Starting /dee2/code/volunteer_pipeline.sh SRR12690182 current disk space = 3057027829760 free memory = 1479568284 SRR12690182 SRAfilesize 705447a655c1602f664a63f028f04833 SRR12690182.sra SRR12690182.sra file validated SRR12690182 is paired end SRR12690182 is conventional basespace SRR12690182 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690182_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.625 37.0 37.0 37.0 37.0 37.0 2 36.44075 37.0 37.0 37.0 37.0 37.0 3 36.594 37.0 37.0 37.0 37.0 37.0 4 36.6485 37.0 37.0 37.0 37.0 37.0 5 36.682 37.0 37.0 37.0 37.0 37.0 6 36.58 37.0 37.0 37.0 37.0 37.0 7 36.5695 37.0 37.0 37.0 37.0 37.0 8 36.5845 37.0 37.0 37.0 37.0 37.0 9 36.62 37.0 37.0 37.0 37.0 37.0 10-14 36.6022 37.0 37.0 37.0 37.0 37.0 15-19 36.5946 37.0 37.0 37.0 37.0 37.0 20-24 36.6044 37.0 37.0 37.0 37.0 37.0 25-29 36.5678 37.0 37.0 37.0 37.0 37.0 30-34 36.5186 37.0 37.0 37.0 37.0 37.0 35-39 36.4903 37.0 37.0 37.0 37.0 37.0 40-44 36.508700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.438300000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4721 37.0 37.0 37.0 37.0 37.0 55-59 36.4101 37.0 37.0 37.0 37.0 37.0 60-64 36.390699999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.407799999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.3417 37.0 37.0 37.0 37.0 37.0 75-79 36.342 37.0 37.0 37.0 37.0 37.0 80-84 36.2709 37.0 37.0 37.0 37.0 37.0 85-89 36.2798 37.0 37.0 37.0 37.0 37.0 90-94 36.2757 37.0 37.0 37.0 37.0 37.0 95-99 36.2451 37.0 37.0 37.0 37.0 37.0 100-104 36.188300000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.171299999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.158 37.0 37.0 37.0 37.0 37.0 115-119 36.096599999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.0653 37.0 37.0 37.0 37.0 37.0 125-129 36.037800000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.047700000000006 37.0 37.0 37.0 37.0 37.0 135-139 36.058 37.0 37.0 37.0 37.0 37.0 140-144 35.8232 37.0 37.0 37.0 37.0 37.0 145-149 35.820899999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.52275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 3.0 26 5.0 27 7.0 28 9.0 29 13.0 30 34.0 31 46.0 32 50.0 33 62.0 34 103.0 35 254.0 36 2976.0 37 436.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.15 13.025 9.125 41.699999999999996 2 20.84903290630495 12.308465209746295 33.98643556895252 32.85606631499623 3 15.45 13.900000000000002 29.65 41.0 4 19.875 21.55 26.700000000000003 31.874999999999996 5 22.85 27.875 25.900000000000002 23.375 6 22.025 31.0 24.425 22.55 7 17.25 26.650000000000002 37.95 18.15 8 18.55 26.724999999999998 31.85 22.875 9 17.65 25.025 34.0 23.325000000000003 10-14 19.63 28.62 28.075 23.674999999999997 15-19 20.255000000000003 26.56 28.33 24.855 20-24 20.015 27.275 28.275 24.435000000000002 25-29 20.23 27.42 27.884999999999998 24.465 30-34 20.46 27.595 26.895000000000003 25.05 35-39 19.96 27.42 27.894999999999996 24.725 40-44 20.77 27.875 27.089999999999996 24.265 45-49 20.645 27.66 27.175 24.52 50-54 20.585 27.839999999999996 27.495000000000005 24.08 55-59 20.655 27.155 27.37 24.82 60-64 20.89 27.24 27.605 24.265 65-69 20.9 26.51 27.339999999999996 25.25 70-74 22.035 27.200000000000003 26.729999999999997 24.035 75-79 20.495 26.83 28.16 24.515 80-84 