Starting /dee2/code/volunteer_pipeline.sh SRR12690183 current disk space = 3056932769792 free memory = 1194597240 SRR12690183 SRAfilesize c7c6d8a1880a570a7f8a9f5f2e713cc7 SRR12690183.sra SRR12690183.sra file validated SRR12690183 is paired end SRR12690183 is conventional basespace SRR12690183 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690183_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6135 37.0 37.0 37.0 37.0 37.0 2 36.37025 37.0 37.0 37.0 37.0 37.0 3 36.5965 37.0 37.0 37.0 37.0 37.0 4 36.605 37.0 37.0 37.0 37.0 37.0 5 36.6445 37.0 37.0 37.0 37.0 37.0 6 36.655 37.0 37.0 37.0 37.0 37.0 7 36.5815 37.0 37.0 37.0 37.0 37.0 8 36.6225 37.0 37.0 37.0 37.0 37.0 9 36.5505 37.0 37.0 37.0 37.0 37.0 10-14 36.5835 37.0 37.0 37.0 37.0 37.0 15-19 36.6229 37.0 37.0 37.0 37.0 37.0 20-24 36.5741 37.0 37.0 37.0 37.0 37.0 25-29 36.510200000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.5293 37.0 37.0 37.0 37.0 37.0 35-39 36.5284 37.0 37.0 37.0 37.0 37.0 40-44 36.4601 37.0 37.0 37.0 37.0 37.0 45-49 36.4639 37.0 37.0 37.0 37.0 37.0 50-54 36.400400000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.402699999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4115 37.0 37.0 37.0 37.0 37.0 65-69 36.3708 37.0 37.0 37.0 37.0 37.0 70-74 36.3262 37.0 37.0 37.0 37.0 37.0 75-79 36.3043 37.0 37.0 37.0 37.0 37.0 80-84 36.244299999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.339299999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.2981 37.0 37.0 37.0 37.0 37.0 95-99 36.1912 37.0 37.0 37.0 37.0 37.0 100-104 36.174499999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.176700000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.163599999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1188 37.0 37.0 37.0 37.0 37.0 120-124 36.020900000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.0209 37.0 37.0 37.0 37.0 37.0 130-134 35.9969 37.0 37.0 37.0 37.0 37.0 135-139 35.9624 37.0 37.0 37.0 37.0 37.0 140-144 35.797000000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.7583 37.0 37.0 37.0 37.0 37.0 150-151 35.58425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 0.0 24 2.0 25 1.0 26 1.0 27 5.0 28 11.0 29 25.0 30 27.0 31 31.0 32 41.0 33 63.0 34 102.0 35 316.0 36 2996.0 37 377.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.550000000000004 12.8 6.3 41.349999999999994 2 18.68242393764144 12.144832788534071 37.08825748051295 32.08448579331154 3 15.65 15.65 28.875 39.825 4 19.525000000000002 23.175 25.775 31.525 5 21.85 29.5 24.4 24.25 6 20.225 32.225 25.525 22.025 7 16.45 26.200000000000003 38.975 18.375 8 16.650000000000002 27.450000000000003 30.599999999999998 25.3 9 17.025000000000002 23.849999999999998 35.925000000000004 23.200000000000003 10-14 19.405 29.385 27.625 23.585 15-19 19.46 27.655 28.055000000000003 24.83 20-24 19.895 27.644999999999996 27.93 24.529999999999998 25-29 20.01 27.375 27.82 24.795 30-34 19.54 28.04 27.834999999999997 24.585 35-39 20.365 27.91 27.935 23.79 40-44 20.544999999999998 27.62 27.560000000000002 24.275 45-49 19.67 27.74 28.13 24.46 50-54 20.505000000000003 27.250000000000004 28.03 24.215 55-59 19.950000000000003 27.57 27.735 24.745 60-64 20.26 27.715 27.41 24.615000000000002 65-69 20.03 27.825 27.71 24.435000000000002 70-74 20.4 27.555000000000003 27.474999999999998 24.57 75-79 20.424999999999997 28.12 27.16 24.295 80-84 20.195 28.425 27.375 24.005000000000003 85-89 20.435 27.529999999999998 