Starting /dee2/code/volunteer_pipeline.sh SRR12690181 current disk space = 3056952700928 free memory = 1286056508 SRR12690181 SRAfilesize f5bf0ad230e35adcb6af609469423ec1 SRR12690181.sra SRR12690181.sra file validated SRR12690181 is paired end SRR12690181 is conventional basespace SRR12690181 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690181_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.602 37.0 37.0 37.0 37.0 37.0 2 36.52225 37.0 37.0 37.0 37.0 37.0 3 36.66 37.0 37.0 37.0 37.0 37.0 4 36.613 37.0 37.0 37.0 37.0 37.0 5 36.6255 37.0 37.0 37.0 37.0 37.0 6 36.5555 37.0 37.0 37.0 37.0 37.0 7 36.521 37.0 37.0 37.0 37.0 37.0 8 36.681 37.0 37.0 37.0 37.0 37.0 9 36.6325 37.0 37.0 37.0 37.0 37.0 10-14 36.628 37.0 37.0 37.0 37.0 37.0 15-19 36.6138 37.0 37.0 37.0 37.0 37.0 20-24 36.5847 37.0 37.0 37.0 37.0 37.0 25-29 36.5734 37.0 37.0 37.0 37.0 37.0 30-34 36.5299 37.0 37.0 37.0 37.0 37.0 35-39 36.5346 37.0 37.0 37.0 37.0 37.0 40-44 36.5165 37.0 37.0 37.0 37.0 37.0 45-49 36.45 37.0 37.0 37.0 37.0 37.0 50-54 36.454299999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.4406 37.0 37.0 37.0 37.0 37.0 60-64 36.3525 37.0 37.0 37.0 37.0 37.0 65-69 36.3951 37.0 37.0 37.0 37.0 37.0 70-74 36.3607 37.0 37.0 37.0 37.0 37.0 75-79 36.3703 37.0 37.0 37.0 37.0 37.0 80-84 36.273 37.0 37.0 37.0 37.0 37.0 85-89 36.321600000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.2489 37.0 37.0 37.0 37.0 37.0 95-99 36.22689999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.158500000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.130399999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1328 37.0 37.0 37.0 37.0 37.0 115-119 36.1081 37.0 37.0 37.0 37.0 37.0 120-124 36.0757 37.0 37.0 37.0 37.0 37.0 125-129 36.0252 37.0 37.0 37.0 37.0 37.0 130-134 35.978300000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.0207 37.0 37.0 37.0 37.0 37.0 140-144 35.7888 37.0 37.0 37.0 37.0 37.0 145-149 35.7693 37.0 37.0 37.0 37.0 37.0 150-151 35.53725 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 0.0 25 4.0 26 4.0 27 3.0 28 13.0 29 12.0 30 14.0 31 41.0 32 47.0 33 82.0 34 109.0 35 307.0 36 3003.0 37 360.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.35 12.225 8.05 39.375 2 20.79679278376347 12.82886494612879 34.602856426960656 31.77148584314708 3 17.525 16.05 28.4 38.025 4 21.95 23.45 25.924999999999997 28.675 5 23.35 28.575 25.900000000000002 22.175 6 20.375 33.6 23.474999999999998 22.55 7 15.8 28.449999999999996 38.4 17.349999999999998 8 18.875 26.325 30.75 24.05 9 17.7 24.2 35.475 22.625 10-14 20.165 29.32 27.195000000000004 23.32 15-19 19.725 27.975 28.01 24.29 20-24 20.424999999999997 27.994999999999997 27.88 23.7 25-29 19.84 28.449999999999996 27.74 23.97 30-34 20.169999999999998 28.199999999999996 27.950000000000003 23.68 35-39 20.5 28.000000000000004 27.395000000000003 24.104999999999997 40-44 20.375 28.405 27.150000000000002 24.07 45-49 20.105 27.85 27.905 24.14 50-54 20.34 28.244999999999997 27.245 24.169999999999998 55-59 20.599999999999998 28.26 27.63 23.51 60-64 20.24 28.000000000000004 27.925 23.835 65-69 19.825 27.71 27.805000000000003 24.66 70-74 20.78 27.944999999999997 27.62 23.655 75-79 19.955000000000002 28.32 27.975 23.75 80-84 20.495 