Starting /dee2/code/volunteer_pipeline.sh SRR12690179 current disk space = 3056938668032 free memory = 1156343892 SRR12690179 SRAfilesize 6949864157344ad96aa9e6a141a366ae SRR12690179.sra SRR12690179.sra file validated SRR12690179 is paired end SRR12690179 is conventional basespace SRR12690179 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690179_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.589 37.0 37.0 37.0 37.0 37.0 2 36.41 37.0 37.0 37.0 37.0 37.0 3 36.573 37.0 37.0 37.0 37.0 37.0 4 36.6095 37.0 37.0 37.0 37.0 37.0 5 36.6275 37.0 37.0 37.0 37.0 37.0 6 36.652 37.0 37.0 37.0 37.0 37.0 7 36.559 37.0 37.0 37.0 37.0 37.0 8 36.61 37.0 37.0 37.0 37.0 37.0 9 36.643 37.0 37.0 37.0 37.0 37.0 10-14 36.5886 37.0 37.0 37.0 37.0 37.0 15-19 36.5612 37.0 37.0 37.0 37.0 37.0 20-24 36.557500000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.525800000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4993 37.0 37.0 37.0 37.0 37.0 35-39 36.4738 37.0 37.0 37.0 37.0 37.0 40-44 36.441199999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3949 37.0 37.0 37.0 37.0 37.0 50-54 36.4054 37.0 37.0 37.0 37.0 37.0 55-59 36.3713 37.0 37.0 37.0 37.0 37.0 60-64 36.37349999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3735 37.0 37.0 37.0 37.0 37.0 70-74 36.356399999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.2823 37.0 37.0 37.0 37.0 37.0 80-84 36.2523 37.0 37.0 37.0 37.0 37.0 85-89 36.236399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.25 37.0 37.0 37.0 37.0 37.0 95-99 36.175 37.0 37.0 37.0 37.0 37.0 100-104 36.1904 37.0 37.0 37.0 37.0 37.0 105-109 36.1449 37.0 37.0 37.0 37.0 37.0 110-114 36.0864 37.0 37.0 37.0 37.0 37.0 115-119 36.0871 37.0 37.0 37.0 37.0 37.0 120-124 36.06660000000001 37.0 37.0 37.0 37.0 37.0 125-129 36.0372 37.0 37.0 37.0 37.0 37.0 130-134 35.9942 37.0 37.0 37.0 37.0 37.0 135-139 36.0086 37.0 37.0 37.0 37.0 37.0 140-144 35.8559 37.0 37.0 37.0 37.0 37.0 145-149 35.820699999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.5685 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 2.0 25 1.0 26 1.0 27 7.0 28 11.0 29 11.0 30 17.0 31 40.0 32 53.0 33 75.0 34 116.0 35 316.0 36 3030.0 37 318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.275 11.4 7.725 35.6 2 21.106659989984976 12.168252378567852 34.40160240360541 32.323485227841765 3 17.25 16.425 29.175 37.15 4 20.45 22.725 25.900000000000002 30.925000000000004 5 23.525 29.625 23.849999999999998 23.0 6 21.6 32.975 23.1 22.325 7 16.575 28.000000000000004 40.1 15.325 8 17.125 27.275 32.925 22.675 9 18.025 24.4 33.45 24.125 10-14 19.875 29.725 27.689999999999998 22.71 15-19 20.44 27.279999999999998 27.66 24.62 20-24 20.485 27.675 28.22 23.62 25-29 20.365 28.04 28.01 23.585 30-34 20.375 27.76 27.52 24.345 35-39 20.580000000000002 27.87 27.685 23.865 40-44 20.395 27.845 27.584999999999997 24.175 45-49 20.560000000000002 28.33 27.195000000000004 23.915 50-54 20.580000000000002 28.470000000000002 27.639999999999997 23.31 55-59 19.79 28.78 27.77 23.66 60-64 21.349999999999998 27.105 28.205000000000002 23.34 65-69 20.24 28.060000000000002 27.405 24.295 70-74 21.279999999999998 27.750000000000004 27.27 23.7 75-79 20.565 27.575 28.375 23.485 80-84 20.330000000000002 28.095 