Starting /dee2/code/volunteer_pipeline.sh SRR12690184 current disk space = 3057009434624 free memory = 1210822428 SRR12690184 SRAfilesize f63c7283494e84ce93a78185c4b7181b SRR12690184.sra SRR12690184.sra file validated SRR12690184 is paired end SRR12690184 is conventional basespace SRR12690184 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690184_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.556 37.0 37.0 37.0 37.0 37.0 2 36.39375 37.0 37.0 37.0 37.0 37.0 3 36.612 37.0 37.0 37.0 37.0 37.0 4 36.607 37.0 37.0 37.0 37.0 37.0 5 36.653 37.0 37.0 37.0 37.0 37.0 6 36.6195 37.0 37.0 37.0 37.0 37.0 7 36.565 37.0 37.0 37.0 37.0 37.0 8 36.6705 37.0 37.0 37.0 37.0 37.0 9 36.585 37.0 37.0 37.0 37.0 37.0 10-14 36.601800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5904 37.0 37.0 37.0 37.0 37.0 20-24 36.5973 37.0 37.0 37.0 37.0 37.0 25-29 36.5509 37.0 37.0 37.0 37.0 37.0 30-34 36.4842 37.0 37.0 37.0 37.0 37.0 35-39 36.4967 37.0 37.0 37.0 37.0 37.0 40-44 36.4842 37.0 37.0 37.0 37.0 37.0 45-49 36.458 37.0 37.0 37.0 37.0 37.0 50-54 36.4191 37.0 37.0 37.0 37.0 37.0 55-59 36.363299999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3525 37.0 37.0 37.0 37.0 37.0 65-69 36.333400000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.321600000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.347300000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3363 37.0 37.0 37.0 37.0 37.0 85-89 36.2727 37.0 37.0 37.0 37.0 37.0 90-94 36.328799999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.223600000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.155100000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1572 37.0 37.0 37.0 37.0 37.0 110-114 36.132 37.0 37.0 37.0 37.0 37.0 115-119 36.124399999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.0548 37.0 37.0 37.0 37.0 37.0 125-129 35.9661 37.0 37.0 37.0 37.0 37.0 130-134 36.0206 37.0 37.0 37.0 37.0 37.0 135-139 36.009499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.769600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.769600000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.5785 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 2.0 25 0.0 26 3.0 27 8.0 28 12.0 29 15.0 30 22.0 31 33.0 32 58.0 33 66.0 34 104.0 35 292.0 36 3001.0 37 381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.324999999999996 12.75 6.9750000000000005 34.949999999999996 2 21.7456734386757 12.967143215450214 35.46526210183095 29.821921244043143 3 16.45 17.325 29.675 36.55 4 20.65 23.325000000000003 26.75 29.275000000000002 5 23.225 30.575000000000003 24.425 21.775 6 22.0 33.650000000000006 22.975 21.375 7 15.65 26.474999999999998 40.575 17.299999999999997 8 18.099999999999998 26.5 31.4 24.0 9 16.7 25.0 34.375 23.925 10-14 20.235 28.904999999999998 27.41 23.45 15-19 19.57 27.915 28.28 24.235 20-24 20.275000000000002 28.065 28.139999999999997 23.52 25-29 20.595 27.66 28.360000000000003 23.385 30-34 19.975 27.91 28.03 24.085 35-39 20.02 28.194999999999997 27.655 24.13 40-44 20.31 27.715 28.189999999999998 23.785 45-49 20.09 27.935 27.705000000000002 24.27 50-54 20.495 28.28 27.845 23.380000000000003 55-59 20.73 28.08 27.744999999999997 23.445 60-64 21.015 27.685 27.355 23.945 65-69 20.64 27.83 27.83 23.7 70-74 20.845 28.33 27.04 23.785 75-79 20.97 28.63 27.060000000000002 23.34 80-84 20.27 28.02 27.48 24.23 85-89 20.51 28.74 27.400000000000002 23.35 90-94 20.849999999999998 28.000000000000004 27.310000000000002 23.84 95-99 20.3 27.88 27.685 24.135 100-104 21.085 28.360000000000003 27.425 23.13 105-109 21.105 27.74 27.3 23.855 110-114 20.885 28.075 27.785 23.255 115-119 21.32 28.384999999999998 26.775 23.52 120-124 20.87 28.305000000000003 26.805 24.02 125-129 21.175 27.805000000000003 27.355 23.665 130-134 21.154999999999998 28.03 27.185 23.630000000000003 135-139 20.645 28.585 27.200000000000003 23.57 140-144 21.275 28.050000000000004 26.465 24.21 145-149 21.455 28.52 26.135 23.89 150-151 21.837500000000002 28.499999999999996 26.400000000000002 23.