21.044999999999998 26.455000000000002 27.715 24.785 85-89 21.38 26.889999999999997 27.58 24.15 90-94 21.45 26.63 27.015 24.905 95-99 21.315 27.22 27.205000000000002 24.26 100-104 20.93 26.955000000000002 27.589999999999996 24.525 105-109 21.165 26.655 27.36 24.82 110-114 21.240000000000002 26.905 27.195000000000004 24.66 115-119 21.525 26.979999999999997 27.47 24.025 120-124 21.654999999999998 27.065 26.555 24.725 125-129 21.865000000000002 26.915 27.43 23.79 130-134 21.395 26.555 27.775 24.275 135-139 21.895 26.935 26.939999999999998 24.23 140-144 22.21 26.75 27.084999999999997 23.955000000000002 145-149 21.495 26.815 26.865 24.825 150-151 21.8625 27.287499999999998 26.737499999999997 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.5 27 4.5 28 5.0 29 4.5 30 8.5 31 13.5 32 15.5 33 20.0 34 32.0 35 51.0 36 60.5 37 69.0 38 100.5 39 118.0 40 143.5 41 195.5 42 223.0 43 248.5 44 268.5 45 258.0 46 258.5 47 274.0 48 263.0 49 242.5 50 227.5 51 186.0 52 149.5 53 131.0 54 100.0 55 73.0 56 65.5 57 52.0 58 33.0 59 28.0 60 24.0 61 16.0 62 12.0 63 9.0 64 5.0 65 2.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.24931205283434 82.89999999999999 2 7.760044028618602 14.099999999999998 3 0.6879471656576774 1.875 4 0.27517886626307103 1.0 5 0.0275178866263071 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCTGCAAATATCTTGATCTTTTCTGCTCGTTCAGCCCCCAGCAGAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.4000000000000004 0.0 0.0 0.0 0.0 114-115 2.8 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.1 0.0 0.0 0.0 0.0 122-123 4.5375 0.0 0.0 0.0 0.0 124-125 5.0 0.0 0.0 0.0 0.0 126-127 5.4125 0.0 0.0 0.0 0.0 128-129 5.975 0.0 0.0 0.0 0.0 130-131 6.4125 0.0 0.0 0.0 0.0 132-133 7.0375 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGTGTC 10 0.006830828 145.0 7 >>END_MODULE SRR12690182 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690182_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3275 37.0 37.0 37.0 37.0 37.0 2 36.0365 37.0 37.0 37.0 37.0 37.0 3 36.117 37.0 37.0 37.0 37.0 37.0 4 36.285 37.0 37.0 37.0 37.0 37.0 5 36.341 37.0 37.0 37.0 37.0 37.0 6 36.1775 37.0 37.0 37.0 37.0 37.0 7 36.1405 37.0 37.0 37.0 37.0 37.0 8 36.4035 37.0 37.0 37.0 37.0 37.0 9 36.31 37.0 37.0 37.0 37.0 37.0 10-14 36.3312 37.0 37.0 37.0 37.0 37.0 15-19 36.255300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.3096 37.0 37.0 37.0 37.0 37.0 25-29 36.2947 37.0 37.0 37.0 37.0 37.0 30-34 36.1983 37.0 37.0 37.0 37.0 37.0 35-39 36.211 37.0 37.0 37.0 37.0 37.0 40-44 36.1713 37.0 37.0 37.0 37.0 37.0 45-49 36.15079999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.1354 37.0 37.0 37.0 37.0 37.0 55-59 36.0956 37.0 37.0 37.0 37.0 37.0 60-64 36.0834 37.0 37.0 37.0 37.0 37.0 65-69 36.0215 37.0 37.0 37.0 37.0 37.0 70-74 36.0698 37.0 37.0 37.0 37.0 37.0 75-79 35.987399999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.951 37.0 37.0 37.0 37.0 37.0 85-89 35.9983 37.0 37.0 37.0 37.0 37.0 90-94 35.8593 37.0 37.0 37.0 37.0 37.0 95-99 35.9307 37.0 37.0 37.0 37.0 37.0 100-104 35.992 37.0 37.0 37.0 37.0 37.0 105-109 35.921299999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.8067 37.0 37.0 37.0 37.0 37.0 115-119 35.7756 37.0 37.0 37.0 37.0 37.0 120-124 35.7139 37.0 37.0 37.0 37.0 37.0 125-129 35.674699999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.5381 37.0 37.0 37.0 37.0 37.0 135-139 35.532799999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.4136 37.0 37.0 37.0 37.0 37.0 145-149 35.2031 37.0 37.0 37.0 32.2 37.0 150-151 34.7845 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 1.0 14 2.