27.889999999999997 23.685000000000002 85-89 20.01 28.810000000000002 26.91 24.27 90-94 20.23 27.435 28.305000000000003 24.03 95-99 20.23 28.199999999999996 27.744999999999997 23.825 100-104 21.05 28.355000000000004 27.05 23.544999999999998 105-109 21.175 28.12 27.560000000000002 23.145 110-114 21.0 28.425 26.895000000000003 23.68 115-119 20.5 28.595 27.825 23.080000000000002 120-124 21.375 28.235 26.740000000000002 23.65 125-129 20.71 28.37 26.919999999999998 24.0 130-134 20.965 27.694999999999997 26.945000000000004 24.395 135-139 21.485000000000003 27.87 26.884999999999998 23.76 140-144 21.5 28.015 26.619999999999997 23.865 145-149 21.044999999999998 28.044999999999998 26.57 24.34 150-151 21.2875 28.237499999999997 26.637499999999996 23.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.5 20 1.0 21 1.0 22 2.0 23 1.5 24 2.0 25 3.5 26 4.5 27 6.0 28 13.0 29 15.0 30 11.0 31 17.5 32 24.0 33 30.0 34 43.0 35 65.0 36 89.5 37 106.0 38 123.0 39 139.0 40 163.0 41 196.0 42 219.0 43 240.0 44 253.5 45 275.5 46 272.0 47 264.5 48 266.5 49 223.0 50 186.0 51 160.0 52 126.5 53 97.0 54 73.5 55 62.0 56 58.5 57 49.5 58 31.0 59 21.0 60 21.0 61 15.0 62 6.0 63 2.5 64 4.5 65 4.5 66 3.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.2 #Duplication Level Percentage of deduplicated Percentage of total 1 92.51626898047722 85.3 2 6.616052060737528 12.2 3 0.7863340563991325 2.175 4 0.05422993492407809 0.2 5 0.027114967462039046 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGCAGTTGCTCCCTCGGATCCCCATCTTCTTCATCTATAGATTTCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.7625000000000002 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.4125 0.0 0.0 0.0 0.0 116-117 2.7875 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.1125 0.0 0.0 0.0 0.0 126-127 4.550000000000001 0.0 0.0 0.0 0.0 128-129 5.0375 0.0 0.0 0.0 0.0 130-131 5.512499999999999 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.387499999999999 0.0 0.0 0.0 0.0 136-137 6.9875 0.0 0.0 0.0 0.0 138-139 7.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTATG 10 0.006830828 145.0 9 >>END_MODULE SRR12690179 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690179_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.342 37.0 37.0 37.0 37.0 37.0 2 36.0735 37.0 37.0 37.0 37.0 37.0 3 36.1525 37.0 37.0 37.0 37.0 37.0 4 36.1615 37.0 37.0 37.0 37.0 37.0 5 36.3415 37.0 37.0 37.0 37.0 37.0 6 36.265 37.0 37.0 37.0 37.0 37.0 7 36.3865 37.0 37.0 37.0 37.0 37.0 8 36.2835 37.0 37.0 37.0 37.0 37.0 9 36.3455 37.0 37.0 37.0 37.0 37.0 10-14 36.298500000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.3241 37.0 37.0 37.0 37.0 37.0 20-24 36.278299999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.2274 37.0 37.0 37.0 37.0 37.0 30-34 36.17380000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.169599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1518 37.0 37.0 37.0 37.0 37.0 45-49 36.122 37.0 37.0 37.0 37.0 37.0 50-54 36.0666 37.0 37.0 37.0 37.0 37.0 55-59 36.080799999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.0239 37.0 37.0 37.0 37.0 37.0 65-69 36.011900000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9557 37.0 37.0 37.0 37.0 37.0 75-79 35.984 37.0 37.0 37.0 37.0 37.0 80-84 35.9049 37.0 37.0 37.0 37.0 