Starting /dee2/code/volunteer_pipeline.sh SRR12690180 current disk space = 3056445194240 free memory = 1463301276 SRR12690180 SRAfilesize 7bac8b7cf2802282c600287486fecc6a SRR12690180.sra SRR12690180.sra file validated SRR12690180 is paired end SRR12690180 is conventional basespace SRR12690180 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690180_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.685 37.0 37.0 37.0 37.0 37.0 2 36.4915 37.0 37.0 37.0 37.0 37.0 3 36.595 37.0 37.0 37.0 37.0 37.0 4 36.616 37.0 37.0 37.0 37.0 37.0 5 36.621 37.0 37.0 37.0 37.0 37.0 6 36.571 37.0 37.0 37.0 37.0 37.0 7 36.5555 37.0 37.0 37.0 37.0 37.0 8 36.619 37.0 37.0 37.0 37.0 37.0 9 36.576 37.0 37.0 37.0 37.0 37.0 10-14 36.6145 37.0 37.0 37.0 37.0 37.0 15-19 36.6387 37.0 37.0 37.0 37.0 37.0 20-24 36.5864 37.0 37.0 37.0 37.0 37.0 25-29 36.513 37.0 37.0 37.0 37.0 37.0 30-34 36.482299999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4773 37.0 37.0 37.0 37.0 37.0 40-44 36.431999999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.25320000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.1871 37.0 37.0 37.0 37.0 37.0 55-59 36.0518 37.0 37.0 37.0 37.0 37.0 60-64 36.1057 37.0 37.0 37.0 37.0 37.0 65-69 36.0354 37.0 37.0 37.0 37.0 37.0 70-74 36.0796 37.0 37.0 37.0 37.0 37.0 75-79 36.2637 37.0 37.0 37.0 37.0 37.0 80-84 36.196299999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.22709999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2261 37.0 37.0 37.0 37.0 37.0 95-99 36.1175 37.0 37.0 37.0 37.0 37.0 100-104 36.0522 37.0 37.0 37.0 37.0 37.0 105-109 36.05550000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.0106 37.0 37.0 37.0 37.0 37.0 115-119 35.9637 37.0 37.0 37.0 37.0 37.0 120-124 35.884299999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9075 37.0 37.0 37.0 37.0 37.0 130-134 35.80460000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.7473 37.0 37.0 37.0 37.0 37.0 140-144 35.488800000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.3872 37.0 37.0 37.0 34.6 37.0 150-151 35.17125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 2.0 25 9.0 26 10.0 27 11.0 28 9.0 29 13.0 30 32.0 31 34.0 32 82.0 33 109.0 34 117.0 35 331.0 36 2863.0 37 376.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.65 14.75 9.1 38.5 2 21.453634085213032 13.55889724310777 32.4812030075188 32.5062656641604 3 16.3 13.675 29.349999999999998 40.675 4 19.175 19.475 27.500000000000004 33.85 5 24.7 24.349999999999998 26.6 24.349999999999998 6 24.6 28.299999999999997 24.95 22.15 7 18.425 27.400000000000002 37.574999999999996 16.6 8 18.2 27.825 32.125 21.85 9 20.075000000000003 25.575 32.125 22.225 10-14 20.200000000000003 28.555000000000003 28.249999999999996 22.994999999999997 15-19 20.275000000000002 28.515 27.525 23.685000000000002 20-24 21.165 27.485 28.205000000000002 23.145 25-29 21.035 27.595 28.03 23.34 30-34 20.95 27.084999999999997 27.76 24.205 35-39 21.154999999999998 26.625 28.21 24.01 40-44 21.255 27.145000000000003 27.515 24.085 45-49 22.245 26.915 27.97 22.869999999999997 50-54 21.97 26.55 27.76 23.72 55-59 21.59 26.090000000000003 28.595 23.724999999999998 60-64 21.77 26.655 28.444999999999997 23.13 65-69 21.25 27.560000000000002 27.605 23.585 70-74 22.79 26.595000000000002 27.72 22.895 75-79 22.505 26.655 27.07 23.77 80-84 22.535 26.424999999999997 27.46 23.580000000000002 85-89 22.689999999999998 27.16 26.845000000000002 23.305 90-94 22.21 27.07 27.13 23.59 95-99 22.555 26.38 27.500000000000004 23.565 100-104 22.82 27.005000000000003 27.07 23.105 105-109 22.405 27.465 27.060000000000002 23.07 