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 0.0 21 2.0 22 1.0 23 4.0 24 5.0 25 4.0 26 8.0 27 17.0 28 15.0 29 16.0 30 23.0 31 46.0 32 48.0 33 84.0 34 158.0 35 627.0 36 2684.0 37 250.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.55 25.1 10.575 27.775 2 28.625 28.075 26.674999999999997 16.625 3 20.05 29.349999999999998 28.65 21.95 4 24.075 33.45 23.45 19.025 5 25.55 35.925000000000004 21.525 17.0 6 21.3 39.4 20.9 18.4 7 21.625 23.974999999999998 35.725 18.675 8 21.825 26.35 26.3 25.525 9 22.15 25.575 29.5 22.775000000000002 10-14 23.71 29.955 24.82 21.515 15-19 23.865 28.544999999999998 26.0 21.59 20-24 23.52 28.17 26.69 21.62 25-29 23.765 27.845 26.775 21.615000000000002 30-34 23.43 28.43 26.47 21.67 35-39 23.59 27.655 26.855 21.9 40-44 23.27 27.61 27.1 22.02 45-49 23.375 27.92 26.855 21.85 50-54 23.244999999999997 28.165000000000003 26.615 21.975 55-59 23.93 27.915 26.505000000000003 21.65 60-64 23.799999999999997 27.88 26.685 21.634999999999998 65-69 24.215 26.889999999999997 26.974999999999998 21.92 70-74 23.95 28.125 25.8 22.125 75-79 23.605 27.965 25.990000000000002 22.439999999999998 80-84 23.735 27.985 25.85 22.43 85-89 23.945 27.224999999999998 26.99 21.84 90-94 23.995 27.834999999999997 26.35 21.82 95-99 24.305 27.875 26.255 21.565 100-104 24.02 27.815 26.229999999999997 21.935 105-109 24.435000000000002 27.955000000000002 26.38 21.23 110-114 25.040000000000003 28.025 25.869999999999997 21.065 115-119 25.14 27.865000000000002 26.035000000000004 20.96 120-124 25.085 27.810000000000002 26.87 20.235 125-129 25.41 27.99 25.814999999999998 20.785 130-134 25.885 27.155 26.445 20.515 135-139 25.545 27.485 26.424999999999997 20.544999999999998 140-144 26.525 27.27 26.1 20.105 145-149 26.369999999999997 27.555000000000003 26.1 19.975 150-151 27.1 26.6 26.150000000000002 20.150000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.5 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 1.5 22 0.5 23 0.5 24 2.0 25 3.0 26 1.5 27 3.5 28 6.0 29 6.0 30 6.0 31 9.0 32 15.0 33 16.0 34 23.5 35 39.0 36 50.0 37 67.5 38 96.0 39 132.0 40 166.5 41 194.5 42 232.5 43 262.0 44 275.5 45 276.0 46 273.0 47 270.0 48 243.0 49 238.0 50 216.0 51 167.0 52 137.0 53 117.5 54 105.0 55 80.5 56 66.5 57 56.0 58 35.0 59 25.0 60 26.0 61 19.0 62 9.5 63 6.0 64 3.5 65 2.0 66 1.5 67 0.5 68 1.0 69 2.0 70 1.5 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.26240352811466 82.775 2 7.635060639470782 13.850000000000001 3 0.8820286659316428 2.4 4 0.11025358324145534 0.4 5 0.027563395810363836 0.125 6 0.08269018743109151 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 6 0.15 No Hit CGAAAGACAGAGCTGTTCATGGCCCTTATTGAGAAGAAATTGTTACCTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.2125 0.0 0.0 0.0 0.0 118-119 3.7125 0.0 0.0 0.0 0.0 120-121 4.075 0.0 0.0 0.0 0.0 122-123 4.512499999999999 0.0 0.0 0.0 0.0 124-125 4.975 0.0 0.0 0.0 0.0 126-127 5.4125 0.0 0.0 0.0 0.0 128-129 5.9625 0.0 0.0 0.0 0.0 130-131 6.4125 