37.0 85-89 35.9345 37.0 37.0 37.0 37.0 37.0 90-94 35.8177 37.0 37.0 37.0 37.0 37.0 95-99 35.899 37.0 37.0 37.0 37.0 37.0 100-104 35.8848 37.0 37.0 37.0 37.0 37.0 105-109 35.8725 37.0 37.0 37.0 37.0 37.0 110-114 35.8331 37.0 37.0 37.0 37.0 37.0 115-119 35.779 37.0 37.0 37.0 37.0 37.0 120-124 35.65069999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.60949999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.5713 37.0 37.0 37.0 37.0 37.0 135-139 35.4974 37.0 37.0 37.0 37.0 37.0 140-144 35.4261 37.0 37.0 37.0 37.0 37.0 145-149 35.3315 37.0 37.0 37.0 32.2 37.0 150-151 34.829 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 4.0 14 3.0 15 3.0 16 1.0 17 3.0 18 1.0 19 2.0 20 1.0 21 1.0 22 1.0 23 4.0 24 8.0 25 2.0 26 13.0 27 9.0 28 10.0 29 16.0 30 33.0 31 45.0 32 60.0 33 90.0 34 164.0 35 503.0 36 2749.0 37 273.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.625 24.025 11.25 23.1 2 29.599999999999998 25.424999999999997 28.249999999999996 16.725 3 22.2 28.325 30.95 18.525 4 24.175 33.75 23.474999999999998 18.6 5 24.575 36.75 21.15 17.525 6 22.35 38.9 21.0 17.75 7 20.075000000000003 24.7 35.65 19.575 8 21.7 26.125 27.575 24.6 9 21.6 25.55 28.549999999999997 24.3 10-14 23.45 29.75 26.16 20.64 15-19 23.415 28.78 26.77 21.035 20-24 23.305 29.195 26.685 20.815 25-29 22.650000000000002 28.904999999999998 27.169999999999998 21.275 30-34 22.884999999999998 28.74 27.139999999999997 21.235 35-39 23.285 28.155 27.084999999999997 21.475 40-44 23.24 28.194999999999997 27.49 21.075 45-49 22.49 28.185 27.235 22.09 50-54 22.975 28.03 27.915 21.08 55-59 23.155 27.800000000000004 27.529999999999998 21.515 60-64 22.99 27.72 27.62 21.67 65-69 23.24 27.21 27.634999999999998 21.915000000000003 70-74 22.509999999999998 28.095 27.065 22.33 75-79 23.53 27.365000000000002 27.060000000000002 22.045 80-84 22.994999999999997 27.66 27.755000000000003 21.59 85-89 23.385 27.994999999999997 26.75 21.87 90-94 23.32 27.575 27.544999999999998 21.560000000000002 95-99 23.03 27.325 27.58 22.065 100-104 23.955000000000002 28.165000000000003 26.88 21.0 105-109 23.419999999999998 28.345 26.56 21.675 110-114 23.45 28.110000000000003 27.455000000000002 20.985 115-119 23.65 28.26 27.089999999999996 21.0 120-124 24.060000000000002 28.42 27.18 20.34 125-129 24.775 28.09 26.845000000000002 20.29 130-134 24.735 27.51 27.04 20.715 135-139 25.374999999999996 27.865000000000002 26.450000000000003 20.31 140-144 25.385 27.894999999999996 26.195 20.525 145-149 25.515 28.29 26.224999999999998 19.97 150-151 25.687500000000004 27.650000000000002 26.375 20.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 1.0 12 2.0 13 1.0 14 0.5 15 1.0 16 1.5 17 1.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.5 25 4.0 26 2.5 27 3.0 28 9.5 29 14.5 30 12.0 31 12.0 32 23.0 33 36.5 34 46.5 35 66.0 36 75.5 37 90.5 38 127.5 39 151.0 40 182.0 41 227.0 42 241.0 43 244.5 44 264.5 45 279.0 46 270.0 47 250.0 48 223.5 49 194.0 50 180.5 51 154.0 52 115.0 53 91.5 54 87.5 55 71.0 56 52.0 57 48.5 58 39.0 59 25.5 60 17.5 61 14.0 62 8.5 63 5.0 64 2.5 65 2.0 66 1.5 67 0.5 68 1.0 69 1.5 70 1.0 71 1.5 72 2.0 73 1.5 74 1.0 75 0.5 76 0.0 77 1.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 1.0 94 1.