27.965 27.700000000000003 23.84 85-89 20.974999999999998 27.839999999999996 27.839999999999996 23.345 90-94 20.41 28.395 27.08 24.115000000000002 95-99 20.135 28.505000000000003 27.889999999999997 23.47 100-104 20.39 28.050000000000004 27.01 24.55 105-109 20.385 28.615000000000002 27.650000000000002 23.35 110-114 20.990000000000002 28.499999999999996 27.029999999999998 23.48 115-119 21.195 27.85 27.12 23.835 120-124 20.5 27.875 27.72 23.905 125-129 21.16 28.205000000000002 26.945000000000004 23.69 130-134 20.724999999999998 28.660000000000004 26.855 23.76 135-139 21.965 27.49 26.674999999999997 23.87 140-144 21.11 27.915 27.134999999999998 23.84 145-149 21.855 28.405 26.66 23.080000000000002 150-151 20.8 28.375 26.8375 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.5 24 3.0 25 4.0 26 5.0 27 5.0 28 7.5 29 14.5 30 16.0 31 17.0 32 29.0 33 40.5 34 47.5 35 61.0 36 75.5 37 81.5 38 104.5 39 147.0 40 190.5 41 213.5 42 239.0 43 257.0 44 260.0 45 290.0 46 283.0 47 240.0 48 217.5 49 202.0 50 187.5 51 170.5 52 137.5 53 100.0 54 80.5 55 75.0 56 59.0 57 36.0 58 25.0 59 18.0 60 16.5 61 17.5 62 10.5 63 3.5 64 2.0 65 2.0 66 2.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.25 #Duplication Level Percentage of deduplicated Percentage of total 1 89.69187675070029 80.05 2 8.907563025210084 15.9 3 1.204481792717087 3.225 4 0.1400560224089636 0.5 5 0.028011204481792715 0.125 6 0.0 0.0 7 0.0 0.0 8 0.028011204481792715 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTGCTAGGGTGCGTCCATCTTCCAACTGCTTTCCGGCAAAGATCAACC 8 0.2 No Hit CCACAGGTAGCGTTAGACTCATCCATGGCCAAAATACCTCGGCCAGGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.475 0.0 0.0 0.0 0.0 120-121 3.8 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.925 0.0 0.0 0.0 0.0 126-127 5.425000000000001 0.0 0.0 0.0 0.0 128-129 5.8125 0.0 0.0 0.0 0.0 130-131 6.3 0.0 0.0 0.0 0.0 132-133 6.800000000000001 0.0 0.0 0.0 0.0 134-135 7.225 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690181 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690181_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.409 37.0 37.0 37.0 37.0 37.0 2 36.0415 37.0 37.0 37.0 37.0 37.0 3 36.1945 37.0 37.0 37.0 37.0 37.0 4 36.296 37.0 37.0 37.0 37.0 37.0 5 36.431 37.0 37.0 37.0 37.0 37.0 6 36.274 37.0 37.0 37.0 37.0 37.0 7 36.3025 37.0 37.0 37.0 37.0 37.0 8 36.37 37.0 37.0 37.0 37.0 37.0 9 36.403 37.0 37.0 37.0 37.0 37.0 10-14 36.3671 37.0 37.0 37.0 37.0 37.0 15-19 36.3076 37.0 37.0 37.0 37.0 37.0 20-24 36.3053 37.0 37.0 37.0 37.0 37.0 25-29 36.290400000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2698 37.0 37.0 37.0 37.0 37.0 35-39 36.2555 37.0 37.0 37.0 37.0 37.0 40-44 36.1389 37.0 37.0 37.0 37.0 37.0 45-49 36.1755 37.0 37.0 37.0 37.0 37.0 50-54 36.1721 37.0 37.0 37.0 37.0 37.0 55-59 36.1579 37.0 37.0 37.0 37.0 37.0 60-64 36.1125 37.0 37.0 37.0 37.0 37.0 65-69 36.0866 37.0 37.0 37.0 37.0 37.0 70-74 35.974199999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.005399999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0048 37.0 37.0 37.0 37.0 37.0 85-89 36.0461 37.0 37.0 37.0 37.0 37.0 90-94 35.857 37.0 37.0 37.0 37.0 37.0 95-99 35.9809 37.0 37.0 37.0 37.0 37.0 100-104 35.9613 37.0 37.0 37.0 37.0 37.0 105-109 35.9443 