0.0 0.0 0.0 0.0 132-133 7.0375 0.0 0.0 0.0 0.0 134-135 7.425000000000001 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATAC 10 0.006830828 145.0 3 GAAACAG 10 0.006830828 145.0 1 AAACAGC 10 0.006830828 145.0 2 CATTCAT 10 0.006830828 145.0 1 ATACTCC 10 0.006830828 145.0 6 CATACTC 10 0.006830828 145.0 5 TCATACT 10 0.006830828 145.0 4 >>END_MODULE Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898273 spots for SRR12690182.sra Written 898273 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra Read 898260 spots for SRR12690182.sra Written 898260 spots for SRR12690182.sra SRR ids: ['SRR12690182.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_67fmbicm SRR12690182.sra spots: 17965213 blocks: [[1, 898260], [898261, 1796520], [1796521, 2694780], [2694781, 3593040], [3593041, 4491300], [4491301, 5389560], [5389561, 6287820], [6287821, 7186080], [7186081, 8084340], [8084341, 8982600], [8982601, 9880860], [9880861, 10779120], [10779121, 11677380], [11677381, 12575640], [12575641, 13473900], [13473901, 14372160], [14372161, 15270420], [15270421, 16168680], [16168681, 17066940], [17066941, 17965213]] SRR12690182 file size 6083664 SRR12690182 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690182 SRR12690182_1.fastq SRR12690182_2.fastq Input file: SRR12690182_1.fastq Paired file: SRR12690182_2.fastq trimmed: SRR12690182-trimmed-pair1.fastq, SRR12690182-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:45:38 2025 >> started Mon Feb 10 21:46:00 2025 >> done (21.858s) 17965213 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 12857 ( 0.07%) empty read pairs filtered out after trimming by size control 17952330 (99.93%) read pairs available; of these: 2356399 (13.13%) trimmed read pairs available after processing 15595931 (86.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 8 0.00% 21 6 0.00% 22 5 0.00% 23 6 0.00% 24 10 0.00% 25 19 0.00% 26 17 0.00% 27 18 0.00% 28 20 0.00% 29 24 0.00% 30 27 0.00% 31 25 0.00% 32 24 0.00% 33 35 0.00% 34 28 0.00% 35 24 0.00% 36 25 0.00% 37 35 0.00% 38 37 0.00% 39 38 0.00% 40 44 0.00% 41 46 0.00% 42 39 0.00% 43 58 0.00% 44 51 0.00% 45 49 0.00% 46 41 0.00% 47 75 0.00% 48 73 0.00% 49 92 0.00% 50 103 0.00% 51 119 0.00% 52 142 0.00% 53 120 0.00% 54 138 0.00% 55 171 0.00% 56 151 0.00% 57 186 0.00% 58 234 0.00% 59 223 0.00% 60 270 0.00% 61 308 0.00% 62 375 0.00% 63 381 0.00% 64 455 0.00% 65 475 0.00% 66 530 0.00% 67 608 0.00% 68 675 0.00% 69 819 0.00% 70 945 0.01% 71 897 0.00% 72 1078 0.01% 73 1260 0.01% 74 1399 0.01% 75 1502 0.01% 76 1768 0.01% 77 1964 0.01% 78 2062 0.01% 79 2410 0.01% 80 2629 0.01% 81 3035 0.02% 82 3505 0.02% 83 3708 0.02% 84 4102 0.02% 85 4627 0.03% 86 4941 0.03% 87 5492 0.03% 88 6213 0.03% 89 6390 0.04% 90 6970 0.04% 91 7755 0.04% 92 8620 0.05% 93 9168 0.05% 94 9710 0.05% 95 10574 0.06% 96 11175 0.06% 97 12097 0.07% 98 12932 0.07% 99 13755 0.08% 100 14491 0.08% 101 15257 0.08% 102 16129 0.09% 103 16875 0.09% 104 18058 0.10% 105 18949 0.11% 106 19785 0.11% 107 21090 0.12% 108 21910 0.12% 109 22785 0.13% 110 23528 0.13% 111 24747 0.14% 112 26119 0.15% 113 26862 0.15% 114 28226 0.16% 115 29274 0.16% 116 30552 0.17% 117 31848 0.18% 118 33182 0.18% 119 34066 0.19% 120 35790 0.20% 121 36362 0.20% 122 37812 0.21% 123 38883 0.22% 124 