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 0.5 25 1.0 26 2.5 27 6.5 28 13.5 29 11.5 30 10.5 31 20.5 32 29.5 33 38.5 34 47.5 35 53.5 36 84.0 37 110.0 38 115.0 39 139.5 40 173.5 41 206.5 42 242.0 43 256.5 44 257.5 45 276.0 46 272.0 47 244.0 48 229.0 49 217.0 50 182.0 51 154.0 52 131.0 53 112.0 54 89.5 55 67.5 56 58.5 57 38.5 58 30.5 59 22.5 60 16.0 61 13.0 62 7.0 63 4.0 64 1.5 65 0.0 66 0.0 67 0.0 68 0.5 69 1.0 70 0.5 71 2.0 72 2.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.44502330682754 83.375 2 7.704962983273924 14.05 3 0.6580751302440362 1.7999999999999998 4 0.13709898546750754 0.5 5 0.027419797093501508 0.125 6 0.027419797093501508 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCCATTCAGCTAATTCATTTGTTCATGCCAGTTGCCTTCTTAACTCCT 6 0.15 No Hit CCTCTCTGTGGTCTCCAAGCATTGTGCTGGATCATTCCCAACTGCTGAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.8 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 3.0875000000000004 0.0 0.0 0.0 0.0 124-125 3.4125 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.05 0.0 0.0 0.0 0.0 130-131 4.475 0.0 0.0 0.0 0.0 132-133 4.9125 0.0 0.0 0.0 0.0 134-135 5.4625 0.0 0.0 0.0 0.0 136-137 5.95 0.0 0.0 0.0 0.0 138-139 6.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690184 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690184_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3215 37.0 37.0 37.0 37.0 37.0 2 36.059 37.0 37.0 37.0 37.0 37.0 3 36.2375 37.0 37.0 37.0 37.0 37.0 4 36.1315 37.0 37.0 37.0 37.0 37.0 5 36.266 37.0 37.0 37.0 37.0 37.0 6 36.2315 37.0 37.0 37.0 37.0 37.0 7 36.238 37.0 37.0 37.0 37.0 37.0 8 36.2775 37.0 37.0 37.0 37.0 37.0 9 36.277 37.0 37.0 37.0 37.0 37.0 10-14 36.2025 37.0 37.0 37.0 37.0 37.0 15-19 36.161300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.1334 37.0 37.0 37.0 37.0 37.0 25-29 36.108799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.103699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.056599999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.995400000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9769 37.0 37.0 37.0 37.0 37.0 50-54 35.93919999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.97449999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.910900000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.8885 37.0 37.0 37.0 37.0 37.0 70-74 35.8038 37.0 37.0 37.0 37.0 37.0 75-79 35.863299999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.8733 37.0 37.0 37.0 37.0 37.0 85-89 35.858399999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.7525 37.0 37.0 37.0 37.0 37.0 95-99 35.7985 37.0 37.0 37.0 37.0 37.0 100-104 35.7935 37.0 37.0 37.0 37.0 37.0 105-109 35.8221 37.0 37.0 37.0 37.0 37.0 110-114 35.689800000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6838 37.0 37.0 37.0 37.0 37.0 120-124 35.5709 37.0 37.0 37.0 37.0 37.0 125-129 35.5499 37.0 37.0 37.0 37.0 37.0 130-134 35.469699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.4071 37.0 37.0 37.0 37.0 37.0 140-144 35.349000000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.2183 37.0 37.0 37.0 29.8 37.0 150-151 34.84525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 5.0 14 7.0 15 6.0 16 1.0 17 2.0 18 3.0 19 2.0 20 0.0 21 6.0 22 6.0 23 4.0 24 5.0 25 7.0 26 8.0 27 11.0 28 19.0 29 14.0 30 32.0 31 40.0 32 63.0 33 78.0 34 178.0 35 500.0 36 2720.0 37 280.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.675000000000004 25.3 8.200000000000001 23.825 2 28.975 27.800000000000004 27.925 15.299999999999999 3 20.525 28.4 31.924999999999997 19.15 4 23.925 33.725 23.9 18.45 5 24.425 37.0 22.125 16.45 6 21.5 38.45 22.15 17.9 7 20.599999999999998 21.3 38.324999999999996 19.775000000000002 8 22.425 26.700000000000003 27.425 23.45 9 21.525 25.1 28.9 24.474999999999998 10-14 23.830000000000002 29.15 26.195 20.825 15-19 24.11 28.615000000000002 27.229999999999997 20.044999999999998 20-24 23.285 28.854999999999997 27.034999999999997 20.825 25-29 23.095 28.335 27.76 20.810000000000002 30-34 23.18 28.360000000000003 27.43 21.029999999999998 35-39 23.325000000000003 28.720000000000002 26.855 21.099999999999998 40-44 22.905 27.544999999999998 28.189999999999998 21.36 45-49 23.34 28.125 27.565 20.97 50-54 23.02 28.08 27.605 21.295 55-59 23.05 27.37 28.22 21.36 60-64 23.53 28.185 27.46 20.825 65-69 