37.0 37.0 37.0 37.0 37.0 110-114 35.8466 37.0 37.0 37.0 37.0 37.0 115-119 35.734899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7898 37.0 37.0 37.0 37.0 37.0 125-129 35.6893 37.0 37.0 37.0 37.0 37.0 130-134 35.6239 37.0 37.0 37.0 37.0 37.0 135-139 35.535199999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.4896 37.0 37.0 37.0 37.0 37.0 145-149 35.390499999999996 37.0 37.0 37.0 34.6 37.0 150-151 34.991 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 2.0 15 2.0 16 3.0 17 1.0 18 1.0 19 0.0 20 1.0 21 3.0 22 6.0 23 3.0 24 5.0 25 3.0 26 4.0 27 13.0 28 9.0 29 18.0 30 26.0 31 32.0 32 58.0 33 95.0 34 156.0 35 463.0 36 2808.0 37 284.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.724999999999994 24.275 11.375 26.625 2 28.875 27.3 28.125 15.7 3 21.0 27.800000000000004 31.3 19.900000000000002 4 23.9 34.575 23.799999999999997 17.724999999999998 5 25.25 35.925000000000004 22.7 16.125 6 19.75 39.300000000000004 22.375 18.575 7 20.125 22.725 37.625 19.525000000000002 8 20.549999999999997 26.150000000000002 27.875 25.424999999999997 9 20.75 25.124999999999996 30.225 23.9 10-14 23.235 29.299999999999997 26.11 21.355 15-19 23.080000000000002 28.134999999999998 27.605 21.18 20-24 22.765 28.994999999999997 27.26 20.979999999999997 25-29 23.215 27.76 28.349999999999998 20.674999999999997 30-34 22.745 28.37 27.939999999999998 20.945 35-39 22.515 28.325 27.544999999999998 21.615000000000002 40-44 22.57 28.24 28.18 21.01 45-49 22.86 28.134999999999998 27.72 21.285 50-54 22.675 28.215 27.935 21.175 55-59 22.74 27.785 27.96 21.515 60-64 22.55 28.025 27.92 21.505 65-69 23.455000000000002 28.42 27.18 20.945 70-74 23.0 27.915 27.485 21.6 75-79 22.42 27.894999999999996 27.92 21.765 80-84 23.035 27.83 27.944999999999997 21.19 85-89 23.105 27.689999999999998 27.810000000000002 21.395 90-94 23.635 27.785 27.21 21.37 95-99 23.865 27.925 27.63 20.580000000000002 100-104 23.455000000000002 28.325 27.54 20.68 105-109 23.78 27.955000000000002 27.77 20.495 110-114 23.25 29.09 27.01 20.65 115-119 24.34 28.96 26.484999999999996 20.215 120-124 24.695 28.205000000000002 27.105 19.994999999999997 125-129 24.515 28.084999999999997 26.790000000000003 20.61 130-134 25.085 28.044999999999998 26.375 20.495 135-139 25.445 27.63 27.36 19.564999999999998 140-144 25.840000000000003 27.47 26.405 20.285 145-149 26.495 27.215 26.314999999999998 19.975 150-151 26.637499999999996 28.812500000000004 26.137500000000003 18.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 2.0 17 1.5 18 1.0 19 2.5 20 3.5 21 1.5 22 1.5 23 1.5 24 1.0 25 4.0 26 5.0 27 5.5 28 4.5 29 6.5 30 12.5 31 24.0 32 30.0 33 33.0 34 45.5 35 70.0 36 97.5 37 125.5 38 152.5 39 187.0 40 201.5 41 207.5 42 235.0 43 255.0 44 259.5 45 251.0 46 245.0 47 238.5 48 218.0 49 201.0 50 174.5 51 141.0 52 110.5 53 82.0 54 72.0 55 61.5 56 51.0 57 39.5 58 25.5 59 21.5 60 22.5 61 15.0 62 10.5 63 11.5 64 8.5 65 2.0 66 1.0 67 3.0 68 2.