28.075 23.96 90-94 20.285 27.565 27.595 24.555 95-99 20.49 27.084999999999997 27.74 24.685000000000002 100-104 20.599999999999998 27.700000000000003 27.375 24.325 105-109 20.419999999999998 27.500000000000004 27.565 24.515 110-114 21.345 27.944999999999997 26.650000000000002 24.060000000000002 115-119 20.76 27.439999999999998 27.18 24.62 120-124 20.605 27.339999999999996 27.27 24.785 125-129 20.085 27.589999999999996 27.134999999999998 25.19 130-134 20.035 27.894999999999996 27.175 24.895 135-139 20.29 28.139999999999997 26.515 25.055 140-144 20.96 27.92 26.935 24.185000000000002 145-149 20.21 27.71 26.66 25.419999999999998 150-151 20.0125 27.925 26.2625 25.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 2.0 27 2.0 28 8.0 29 11.0 30 6.5 31 12.5 32 24.5 33 26.5 34 39.0 35 54.0 36 72.5 37 93.5 38 113.0 39 141.5 40 173.5 41 219.0 42 246.5 43 259.0 44 275.5 45 279.5 46 279.5 47 266.0 48 239.0 49 218.0 50 190.0 51 142.0 52 122.0 53 112.5 54 84.0 55 66.5 56 51.0 57 38.5 58 29.5 59 24.5 60 23.5 61 17.5 62 11.0 63 7.0 64 1.5 65 3.0 66 4.0 67 1.5 68 0.5 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.475 #Duplication Level Percentage of deduplicated Percentage of total 1 91.9103580213173 84.075 2 7.051106859797759 12.9 3 0.8472260180377154 2.325 4 0.19130910084722602 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.5125 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.9249999999999998 0.0 0.0 0.0 0.0 104-105 2.075 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.5999999999999996 0.0 0.0 0.0 0.0 110-111 2.95 0.0 0.0 0.0 0.0 112-113 3.4124999999999996 0.0 0.0 0.0 0.0 114-115 3.85 0.0 0.0 0.0 0.0 116-117 4.275 0.0 0.0 0.0 0.0 118-119 4.75 0.0 0.0 0.0 0.0 120-121 5.225 0.0 0.0 0.0 0.0 122-123 5.8625 0.0 0.0 0.0 0.0 124-125 6.4875 0.0 0.0 0.0 0.0 126-127 7.025 0.0 0.0 0.0 0.0 128-129 7.637499999999999 0.0 0.0 0.0 0.0 130-131 8.25 0.0 0.0 0.0 0.0 132-133 8.8 0.0 0.0 0.0 0.0 134-135 9.475000000000001 0.0 0.0 0.0 0.0 136-137 10.1625 0.0 0.0 0.0 0.0 138-139 10.912500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690183 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690183_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.304 37.0 37.0 37.0 37.0 37.0 2 36.004 37.0 37.0 37.0 37.0 37.0 3 36.039 37.0 37.0 37.0 37.0 37.0 4 36.056 37.0 37.0 37.0 37.0 37.0 5 36.329 37.0 37.0 37.0 37.0 37.0 6 36.205 37.0 37.0 37.0 37.0 37.0 7 36.28 37.0 37.0 37.0 37.0 37.0 8 36.2975 37.0 37.0 37.0 37.0 37.0 9 36.27 37.0 37.0 37.0 37.0 37.0 10-14 36.2912 37.0 37.0 37.0 37.0 37.0 15-19 36.2451 37.0 37.0 37.0 37.0 37.0 20-24 36.23870000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.1675 37.0 37.0 37.0 37.0 37.0 30-34 36.152 37.0 37.0 37.0 37.0 37.0 35-39 36.1539 37.0 37.0 37.0 37.0 37.0 40-44 36.1065 37.0 37.0 37.0 37.0 37.0 45-49 36.089600000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0749 37.0 37.0 37.0 37.0 37.0 55-59 36.056599999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9799 37.0 37.0 37.0 37.0 37.0 65-69 35.9692 37.0 37.0 37.0 37.0 37.0 70-74 35.8858 37.0 37.0 37.0 37.0 37.0 75-79 35.9678 37.0 37.0 37.0 37.0 37.0 80-84 35.91940000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8797 37.0 37.0 37.0 37.0 37.0 90-94 35.8361 37.0 37.0 37.0 37.0 37.0 95-99 35.8152 37.0 37.0 37.0 37.0 37.0 100-104 35.8685 37.0 37.0 37.0 37.0 37.0 105-109 35.8056 37.0 37.0 37.0 37.0 37.0 110-114 35.84 37.0 37.0 37.0 37.0 37.0 115-119 35.714999999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.6201 37.0 37.0 37.0 37.0 37.0 125-129 35.5767 37.0 37.0 37.0 37.0 37.0 130-134 35.4759 37.0 37.0 37.0 37.0 37.0 135-139 35.4295 37.0 37.0 37.0 37.0 37.0 140-144 35.2958 37.0 37.0 37.0 34.6 37.0 145-149 35.1634 37.0 37.0 37.0 29.8 37.0 150-151 34.82225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 5.