23.580000000000002 27.975 27.0 21.445 70-74 23.52 27.855 27.255000000000003 21.37 75-79 23.645 27.884999999999998 26.99 21.48 80-84 23.415 28.395 26.805 21.385 85-89 23.98 28.1 26.279999999999998 21.64 90-94 23.695 28.33 27.22 20.755000000000003 95-99 23.515 28.055000000000003 27.334999999999997 21.095 100-104 23.549999999999997 27.875 27.139999999999997 21.435000000000002 105-109 24.38 28.310000000000002 26.52 20.79 110-114 23.635 27.939999999999998 27.800000000000004 20.625 115-119 23.990000000000002 28.685 26.490000000000002 20.835 120-124 24.335 28.075 26.39 21.2 125-129 24.015 27.644999999999996 27.279999999999998 21.060000000000002 130-134 25.080000000000002 28.22 26.14 20.560000000000002 135-139 24.84 28.000000000000004 26.57 20.59 140-144 25.264999999999997 27.63 26.619999999999997 20.485 145-149 25.36 27.965 26.66 20.015 150-151 26.0625 27.187499999999996 26.5125 20.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.5 14 1.0 15 1.5 16 2.0 17 2.0 18 1.0 19 0.5 20 1.5 21 1.5 22 1.5 23 1.0 24 0.0 25 0.0 26 1.5 27 3.5 28 5.0 29 8.0 30 10.5 31 11.0 32 21.0 33 31.5 34 49.5 35 63.5 36 68.5 37 101.5 38 131.0 39 153.0 40 191.5 41 225.0 42 242.5 43 270.5 44 290.0 45 276.0 46 267.0 47 255.0 48 220.5 49 197.5 50 170.5 51 135.0 52 121.5 53 106.0 54 85.5 55 70.0 56 49.5 57 35.5 58 29.5 59 21.5 60 15.0 61 8.0 62 4.0 63 3.0 64 3.0 65 2.5 66 1.0 67 2.0 68 3.5 69 2.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 1.0 88 1.0 89 0.0 90 0.0 91 1.0 92 1.0 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 1.0 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.99341924869756 83.875 2 6.937208664655882 12.65 3 0.6854949273375377 1.875 4 0.2741979709350151 1.0 5 0.054839594187003016 0.25 6 0.027419797093501508 0.15 7 0.0 0.0 8 0.027419797093501508 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit CCGAAACCAGTCTGGGTTTTCCTTTATAGGATCATCAGAATTAGAAGGGA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9125000000000001 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.825 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 3.1 0.0 0.0 0.0 0.0 124-125 3.4125 0.0 0.0 0.0 0.0 126-127 3.7125 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 4.9375 0.0 0.0 0.0 0.0 134-135 5.4875 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTGG 10 0.006830828 145.0 6 AATTAAG 10 0.006830828 145.0 6 >>END_MODULE Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712170 spots for SRR12690184.sra Written 712170 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra Read 712164 spots for SRR12690184.sra Written 712164 spots for SRR12690184.sra SRR ids: ['SRR12690184.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_76i1azd5 SRR12690184.sra spots: 14243286 blocks: [[1, 712164], [712165, 1424328], [1424329, 2136492], [2136493, 2848656], [2848657, 3560820], [3560821, 4272984], [4272985, 4985148], [4985149, 5697312], [5697313, 6409476], [6409477, 7121640], [7121641, 7833804], [7833805, 8545968], [8545969, 9258132], [9258133, 9970296], [9970297, 10682460], [10682461, 11394624], [11394625, 12106788], [12106789, 12818952], [12818953, 13531116], [13531117, 14243286]] SRR12690184 file size 4818791 SRR12690184 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690184 SRR12690184_1.fastq SRR12690184_2.fastq Input file: SRR12690184_1.fastq Paired file: SRR12690184_2.fastq trimmed: SRR12690184-trimmed-pair1.fastq, SRR12690184-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:50:50 2025 >> started Mon Feb 10 21:51:06 2025 >> done (15.763s) 14243286 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 3277 ( 0.02%) empty read pairs filtered out after trimming by size control 14239977 (99.98%) read pairs available; of these: 1513044 (10.63%) trimmed read pairs available after processing 12726933 (89.