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.525 #Duplication Level Percentage of deduplicated Percentage of total 1 89.9748673554873 80.55 2 8.656799776598715 15.5 3 1.1728567439262776 3.15 4 0.16755096341803966 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027925160569673275 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACCCTTCACTTGGTGCTTCGGCTGCGTGGAGGAATGCAAATCTTTGTT 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.1625 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.475 0.0 0.0 0.0 0.0 120-121 3.8 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.9375 0.0 0.0 0.0 0.0 126-127 5.449999999999999 0.0 0.0 0.0 0.0 128-129 5.824999999999999 0.0 0.0 0.0 0.0 130-131 6.3 0.0 0.0 0.0 0.0 132-133 6.825 0.0 0.0 0.0 0.0 134-135 7.3125 0.0 0.0 0.0 0.0 136-137 7.9125000000000005 0.0 0.0 0.0 0.0 138-139 8.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 41.428574 145 AAAAAAA 115 1.9681378E-4 11.347827 10-14 >>END_MODULE Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651550 spots for SRR12690181.sra Written 651550 spots for SRR12690181.sra Read 651563 spots for SRR12690181.sra Written 651563 spots for SRR12690181.sra SRR ids: ['SRR12690181.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nhl6azcg SRR12690181.sra spots: 13031013 blocks: [[1, 651550], [651551, 1303100], [1303101, 1954650], [1954651, 2606200], [2606201, 3257750], [3257751, 3909300], [3909301, 4560850], [4560851, 5212400], [5212401, 5863950], [5863951, 6515500], [6515501, 7167050], [7167051, 7818600], [7818601, 8470150], [8470151, 9121700], [9121701, 9773250], [9773251, 10424800], [10424801, 11076350], [11076351, 11727900], [11727901, 12379450], [12379451, 13031013]] SRR12690181 file size 4406807 SRR12690181 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690181 SRR12690181_1.fastq SRR12690181_2.fastq Input file: SRR12690181_1.fastq Paired file: SRR12690181_2.fastq trimmed: SRR12690181-trimmed-pair1.fastq, SRR12690181-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:19:45 2025 >> started Mon Feb 10 21:20:05 2025 >> done (20.400s) 13031013 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 4590 ( 0.04%) empty read pairs filtered out after trimming by size control 13026400 (99.96%) read pairs available; of these: 1723642 (13.23%) trimmed read pairs available after processing 11302758 (86.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 8 0.00% 21 6 0.00% 22 6 0.00% 23 7 0.00% 24 11 0.00% 25 8 0.00% 26 19 0.00% 27 9 0.00% 28 9 0.00% 29 14 0.00% 30 14 0.00% 31 13 0.00% 32 19 0.00% 33 14 0.00% 34 16 0.00% 35 27 0.00% 36 17 0.00% 37 29 0.00% 38 19 0.00% 39 24 0.00% 40 33 0.00% 41 42 0.00% 42 24 0.00% 43 22 0.00% 44 25 0.00% 45 46 0.00% 46 27 0.00% 47 43 0.00% 48 73 0.00% 49 55 0.00% 50 74 0.00% 51 76 0.00% 52 88 0.00% 53 97 0.00% 54 110 0.00% 55 109 0.00% 56 111 0.00% 57 151 0.00% 58 155 0.00% 59 202 0.00% 60 211 0.00% 61 249 0.00% 62 272 0.00% 63 279 0.00% 64 309 0.00% 65 382 0.00% 66 434 0.00% 67 466 0.00% 68 560 0.00% 69 552 0.00% 70 707 0.01% 71 800 0.01% 72 896 0.01% 73 1126 0.01% 74 1186 0.01% 75 1278 0.01% 76 1321 0.01% 77 1587 0.01% 78 1751 0.01% 79 1900 0.01% 80 2114 0.02% 81 2442 0.02% 82 2686 0.02% 83 3104 0.02% 84 3325 0.03% 85 3794 0.03% 86 4080 0.03% 87 4519 0.03% 88 4895 0.04% 89 5246 0.04% 90 5687 0.04% 91 6176 0.05% 92 6753 0.05% 93 7090 0.05% 94 7719 0.06% 95 8369 0.06% 96 8992 0.07% 97 9778 0.08% 98 10023 0.08% 99 10723 0.08% 100 11530 0.09% 101 11963 0.09% 102 12787 0.10% 103 13552 0.10% 104 14104 0.11% 105 14662 0.11% 106 15472 