40589 0.23% 125 41615 0.23% 126 42831 0.24% 127 44945 0.25% 128 46042 0.26% 129 47723 0.27% 130 48685 0.27% 131 49467 0.28% 132 51409 0.29% 133 52731 0.29% 134 53991 0.30% 135 55362 0.31% 136 56626 0.32% 137 57230 0.32% 138 58435 0.33% 139 60642 0.34% 140 61492 0.34% 141 63525 0.35% 142 64813 0.36% 143 66284 0.37% 144 67828 0.38% 145 69480 0.39% 146 70231 0.39% 147 70741 0.39% 148 73274 0.41% 149 73163 0.41% 150 74490 0.41% 151 15595931 86.87% 17952330 reads passed initial QC criterion=sequence-density sequence-density=1.08 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=9 prefix-density=1.10 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.22 sequence-density-rank=22 fanout-score=4.85 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=3.6 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=1.24 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=22 prefix-density=1.24 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=14.87 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.3 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12690182 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:46:46 Started mapping on | Feb 10 21:46:47 Finished on | Feb 10 21:48:52 Mapping speed, Million of reads per hour | 517.03 Number of input reads | 17952330 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16971545 Uniquely mapped reads % | 94.54% Average mapped length | 295.09 Number of splices: Total | 18093296 Number of splices: Annotated (sjdb) | 17752481 Number of splices: GT/AG | 17721752 Number of splices: GC/AG | 318912 Number of splices: AT/AC | 13376 Number of splices: Non-canonical | 39256 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 447314 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 214639 % of reads mapped to too many loci | 1.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.53% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 533471 533471 533471 N_multimapping 447314 447314 447314 N_noFeature 410607 16772546 457125 N_ambiguous 278902 908 125858 UnstrandedReadsAssigned:16282036 PositiveStrandReadsAssigned:198091 NegativeStrandReadsAssigned:16388562 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690182 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690182-trimmed-pair1.fastq SRR12690182-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,952,330 reads, 16,583,121 reads pseudoaligned [quant] estimated average fragment length: 226.267 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR12690182.ke.tsv 34699 SRR12690182.se.tsv 87100 total ==> SRR12690182.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.73 540 13.7622 Potri.005G024800.1.v4.1 1035 809.733 267 15.0654 Potri.004G059700.1.v4.1 961 735.744 67 4.16062 Potri.007G009000.2.v4.1 1416 1190.73 0 0 Potri.003G141000.2.v4.1 2943 2717.73 405.272 6.81319 Potri.016G087400.1.v4.1 270 84.9665 928.516 499.289 Potri.015G069301.1.v4.1 564 341.713 0 0 Potri.010G195200.1.v4.1 1773 1547.73 8 0.236159 Potri.012G127500.1.v4.1 977 751.744 596 36.2231 ==> SRR12690182.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 124 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 214 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12690182 completed mapping pipeline successfully