110-114 22.95 27.150000000000002 27.305 22.595000000000002 115-119 23.315 26.729999999999997 26.61 23.345 120-124 22.945 27.305 26.83 22.919999999999998 125-129 23.095 26.935 26.845000000000002 23.125 130-134 23.25 27.015 26.66 23.075000000000003 135-139 23.119999999999997 27.35 26.505000000000003 23.025000000000002 140-144 23.135 27.025 26.235000000000003 23.605 145-149 22.805 26.740000000000002 26.52 23.935000000000002 150-151 23.575 26.724999999999998 25.9875 23.7125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.5 23 2.5 24 2.0 25 2.5 26 3.5 27 5.5 28 6.0 29 7.5 30 10.0 31 15.0 32 21.0 33 27.0 34 36.0 35 48.0 36 62.5 37 78.0 38 94.0 39 127.5 40 168.5 41 198.5 42 209.0 43 249.0 44 279.0 45 253.5 46 249.0 47 254.0 48 242.0 49 209.5 50 188.5 51 170.5 52 141.5 53 120.0 54 108.5 55 87.0 56 62.5 57 48.0 58 42.5 59 41.0 60 30.0 61 17.0 62 8.5 63 8.0 64 6.0 65 4.0 66 4.5 67 8.5 68 11.5 69 8.0 70 5.0 71 5.5 72 3.5 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.725 #Duplication Level Percentage of deduplicated Percentage of total 1 92.4502589261379 84.8 2 6.623058053965658 12.15 3 0.7904061052057783 2.175 4 0.08176614881439084 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027255382938130283 0.2 9 0.0 0.0 >10 0.027255382938130283 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCTCGTTT 15 0.375 TruSeq Adapter, Index 3 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCTCGTAT 8 0.2 TruSeq Adapter, Index 3 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.175 0.0 0.0 0.0 0.0 92-93 1.3875000000000002 0.0 0.0 0.0 0.0 94-95 1.4874999999999998 0.0 0.0 0.0 0.0 96-97 1.75 0.0 0.0 0.0 0.0 98-99 2.025 0.0 0.0 0.0 0.0 100-101 2.4375 0.0 0.0 0.0 0.0 102-103 2.9875 0.0 0.0 0.0 0.0 104-105 3.4125 0.0 0.0 0.0 0.0 106-107 3.8125 0.0 0.0 0.0 0.0 108-109 4.1875 0.0 0.0 0.0 0.0 110-111 4.762499999999999 0.0 0.0 0.0 0.0 112-113 5.487500000000001 0.0 0.0 0.0 0.0 114-115 6.0375 0.0 0.0 0.0 0.0 116-117 6.675 0.0 0.0 0.0 0.0 118-119 7.5 0.0 0.0 0.0 0.0 120-121 8.2 0.0 0.0 0.0 0.0 122-123 8.8875 0.0 0.0 0.0 0.0 124-125 9.75 0.0 0.0 0.0 0.0 126-127 10.55 0.0 0.0 0.0 0.0 128-129 11.6125 0.0 0.0 0.0 0.0 130-131 12.6125 0.0 0.0 0.0 0.0 132-133 13.575 0.0 0.0 0.0 0.0 134-135 14.35 0.0 0.0 0.0 0.0 136-137 15.4125 0.0 0.0 0.0 0.0 138-139 16.762500000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690180 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690180_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.511 37.0 37.0 37.0 37.0 37.0 2 36.421 37.0 37.0 37.0 37.0 37.0 3 36.3975 37.0 37.0 37.0 37.0 37.0 4 36.3415 37.0 37.0 37.0 37.0 37.0 5 36.543 37.0 37.0 37.0 37.0 37.0 6 36.464 37.0 37.0 37.0 37.0 37.0 7 36.3825 37.0 37.0 37.0 37.0 37.0 8 36.339 37.0 37.0 37.0 37.0 37.0 9 36.367 37.0 37.0 37.0 37.0 37.0 10-14 36.307300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.291999999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.2447 37.0 37.0 37.0 37.0 37.0 25-29 36.1691 37.0 37.0 37.0 37.0 37.0 30-34 36.0986 37.0 37.0 37.0 37.0 37.0 35-39 36.0947 37.0 37.0 37.0 37.0 37.0 40-44 36.0648 37.0 37.0 37.0 37.0 37.0 45-49 36.045399999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.991600000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.995200000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9404 37.0 37.0 37.0 37.0 37.0 65-69 35.943799999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8603 37.0 37.0 37.0 37.0 37.0 75-79 35.852999999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.9171 37.0 37.0 37.0 37.0 37.0 85-89 35.9701 37.0 37.0 37.0 37.0 37.0 90-94 35.925 37.0 