0.12% 107 16369 0.13% 108 16897 0.13% 109 17737 0.14% 110 18414 0.14% 111 18925 0.15% 112 20099 0.15% 113 20631 0.16% 114 21393 0.16% 115 22604 0.17% 116 23554 0.18% 117 24555 0.19% 118 25261 0.19% 119 25371 0.19% 120 26940 0.21% 121 27721 0.21% 122 28281 0.22% 123 29542 0.23% 124 30548 0.23% 125 31157 0.24% 126 31821 0.24% 127 32570 0.25% 128 33090 0.25% 129 34456 0.26% 130 35352 0.27% 131 35981 0.28% 132 36754 0.28% 133 37878 0.29% 134 38515 0.30% 135 39473 0.30% 136 40374 0.31% 137 40845 0.31% 138 41674 0.32% 139 43244 0.33% 140 43618 0.33% 141 44481 0.34% 142 45746 0.35% 143 46836 0.36% 144 46734 0.36% 145 48631 0.37% 146 48920 0.38% 147 49090 0.38% 148 50314 0.39% 149 49962 0.38% 150 51580 0.40% 151 11302758 86.77% 13026400 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=12 prefix-density=0.52 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=43.42 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.4 sequence=CCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=21 prefix-density=0.67 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=73.06 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.7 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12690181 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:20:47 Started mapping on | Feb 10 21:20:47 Finished on | Feb 10 21:22:11 Mapping speed, Million of reads per hour | 558.27 Number of input reads | 13026400 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12321475 Uniquely mapped reads % | 94.59% Average mapped length | 294.74 Number of splices: Total | 12127519 Number of splices: Annotated (sjdb) | 11859708 Number of splices: GT/AG | 11889895 Number of splices: GC/AG | 193649 Number of splices: AT/AC | 8463 Number of splices: Non-canonical | 35512 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299123 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 112736 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 405802 405802 405802 N_multimapping 299123 299123 299123 N_noFeature 504201 12169428 558319 N_ambiguous 171278 778 72836 UnstrandedReadsAssigned:11645996 PositiveStrandReadsAssigned:151269 NegativeStrandReadsAssigned:11690320 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690181 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690181-trimmed-pair1.fastq SRR12690181-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,026,400 reads, 11,795,404 reads pseudoaligned [quant] estimated average fragment length: 235.923 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR12690181.ke.tsv 34699 SRR12690181.se.tsv 87100 total ==> SRR12690181.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.08 342 15.1489 Potri.005G024800.1.v4.1 1035 800.077 213 21.0268 Potri.004G059700.1.v4.1 961 726.116 9 0.978953 Potri.007G009000.2.v4.1 1416 1181.08 0 0 Potri.003G141000.2.v4.1 2943 2708.08 523.425 15.2658 Potri.016G087400.1.v4.1 270 86.5061 465 424.552 Potri.015G069301.1.v4.1 564 335.686 0 0 Potri.010G195200.1.v4.1 1773 1538.08 14 0.718911 Potri.012G127500.1.v4.1 977 742.102 159 16.9223 ==> SRR12690181.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 377 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 32 SRR12690181 completed mapping pipeline successfully