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.95 #Duplication Level Percentage of deduplicated Percentage of total 1 92.49592169657423 85.05 2 6.443719412724307 11.85 3 0.9244154431756388 2.55 4 0.1087547580206634 0.4 5 0.0 0.0 6 0.02718868950516585 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.7875 0.0 0.0 0.0 0.0 118-119 3.2 0.0 0.0 0.0 0.0 120-121 3.4625 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.1125 0.0 0.0 0.0 0.0 126-127 4.550000000000001 0.0 0.0 0.0 0.0 128-129 5.0375 0.0 0.0 0.0 0.0 130-131 5.512499999999999 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.387499999999999 0.0 0.0 0.0 0.0 136-137 6.9875 0.0 0.0 0.0 0.0 138-139 7.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra Read 563708 spots for SRR12690179.sra Written 563708 spots for SRR12690179.sra Read 563698 spots for SRR12690179.sra Written 563698 spots for SRR12690179.sra SRR ids: ['SRR12690179.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i_uvo0yi SRR12690179.sra spots: 11273970 blocks: [[1, 563698], [563699, 1127396], [1127397, 1691094], [1691095, 2254792], [2254793, 2818490], [2818491, 3382188], [3382189, 3945886], [3945887, 4509584], [4509585, 5073282], [5073283, 5636980], [5636981, 6200678], [6200679, 6764376], [6764377, 7328074], [7328075, 7891772], [7891773, 8455470], [8455471, 9019168], [9019169, 9582866], [9582867, 10146564], [10146565, 10710262], [10710263, 11273970]] SRR12690179 file size 3809687 SRR12690179 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690179 SRR12690179_1.fastq SRR12690179_2.fastq Input file: SRR12690179_1.fastq Paired file: SRR12690179_2.fastq trimmed: SRR12690179-trimmed-pair1.fastq, SRR12690179-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:17:55 2025 >> started Mon Feb 10 21:18:08 2025 >> done (13.285s) 11273970 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 8734 ( 0.08%) empty read pairs filtered out after trimming by size control 11265215 (99.92%) read pairs available; of these: 1276353 (11.33%) trimmed read pairs available after processing 9988862 (88.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 9 0.00% 21 6 0.00% 22 11 0.00% 23 8 0.00% 24 13 0.00% 25 12 0.00% 26 15 0.00% 27 10 0.00% 28 14 0.00% 29 16 0.00% 30 23 0.00% 31 20 0.00% 32 23 0.00% 33 19 0.00% 34 21 0.00% 35 12 0.00% 36 35 0.00% 37 20 0.00% 38 28 0.00% 39 19 0.00% 40 26 0.00% 41 20 0.00% 42 30 0.00% 43 25 0.00% 44 30 0.00% 45 45 0.00% 46 24 0.00% 47 34 0.00% 48 57 0.00% 49 64 0.00% 50 63 0.00% 51 68 0.00% 52 83 0.00% 53 80 0.00% 54 79 0.00% 55 110 0.00% 56 97 0.00% 57 114 0.00% 58 133 0.00% 59 174 0.00% 60 170 0.00% 61 197 0.00% 62 246 0.00% 63 234 0.00% 64 279 0.00% 65 317 0.00% 66 313 0.00% 67 358 0.00% 68 401 0.00% 69 552 0.00% 70 567 0.01% 71 576 0.01% 72 719 0.01% 73 807 0.01% 74 949 0.01% 75 1045 0.01% 76 1122 0.01% 77 1246 0.01% 78 1317 0.01% 79 1568 0.01% 80 1740 0.02% 81 1922 0.02% 82 2239 0.02% 83 2306 0.02% 84 2654 0.02% 85 2870 0.03% 86 2961 0.03% 87 3419 0.03% 88 3589 0.03% 89 4113 0.04% 90 4262 0.04% 91 4743 0.04% 92 5195 0.05% 93 5565 0.05% 94 6172 0.05% 95 6520 0.06% 96 6886 0.06% 97 7196 0.06% 98 7686 0.07% 99 7944 0.07% 100 8555 0.08% 101 9043 0.08% 102 9539 0.08% 103 10352 0.09% 104 10877 0.10% 105 11418 0.10% 106 11679 0.10% 107 12144 