37.0 37.0 37.0 37.0 95-99 35.9707 37.0 37.0 37.0 37.0 37.0 100-104 36.0605 37.0 37.0 37.0 37.0 37.0 105-109 36.0009 37.0 37.0 37.0 37.0 37.0 110-114 35.9401 37.0 37.0 37.0 37.0 37.0 115-119 35.870799999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.805099999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.695299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.621 37.0 37.0 37.0 37.0 37.0 135-139 35.51649999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.441199999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.16270000000001 37.0 37.0 37.0 29.8 37.0 150-151 34.74325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 4.0 15 2.0 16 0.0 17 1.0 18 3.0 19 4.0 20 2.0 21 7.0 22 8.0 23 11.0 24 11.0 25 13.0 26 14.0 27 12.0 28 10.0 29 21.0 30 21.0 31 47.0 32 38.0 33 60.0 34 144.0 35 386.0 36 2770.0 37 407.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.725 24.575 13.625000000000002 29.075 2 29.2 27.625 26.575 16.6 3 20.525 30.65 27.975 20.849999999999998 4 24.099999999999998 33.975 21.9 20.025000000000002 5 26.974999999999998 35.75 20.65 16.625 6 22.25 39.175 20.599999999999998 17.974999999999998 7 22.425 23.05 35.65 18.875 8 21.9 26.875 27.0 24.224999999999998 9 23.7 25.825 28.225 22.25 10-14 23.68 28.98 25.31 22.03 15-19 24.38 28.910000000000004 24.895 21.815 20-24 23.855 28.465 25.995 21.685 25-29 23.830000000000002 28.49 26.655 21.025 30-34 23.945 28.79 26.055 21.21 35-39 23.57 28.51 26.834999999999997 21.085 40-44 23.919999999999998 28.255000000000003 26.450000000000003 21.375 45-49 23.78 27.985 26.505000000000003 21.73 50-54 23.77 28.775000000000002 25.705 21.75 55-59 24.18 28.12 26.584999999999997 21.115000000000002 60-64 23.974999999999998 27.405 26.96 21.66 65-69 24.335 27.310000000000002 26.51 21.845 70-74 24.185000000000002 27.644999999999996 26.515 21.654999999999998 75-79 24.325 28.46 25.900000000000002 21.315 80-84 23.95 28.084999999999997 26.865 21.099999999999998 85-89 25.035 27.455000000000002 26.150000000000002 21.36 90-94 24.67 28.000000000000004 25.874999999999996 21.455 95-99 24.505 28.17 26.479999999999997 20.845 100-104 25.040000000000003 28.285 25.569999999999997 21.105 105-109 25.305 27.595 26.33 20.77 110-114 25.555 28.305000000000003 25.69 20.45 115-119 25.735000000000003 28.095 26.064999999999998 20.105 120-124 26.43 28.144999999999996 25.324999999999996 20.1 125-129 26.69 27.76 25.405 20.145 130-134 27.029999999999998 27.36 25.990000000000002 19.62 135-139 26.919999999999998 27.744999999999997 25.395 19.939999999999998 140-144 28.050000000000004 27.589999999999996 24.884999999999998 19.475 145-149 28.835 27.12 25.419999999999998 18.625 150-151 29.9375 26.887499999999996 24.9875 18.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 1.5 17 1.5 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 1.0 24 2.5 25 3.5 26 4.0 27 3.5 28 4.5 29 7.0 30 10.0 31 10.5 32 12.0 33 17.0 34 30.5 35 45.0 36 58.0 37 75.0 38 90.5 39 127.0 40 168.0 41 197.0 42 247.5 43 283.5 44 287.5 45 283.0 46 267.5 47 281.5 48 273.5 49 221.5 50 198.0 51 165.0 52 123.5 53 97.0 54 85.0 55 72.5 56 48.0 57 33.5 58 23.5 59 21.0 60 17.5 61 16.0 62 13.0 63 5.0 64 2.5 65 2.5 66 1.0 67 0.5 68 1.5 69 1.5 70 0.5 71 1.5 72 2.0 73 0.5 74 0.0 75 0.0 76 0.5 77 1.0 78 1.0 79 1.0 80 0.5 81 1.5 82 1.5 83 0.5 84 2.0 85 3.0 86 2.0 87 1.0 88 1.5 89 4.0 90 3.5 91 1.0 92 1.0 93 0.5 94 1.5 95 1.5 96 0.5 97 1.5 98 2.0 99 1.