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 11 0.00% 21 11 0.00% 22 20 0.00% 23 16 0.00% 24 23 0.00% 25 22 0.00% 26 18 0.00% 27 26 0.00% 28 47 0.00% 29 26 0.00% 30 36 0.00% 31 26 0.00% 32 27 0.00% 33 38 0.00% 34 27 0.00% 35 26 0.00% 36 29 0.00% 37 33 0.00% 38 44 0.00% 39 34 0.00% 40 28 0.00% 41 36 0.00% 42 58 0.00% 43 36 0.00% 44 51 0.00% 45 68 0.00% 46 63 0.00% 47 51 0.00% 48 54 0.00% 49 76 0.00% 50 71 0.00% 51 83 0.00% 52 95 0.00% 53 104 0.00% 54 102 0.00% 55 109 0.00% 56 141 0.00% 57 149 0.00% 58 154 0.00% 59 134 0.00% 60 218 0.00% 61 221 0.00% 62 242 0.00% 63 303 0.00% 64 283 0.00% 65 309 0.00% 66 378 0.00% 67 380 0.00% 68 467 0.00% 69 513 0.00% 70 634 0.00% 71 620 0.00% 72 755 0.01% 73 798 0.01% 74 952 0.01% 75 1055 0.01% 76 1122 0.01% 77 1279 0.01% 78 1353 0.01% 79 1553 0.01% 80 1683 0.01% 81 1997 0.01% 82 2208 0.02% 83 2430 0.02% 84 2685 0.02% 85 2913 0.02% 86 3232 0.02% 87 3399 0.02% 88 3665 0.03% 89 4032 0.03% 90 4405 0.03% 91 4870 0.03% 92 5332 0.04% 93 5585 0.04% 94 6286 0.04% 95 6951 0.05% 96 7288 0.05% 97 7686 0.05% 98 7803 0.05% 99 8691 0.06% 100 9036 0.06% 101 9547 0.07% 102 9997 0.07% 103 11059 0.08% 104 11808 0.08% 105 12181 0.09% 106 12741 0.09% 107 13297 0.09% 108 13673 0.10% 109 14082 0.10% 110 14905 0.10% 111 15803 0.11% 112 16754 0.12% 113 17375 0.12% 114 18255 0.13% 115 18811 0.13% 116 19566 0.14% 117 20909 0.15% 118 21149 0.15% 119 21658 0.15% 120 22394 0.16% 121 23437 0.16% 122 24068 0.17% 123 25425 0.18% 124 26607 0.19% 125 26803 0.19% 126 27650 0.19% 127 28722 0.20% 128 28966 0.20% 129 29854 0.21% 130 30988 0.22% 131 31723 0.22% 132 32432 0.23% 133 33879 0.24% 134 34763 0.24% 135 36079 0.25% 136 36815 0.26% 137 37480 0.26% 138 38091 0.27% 139 39252 0.28% 140 39460 0.28% 141 40296 0.28% 142 41617 0.29% 143 42454 0.30% 144 43982 0.31% 145 44270 0.31% 146 45466 0.32% 147 46164 0.32% 148 47186 0.33% 149 47119 0.33% 150 48208 0.34% 151 12726933 89.37% 14239977 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=16 prefix-density=0.69 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=15.61 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=3.3 sequence=GAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCATTCTC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=20 prefix-density=0.59 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=57.27 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=2.3 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12690184 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:51:51 Started mapping on | Feb 10 21:51:51 Finished on | Feb 10 21:53:34 Mapping speed, Million of reads per hour | 497.71 Number of input reads | 14239977 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13273564 Uniquely mapped reads % | 93.21% Average mapped length | 295.98 Number of splices: Total | 13960543 Number of splices: Annotated (sjdb) | 13641164 Number of splices: GT/AG | 13674187 Number of splices: GC/AG | 229044 Number of splices: AT/AC | 10342 Number of splices: Non-canonical | 46970 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341427 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 60838 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 624986 624986 624986 N_multimapping 341427 341427 341427 N_noFeature 373385 13097500 415932 N_ambiguous 231098 767 97145 UnstrandedReadsAssigned:12669081 PositiveStrandReadsAssigned:175297 NegativeStrandReadsAssigned:12760487 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690184 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690184-trimmed-pair1.fastq SRR12690184-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,239,977 reads, 12,814,618 reads pseudoaligned [quant] estimated average fragment length: 251.958 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR12690184.ke.tsv 34699 SRR12690184.se.tsv 87100 total ==> SRR12690184.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.04 509 18.3136 Potri.005G024800.1.v4.1 1035 784.042 351 28.4624 Potri.004G059700.1.v4.1 961 710.153 59 5.28207 Potri.007G009000.2.v4.1 1416 1165.04 0 0 Potri.003G141000.2.v4.1 2943 2692.04 696 16.4373 Potri.016G087400.1.v4.1 270 83.4164 662.063 504.605 Potri.015G069301.1.v4.1 564 325.664 0 0 Potri.010G195200.1.v4.1 1773 1522.04 19 0.793654 Potri.012G127500.1.v4.1 977 726.111 208 18.2123 ==> SRR12690184.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 119 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 159 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12690184 completed mapping pipeline successfully