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 6.0 22 3.0 23 3.0 24 3.0 25 5.0 26 8.0 27 9.0 28 21.0 29 30.0 30 31.0 31 34.0 32 55.0 33 98.0 34 183.0 35 580.0 36 2617.0 37 300.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.375 25.6 10.174999999999999 24.85 2 28.299999999999997 28.499999999999996 28.325 14.875 3 20.7 29.075 29.375 20.849999999999998 4 24.625 34.475 23.425 17.474999999999998 5 25.0 36.449999999999996 21.625 16.925 6 21.175 40.849999999999994 21.25 16.725 7 23.35 23.325000000000003 35.65 17.675 8 22.8 25.874999999999996 27.55 23.775 9 22.525000000000002 24.925 30.075000000000003 22.475 10-14 23.865 29.895 25.28 20.96 15-19 23.799999999999997 28.435 27.025 20.74 20-24 23.400000000000002 28.725 26.590000000000003 21.285 25-29 23.535 28.360000000000003 26.840000000000003 21.265 30-34 24.02 28.23 27.21 20.54 35-39 23.47 28.46 26.795 21.275 40-44 23.34 27.994999999999997 27.245 21.42 45-49 23.599999999999998 27.725 27.58 21.095 50-54 24.255 28.310000000000002 26.810000000000002 20.625 55-59 23.71 27.794999999999998 27.98 20.515 60-64 24.05 28.494999999999997 26.784999999999997 20.669999999999998 65-69 24.065 28.405 27.365000000000002 20.165 70-74 24.185000000000002 27.689999999999998 27.295 20.830000000000002 75-79 23.745 28.035 26.955000000000002 21.265 80-84 23.735 28.694999999999997 26.52 21.05 85-89 24.285 28.189999999999998 26.715 20.810000000000002 90-94 23.825 27.93 26.97 21.275 95-99 24.104999999999997 28.549999999999997 26.490000000000002 20.855 100-104 24.9 28.754999999999995 26.185000000000002 20.16 105-109 24.8 27.955000000000002 26.57 20.674999999999997 110-114 24.895 28.12 27.165 19.82 115-119 25.135 28.575 26.31 19.98 120-124 25.135 28.615000000000002 25.69 20.560000000000002 125-129 25.185000000000002 28.144999999999996 26.39 20.28 130-134 25.91 28.194999999999997 25.985000000000003 19.91 135-139 26.14 28.035 26.325 19.5 140-144 26.5 28.485 25.905 19.11 145-149 27.189999999999998 28.485 25.185000000000002 19.139999999999997 150-151 27.125 28.000000000000004 25.8125 19.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.5 17 1.0 18 1.0 19 1.5 20 0.5 21 0.0 22 1.5 23 2.0 24 2.0 25 2.5 26 4.5 27 6.0 28 4.5 29 5.0 30 6.0 31 8.0 32 16.0 33 25.0 34 36.0 35 49.5 36 69.0 37 99.5 38 117.5 39 148.5 40 184.5 41 214.0 42 266.5 43 279.5 44 288.5 45 297.0 46 281.0 47 263.5 48 240.5 49 208.5 50 164.0 51 137.5 52 122.0 53 101.5 54 78.5 55 62.5 56 46.5 57 34.5 58 24.5 59 22.5 60 22.0 61 14.0 62 10.5 63 7.0 64 2.5 65 1.5 66 1.0 67 0.5 68 2.5 69 2.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.5 81 1.5 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.18622379526272 84.65 2 6.833650966512388 12.55 3 0.871222433977675 2.4 4 0.10890280424720937 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.2000000000000002 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.45 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.05 0.0 0.0 0.0 0.0 112-113 3.5374999999999996 0.0 0.0 0.0 0.0 114-115 3.9625000000000004 0.0 0.0 0.0 0.0 116-117 4.375 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.3375 0.0 0.0 0.0 0.0 122-123 5.9625 0.0 0.0 0.0 0.0 124-125 6.5875 0.0 0.0 0.0 0.0 126-127 7.15 0.0 0.0 0.0 0.0 128-129 7.725 0.0 0.0 0.0 0.0 130-131 8.325 0.0 0.0 0.0 0.0 132-133 8.875 0.0 0.0 0.0 0.0 134-135 9.5625 0.0 0.0 0.0 0.0 136-137 10.2625 0.0 0.0 0.0 0.0 138-139 11.