% 78 3567 0.02% 79 3952 0.02% 80 4457 0.02% 81 4891 0.02% 82 5650 0.02% 83 6316 0.03% 84 7082 0.03% 85 7748 0.03% 86 8442 0.04% 87 9061 0.04% 88 9934 0.04% 89 10719 0.05% 90 11668 0.05% 91 12597 0.05% 92 13551 0.06% 93 14821 0.06% 94 15639 0.07% 95 17226 0.07% 96 18075 0.08% 97 19127 0.08% 98 20365 0.09% 99 21461 0.09% 100 22672 0.10% 101 23744 0.10% 102 25585 0.11% 103 26907 0.12% 104 27965 0.12% 105 29514 0.13% 106 30440 0.13% 107 31972 0.14% 108 32967 0.14% 109 35138 0.15% 110 35205 0.15% 111 36337 0.16% 112 38373 0.17% 113 39571 0.17% 114 41623 0.18% 115 42640 0.18% 116 44495 0.19% 117 46145 0.20% 118 47899 0.21% 119 48403 0.21% 120 50068 0.22% 121 51790 0.22% 122 53339 0.23% 123 54986 0.24% 124 56261 0.24% 125 57398 0.25% 126 59466 0.26% 127 61569 0.27% 128 62653 0.27% 129 64077 0.28% 130 65721 0.28% 131 65867 0.29% 132 69013 0.30% 133 70352 0.30% 134 71640 0.31% 135 72057 0.31% 136 74510 0.32% 137 76090 0.33% 138 76556 0.33% 139 79182 0.34% 140 78857 0.34% 141 80444 0.35% 142 82709 0.36% 143 83405 0.36% 144 85408 0.37% 145 86420 0.37% 146 87520 0.38% 147 87508 0.38% 148 89458 0.39% 149 89257 0.39% 150 91433 0.40% 151 19878905 86.06% 23097769 reads passed initial QC criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=17 prefix-density=0.99 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=14.05 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=3.6 sequence=GAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTAAACGATGTGCTGACCATGGCGCTGGAGAGGGCTGCTGTGGTGGCCATT criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=19 prefix-density=0.76 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=56.17 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=2.3 sequence=ACAAAGAGAGCAGCATACATCCATAGAGAGAAAGAGAAGACATGGCAACCAGAACTCCAAAGCTTGTGAAGCACACATTGTTGACTCGGTTCAAGGATGAGATCACACGAGAACAAATCGACAACTACATTAATGACTATACCAATCTGCTCGATCTCATTCCAACCATGAAGAGTTTCAATTGGGGCACGGATTTGGGCATGGAGTCTGCGGAGCTAAACCGAGGATACACTCATGCCTTTGAATCTACATTTGAGAGCAAGTCAGGTTTGCAAGAGTACCTCGATTCTGCTGCTCTTGCTGCATTTGCAG SRR12690178 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:09:54 Started mapping on | Feb 10 21:09:54 Finished on | Feb 10 21:12:34 Mapping speed, Million of reads per hour | 519.70 Number of input reads | 23097769 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21569846 Uniquely mapped reads % | 93.38% Average mapped length | 294.22 Number of splices: Total | 21334557 Number of splices: Annotated (sjdb) | 20904960 Number of splices: GT/AG | 20918625 Number of splices: GC/AG | 350291 Number of splices: AT/AC | 15941 Number of splices: Non-canonical | 49700 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 743569 % of reads mapped to multiple loci | 3.22% Number of reads mapped to too many loci | 162707 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 784354 784354 784354 N_multimapping 743569 743569 743569 N_noFeature 524376 21340737 593713 N_ambiguous 306107 1128 145664 UnstrandedReadsAssigned:20739363 PositiveStrandReadsAssigned:227981 NegativeStrandReadsAssigned:20830469 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690178 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690178-trimmed-pair1.fastq SRR12690178-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,097,769 reads, 21,079,984 reads pseudoaligned [quant] estimated average fragment length: 237.258 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR12690178.ke.tsv 34699 SRR12690178.se.tsv 87100 total ==> SRR12690178.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.74 406 10.0527 Potri.005G024800.1.v4.1 1035 798.742 100 5.52324 Potri.004G059700.1.v4.1 961 724.785 24 1.46084 Potri.007G009000.2.v4.1 1416 1179.74 0 0 Potri.003G141000.2.v4.1 2943 2706.74 418 6.81287 Potri.016G087400.1.v4.1 270 88.4767 989.73 493.502 Potri.015G069301.1.v4.1 564 335.406 0 0 Potri.010G195200.1.v4.1 1773 1536.74 3 0.0861234 Potri.012G127500.1.v4.1 977 740.766 2512 149.603 ==> SRR12690178.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 206 Potri.001G212900.v4.1 162 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 0 SRR12690178 completed mapping pipeline successfully