0.11% 108 12485 0.11% 109 13014 0.12% 110 13404 0.12% 111 14052 0.12% 112 15046 0.13% 113 15271 0.14% 114 16189 0.14% 115 16867 0.15% 116 17262 0.15% 117 17932 0.16% 118 18243 0.16% 119 18717 0.17% 120 19645 0.17% 121 20162 0.18% 122 20978 0.19% 123 21766 0.19% 124 22471 0.20% 125 23205 0.21% 126 23351 0.21% 127 24096 0.21% 128 24917 0.22% 129 25210 0.22% 130 26170 0.23% 131 26533 0.24% 132 27124 0.24% 133 28128 0.25% 134 28363 0.25% 135 29455 0.26% 136 29944 0.27% 137 30210 0.27% 138 31241 0.28% 139 31735 0.28% 140 31782 0.28% 141 32350 0.29% 142 33127 0.29% 143 34062 0.30% 144 34566 0.31% 145 35034 0.31% 146 36265 0.32% 147 35826 0.32% 148 36792 0.33% 149 36692 0.33% 150 38403 0.34% 151 9988862 88.67% 11265215 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=0.77 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=9.17 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.8 sequence=AAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=24 prefix-density=1.04 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=61.65 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.5 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12690179 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:19:04 Started mapping on | Feb 10 21:19:04 Finished on | Feb 10 21:20:20 Mapping speed, Million of reads per hour | 533.62 Number of input reads | 11265215 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10516527 Uniquely mapped reads % | 93.35% Average mapped length | 295.36 Number of splices: Total | 10403289 Number of splices: Annotated (sjdb) | 10161264 Number of splices: GT/AG | 10183555 Number of splices: GC/AG | 179186 Number of splices: AT/AC | 7837 Number of splices: Non-canonical | 32711 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 239023 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 68825 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 509665 509665 509665 N_multimapping 239023 239023 239023 N_noFeature 380739 10376618 424502 N_ambiguous 156059 527 59651 UnstrandedReadsAssigned:9979729 PositiveStrandReadsAssigned:139382 NegativeStrandReadsAssigned:10032374 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690179 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690179-trimmed-pair1.fastq SRR12690179-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,265,215 reads, 10,089,640 reads pseudoaligned [quant] estimated average fragment length: 256.407 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR12690179.ke.tsv 34699 SRR12690179.se.tsv 87100 total ==> SRR12690179.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.59 214 10.9454 Potri.005G024800.1.v4.1 1035 779.593 67 7.74773 Potri.004G059700.1.v4.1 961 705.802 14 1.78819 Potri.007G009000.2.v4.1 1416 1160.59 0 0 Potri.003G141000.2.v4.1 2943 2687.59 428.424 14.3707 Potri.016G087400.1.v4.1 270 85.8933 441 462.857 Potri.015G069301.1.v4.1 564 323.969 0 0 Potri.010G195200.1.v4.1 1773 1517.59 3 0.178211 Potri.012G127500.1.v4.1 977 721.723 81 10.1177 ==> SRR12690179.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 278 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 119 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12690179 completed mapping pipeline successfully