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGATC 10 0.006830828 145.0 145 >>END_MODULE Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959766 spots for SRR12690183.sra Written 959766 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra Read 959748 spots for SRR12690183.sra Written 959748 spots for SRR12690183.sra SRR ids: ['SRR12690183.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__gud4diw SRR12690183.sra spots: 19194978 blocks: [[1, 959748], [959749, 1919496], [1919497, 2879244], [2879245, 3838992], [3838993, 4798740], [4798741, 5758488], [5758489, 6718236], [6718237, 7677984], [7677985, 8637732], [8637733, 9597480], [9597481, 10557228], [10557229, 11516976], [11516977, 12476724], [12476725, 13436472], [13436473, 14396220], [14396221, 15355968], [15355969, 16315716], [16315717, 17275464], [17275465, 18235212], [18235213, 19194978]] SRR12690183 file size 6501592 SRR12690183 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690183 SRR12690183_1.fastq SRR12690183_2.fastq Input file: SRR12690183_1.fastq Paired file: SRR12690183_2.fastq trimmed: SRR12690183-trimmed-pair1.fastq, SRR12690183-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:32:14 2025 >> started Mon Feb 10 21:32:37 2025 >> done (22.921s) 19194978 read pairs processed; of these: 51 ( 0.00%) short read pairs filtered out after trimming by size control 7812 ( 0.04%) empty read pairs filtered out after trimming by size control 19187115 (99.96%) read pairs available; of these: 3190472 (16.63%) trimmed read pairs available after processing 15996643 (83.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 12 0.00% 21 19 0.00% 22 18 0.00% 23 20 0.00% 24 25 0.00% 25 24 0.00% 26 26 0.00% 27 22 0.00% 28 37 0.00% 29 46 0.00% 30 51 0.00% 31 51 0.00% 32 44 0.00% 33 55 0.00% 34 49 0.00% 35 51 0.00% 36 48 0.00% 37 50 0.00% 38 63 0.00% 39 68 0.00% 40 62 0.00% 41 75 0.00% 42 70 0.00% 43 76 0.00% 44 98 0.00% 45 86 0.00% 46 105 0.00% 47 97 0.00% 48 133 0.00% 49 146 0.00% 50 171 0.00% 51 169 0.00% 52 206 0.00% 53 219 0.00% 54 230 0.00% 55 217 0.00% 56 251 0.00% 57 315 0.00% 58 395 0.00% 59 417 0.00% 60 544 0.00% 61 604 0.00% 62 721 0.00% 63 742 0.00% 64 765 0.00% 65 885 0.00% 66 971 0.01% 67 1091 0.01% 68 1201 0.01% 69 1378 0.01% 70 1668 0.01% 71 1856 0.01% 72 2128 0.01% 73 2434 0.01% 74 2728 0.01% 75 2873 0.01% 76 3353 0.02% 77 3552 0.02% 78 4086 0.02% 79 4617 0.02% 80 4874 0.03% 81 5663 0.03% 82 6316 0.03% 83 6860 0.04% 84 7700 0.04% 85 8594 0.04% 86 9418 0.05% 87 10015 0.05% 88 11175 0.06% 89 11530 0.06% 90 12759 0.07% 91 13701 0.07% 92 14529 0.08% 93 16010 0.08% 94 17535 0.09% 95 18366 0.10% 96 19675 0.10% 97 20948 0.11% 98 21643 0.11% 99 22812 0.12% 100 24492 0.13% 101 25023 0.13% 102 26788 0.14% 103 28219 0.15% 104 29588 0.15% 105 30667 0.16% 106 32456 0.17% 107 33135 0.17% 108 35116 0.18% 109 36210 0.19% 110 36796 0.19% 111 38653 0.20% 112 39820 0.21% 113 40817 0.21% 114 42937 0.22% 115 44616 0.23% 116 45911 0.24% 117 47559 0.25% 118 49070 0.26% 119 49654 0.26% 120 51675 0.27% 121 53126 0.28% 122 53745 0.28% 123 55726 0.29% 124 56706 0.30% 125 57783 0.30% 126 59759 0.31% 