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.43125510481896 84.875 2 6.615845358017969 12.15 3 0.7350939286686632 2.025 4 0.1361285053090117 0.5 5 0.027225701061802342 0.125 6 0.027225701061802342 0.15 7 0.027225701061802342 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.4874999999999998 0.0 0.0 0.0 0.0 94-95 1.5875 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.125 0.0 0.0 0.0 0.0 100-101 2.5375 0.0 0.0 0.0 0.0 102-103 3.0875 0.0 0.0 0.0 0.0 104-105 3.525 0.0 0.0 0.0 0.0 106-107 3.9875 0.0 0.0 0.0 0.0 108-109 4.3625 0.0 0.0 0.0 0.0 110-111 4.9625 0.0 0.0 0.0 0.0 112-113 5.6875 0.0 0.0 0.0 0.0 114-115 6.2875 0.0 0.0 0.0 0.0 116-117 6.949999999999999 0.0 0.0 0.0 0.0 118-119 7.8 0.0 0.0 0.0 0.0 120-121 8.5375 0.0 0.0 0.0 0.0 122-123 9.2375 0.0 0.0 0.0 0.0 124-125 10.100000000000001 0.0 0.0 0.0 0.0 126-127 10.912500000000001 0.0 0.0 0.0 0.0 128-129 11.975 0.0 0.0 0.0 0.0 130-131 12.9875 0.0 0.0 0.0 0.0 132-133 13.975 0.0 0.0 0.0 0.0 134-135 14.7 0.0 0.0 0.0 0.0 136-137 15.75 0.0 0.0 0.0 0.0 138-139 17.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCCGC 10 0.006830828 145.0 4 TGCTCTG 10 0.006830828 145.0 6 TTGGAAC 10 0.006830828 145.0 3 >>END_MODULE Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716798 spots for SRR12690180.sra Written 716798 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra Read 716789 spots for SRR12690180.sra Written 716789 spots for SRR12690180.sra SRR ids: ['SRR12690180.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0x0hujyh SRR12690180.sra spots: 14335789 blocks: [[1, 716789], [716790, 1433578], [1433579, 2150367], [2150368, 2867156], [2867157, 3583945], [3583946, 4300734], [4300735, 5017523], [5017524, 5734312], [5734313, 6451101], [6451102, 7167890], [7167891, 7884679], [7884680, 8601468], [8601469, 9318257], [9318258, 10035046], [10035047, 10751835], [10751836, 11468624], [11468625, 12185413], [12185414, 12902202], [12902203, 13618991], [13618992, 14335789]] SRR12690180 file size 4850227 SRR12690180 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690180 SRR12690180_1.fastq SRR12690180_2.fastq Input file: SRR12690180_1.fastq Paired file: SRR12690180_2.fastq trimmed: SRR12690180-trimmed-pair1.fastq, SRR12690180-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:03:39 2025 >> started Mon Feb 10 21:03:57 2025 >> done (18.555s) 14335789 read pairs processed; of these: 84 ( 0.00%) short read pairs filtered out after trimming by size control 154056 ( 1.07%) empty read pairs filtered out after trimming by size control 14181649 (98.92%) read pairs available; of these: 3642707 (25.69%) trimmed read pairs available after processing 10538942 (74.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 8 0.00% 21 15 0.00% 22 22 0.00% 23 44 0.00% 24 29 0.00% 25 23 0.00% 26 59 0.00% 27 42 0.00% 28 45 0.00% 29 58 0.00% 30 66 0.00% 31 63 0.00% 32 88 0.00% 33 79 0.00% 34 77 0.00% 35 73 0.00% 36 77 0.00% 37 113 0.00% 38 107 0.00% 39 115 0.00% 40 169 0.00% 41 134 0.00% 42 157 0.00% 43 151 0.00% 44 190 0.00% 45 188 0.00% 46 188 0.00% 47 254 0.00% 48 313 0.00% 49 285 0.00% 50 357 0.00% 51 384 0.00% 52 398 0.00% 53 469 0.00% 54 478 0.00% 55 514 0.00% 56 597 0.00% 57 638 0.00% 58 625 0.00% 59 705 0.00% 60 773 0.01% 61 834 0.01% 62 897 0.01% 63 1076 0.01% 64 1058 0.01% 65 1137 0.01% 66 1224 0.01% 67 1391 0.01% 68 1461 0.01% 69 1680 0.01% 70 1826 0.01% 71 2063 0.01% 72 2267 0.02% 73 2562 0.02% 74 2699 0.02% 75 3142 0.02% 76 3295 0.02% 77 3656 0.03% 78 4092 0.03% 79 4507 0.03% 80 4771 0.03% 81 5370 0.04% 82 5953 0.04% 83 6602 0.05% 84 7217 0.05% 85 8138 0.06% 86 8823 0.06% 87 9557 0.07% 88 10594 0.07% 89 11312 0.08% 90 12039 0.08% 91 13210 0.09% 92 14364 0.10% 93 15315 0.11% 94 16816 0.12% 95 18287 0.13% 96 19295 0.14% 97 20647 0.15% 98 21805 