127 60281 0.31% 128 61650 0.32% 129 62867 0.33% 130 64728 0.34% 131 64982 0.34% 132 66371 0.35% 133 68352 0.36% 134 69443 0.36% 135 70379 0.37% 136 72526 0.38% 137 71855 0.37% 138 73080 0.38% 139 75065 0.39% 140 74958 0.39% 141 76249 0.40% 142 77621 0.40% 143 77780 0.41% 144 79697 0.42% 145 81676 0.43% 146 80392 0.42% 147 81253 0.42% 148 82917 0.43% 149 83005 0.43% 150 84649 0.44% 151 15996643 83.37% 19187115 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=31 prefix-density=0.38 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=71.03 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=11.4 sequence=GAAAGAGAAGAAGCAAGACATTACATTTTCAAATACAATACAAGGACTGAAAGTTCTTTCAAAACAAAAGCATTATACATGGTACAGACTTCTTATAAAATCTTTCACTGGATTTGGACATCAATGACCTTAGGTTCAACTTTGGTCTTAGGAATGTTAATGAACAGAACTCCATTTTTCAACTCAGCCTTGATCTTATCCTTTCCGCAATTATCCGGTAGCCTAAGCCGGGTATCATAAGAGCTGACGCTGCTACTAGACCATGAATCATCGCCAGTTTCTTCCTTCTTGTGCTCTCCTTTAATAACAAGCACATCATCCTCGACCGAGACCTTGACATCCTCCTTAGACAGTCCTGGCATGTCGAACCTCATCTTGATCTCATGTTCCTCATCTTTGATTTCCCATGGTGCACGCACCTCTCCTCCTGTCCTGTTCCTGCTGCTAGGAATTGTCAGTGCATCATCGAACAGTCGGTCCATTGTGTCCAGCATTTGACGCATTGTCCTCA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=32 prefix-density=0.29 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=496.66 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=20.9 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGG SRR12690183 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:33:21 Started mapping on | Feb 10 21:33:21 Finished on | Feb 10 21:35:44 Mapping speed, Million of reads per hour | 483.03 Number of input reads | 19187115 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17938627 Uniquely mapped reads % | 93.49% Average mapped length | 292.45 Number of splices: Total | 17894264 Number of splices: Annotated (sjdb) | 17481563 Number of splices: GT/AG | 17553557 Number of splices: GC/AG | 268713 Number of splices: AT/AC | 13691 Number of splices: Non-canonical | 58303 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 523442 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 122391 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 725046 725046 725046 N_multimapping 523442 523442 523442 N_noFeature 533279 17688640 619431 N_ambiguous 268769 3072 102522 UnstrandedReadsAssigned:17136579 PositiveStrandReadsAssigned:246915 NegativeStrandReadsAssigned:17216674 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690183 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690183-trimmed-pair1.fastq SRR12690183-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,187,115 reads, 17,256,024 reads pseudoaligned [quant] estimated average fragment length: 231.967 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR12690183.ke.tsv 34699 SRR12690183.se.tsv 87100 total ==> SRR12690183.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.03 1180 31.3154 Potri.005G024800.1.v4.1 1035 804.033 1260 74.3199 Potri.004G059700.1.v4.1 961 730.146 27 1.75373 Potri.007G009000.2.v4.1 1416 1185.03 0 0 Potri.003G141000.2.v4.1 2943 2712.03 785.582 13.7374 Potri.016G087400.1.v4.1 270 91.8685 1300.37 671.288 Potri.015G069301.1.v4.1 564 342.202 0 0 Potri.010G195200.1.v4.1 1773 1542.03 169 5.19759 Potri.012G127500.1.v4.1 977 746.095 120 7.62773 ==> SRR12690183.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 317 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12690183 completed mapping pipeline successfully