0.15% 99 23117 0.16% 100 24198 0.17% 101 26068 0.18% 102 27233 0.19% 103 28276 0.20% 104 29565 0.21% 105 31294 0.22% 106 33048 0.23% 107 34480 0.24% 108 36189 0.26% 109 38315 0.27% 110 39618 0.28% 111 40942 0.29% 112 42704 0.30% 113 44051 0.31% 114 45612 0.32% 115 47853 0.34% 116 49852 0.35% 117 51627 0.36% 118 53531 0.38% 119 54853 0.39% 120 57059 0.40% 121 58380 0.41% 122 59833 0.42% 123 61942 0.44% 124 63676 0.45% 125 65245 0.46% 126 67504 0.48% 127 69271 0.49% 128 70657 0.50% 129 72831 0.51% 130 75805 0.53% 131 76762 0.54% 132 78439 0.55% 133 80879 0.57% 134 81201 0.57% 135 83032 0.59% 136 84508 0.60% 137 85984 0.61% 138 87720 0.62% 139 90935 0.64% 140 91288 0.64% 141 93635 0.66% 142 95750 0.68% 143 96623 0.68% 144 98382 0.69% 145 99371 0.70% 146 100076 0.71% 147 102089 0.72% 148 103746 0.73% 149 103372 0.73% 150 104119 0.73% 151 10538942 74.31% 14181649 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=26 prefix-density=0.41 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=68.68 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.3 sequence=CTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCCTATTGGGATACCTCCCGTCCATTAAGTTAGGGCTTTCAGCCCTAATTAATGTCC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.84 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.16 sequence-density-rank=22 fanout-score=34.91 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=12.7 sequence=AAAGAAAAGAAAA SRR12690180 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:04:47 Started mapping on | Feb 10 21:04:47 Finished on | Feb 10 21:07:06 Mapping speed, Million of reads per hour | 367.29 Number of input reads | 14181649 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 13271708 Uniquely mapped reads % | 93.58% Average mapped length | 288.82 Number of splices: Total | 12727680 Number of splices: Annotated (sjdb) | 12460329 Number of splices: GT/AG | 12478349 Number of splices: GC/AG | 206027 Number of splices: AT/AC | 8953 Number of splices: Non-canonical | 34351 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311327 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 116731 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.18% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 598614 598614 598614 N_multimapping 311327 311327 311327 N_noFeature 423825 13118471 482960 N_ambiguous 172756 706 78251 UnstrandedReadsAssigned:12675127 PositiveStrandReadsAssigned:152531 NegativeStrandReadsAssigned:12710497 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR12690180 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690180-trimmed-pair1.fastq SRR12690180-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,181,649 reads, 12,863,276 reads pseudoaligned [quant] estimated average fragment length: 184.76 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR12690180.ke.tsv 34699 SRR12690180.se.tsv 87100 total ==> SRR12690180.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1834.24 292 11.3576 Potri.005G024800.1.v4.1 1035 851.24 105 8.80032 Potri.004G059700.1.v4.1 961 777.24 18 1.65226 Potri.007G009000.2.v4.1 1416 1232.24 0 0 Potri.003G141000.2.v4.1 2943 2759.24 481.381 12.4469 Potri.016G087400.1.v4.1 270 98.069 646 469.962 Potri.015G069301.1.v4.1 564 380.66 0 0 Potri.010G195200.1.v4.1 1773 1589.24 35 1.57123 Potri.012G127500.1.v4.1 977 793.24 311 27.9716 ==> SRR12690180.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 314 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 208 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 29 SRR12690180 completed mapping pipeline successfully