Starting /dee2/code/volunteer_pipeline.sh SRR12690185 current disk space = 3057225203712 free memory = 1482911512 SRR12690185 SRAfilesize 895c65cfb6148ce6cf67d9eb87bf5c9f SRR12690185.sra SRR12690185.sra file validated SRR12690185 is paired end SRR12690185 is conventional basespace SRR12690185 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690185_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.594 37.0 37.0 37.0 37.0 37.0 2 36.469 37.0 37.0 37.0 37.0 37.0 3 36.6875 37.0 37.0 37.0 37.0 37.0 4 36.718 37.0 37.0 37.0 37.0 37.0 5 36.692 37.0 37.0 37.0 37.0 37.0 6 36.6905 37.0 37.0 37.0 37.0 37.0 7 36.6385 37.0 37.0 37.0 37.0 37.0 8 36.6635 37.0 37.0 37.0 37.0 37.0 9 36.6415 37.0 37.0 37.0 37.0 37.0 10-14 36.634299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.602599999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.6051 37.0 37.0 37.0 37.0 37.0 25-29 36.555400000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.5228 37.0 37.0 37.0 37.0 37.0 35-39 36.5099 37.0 37.0 37.0 37.0 37.0 40-44 36.4928 37.0 37.0 37.0 37.0 37.0 45-49 36.4172 37.0 37.0 37.0 37.0 37.0 50-54 36.421400000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.2952 37.0 37.0 37.0 37.0 37.0 60-64 36.29860000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2049 37.0 37.0 37.0 37.0 37.0 70-74 36.244499999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.389500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2772 37.0 37.0 37.0 37.0 37.0 85-89 36.3296 37.0 37.0 37.0 37.0 37.0 90-94 36.244099999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.201800000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.179 37.0 37.0 37.0 37.0 37.0 105-109 36.191 37.0 37.0 37.0 37.0 37.0 110-114 36.1379 37.0 37.0 37.0 37.0 37.0 115-119 36.102900000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0895 37.0 37.0 37.0 37.0 37.0 125-129 35.998599999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9098 37.0 37.0 37.0 37.0 37.0 135-139 35.9341 37.0 37.0 37.0 37.0 37.0 140-144 35.6549 37.0 37.0 37.0 37.0 37.0 145-149 35.593 37.0 37.0 37.0 37.0 37.0 150-151 35.388000000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 2.0 26 5.0 27 8.0 28 9.0 29 14.0 30 18.0 31 45.0 32 57.0 33 95.0 34 116.0 35 271.0 36 2944.0 37 412.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.925 14.099999999999998 8.15 38.824999999999996 2 19.53360080240722 13.741223671013039 34.62888665997994 32.0962888665998 3 15.725 14.799999999999999 29.125 40.35 4 22.05 20.7 25.15 32.1 5 22.725 26.35 25.275 25.650000000000002 6 23.625 29.375 23.849999999999998 23.150000000000002 7 18.85 27.425 36.525 17.2 8 17.575 27.525 31.85 23.05 9 19.575 23.625 33.775 23.025000000000002 10-14 20.65 28.595 26.995 23.76 15-19 21.51 26.395000000000003 27.994999999999997 24.099999999999998 20-24 20.979999999999997 27.224999999999998 27.57 24.224999999999998 25-29 21.465 27.125 27.389999999999997 24.02 30-34 20.849999999999998 27.145000000000003 26.93 25.074999999999996 35-39 21.6 26.650000000000002 27.425 24.325 40-44 21.335 27.305 27.229999999999997 24.13 45-49 21.515 27.045 27.634999999999998 23.805 50-54 21.435000000000002 26.765 27.165 24.635 55-59 22.115000000000002 26.384999999999998 27.295 24.205 60-64 22.02 26.355 27.42 24.205 65-69 21.755 26.56 27.015 24.67 70-74 22.325 26.445 26.965 24.265 75-79 22.505 25.979999999999997 27.175 24.34 80-84 22.775000000000002 26.295 26.924999999999997 24.005000000000003 85-89 22.965 26.340000000000003 26.69 24.005000000000003 90-94 22.66 26.695 27.125 23.52 95-99 22.68 26.200000000000003 27.655 23.465 100-104 23.25 26.515 26.965 23.27 105-109 23.645 26.534999999999997 26.52 23.3 110-114 23.35 26.474999999999998 27.034999999999997 23.14 115-119 23.064999999999998 27.505000000000003 26.27 23.16 120-124 23.685000000000002 27.229999999999997 25.895000000000003 23.189999999999998 125-129 23.05 27.38 25.979999999999997 23.59 130-134 23.765 26.96 25.28 23.995 135-139 24.044999999999998 26.43 26.179999999999996 23.345 140-144 24.240000000000002 26.525 25.95 23.285 145-149 24.145 26.169999999999998 25.814999999999998 23.87 150-151 24.175 25.8625 26.85 23.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 1.5 27 3.0 28 7.0 29 9.0 30 11.0 31 16.5 32 24.0 33 31.0 34 36.5 35 45.5 36 57.5 37 73.0 38 89.0 39 116.0 40 137.5 41 150.5 42 175.5 43 215.0 44 230.5 45 226.0 46 241.5 47 251.0 48 258.5 49 257.5 50 226.5 51 183.5 52 146.5 53 122.5 54 126.5 55 125.5 56 106.0 57 72.5 58 48.0 59 41.5 60 29.0 61 20.5 62 15.0 63 12.5 64 10.5 65 9.0 66 7.0 67 7.0 68 7.5 69 5.0 70 2.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.5 76 1.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.9 #Duplication Level Percentage of deduplicated Percentage of total 1 90.10123734533182 80.10000000000001 2 8.43644544431946 15.0 3 1.0967379077615298 2.9250000000000003 4 0.1687289088863892 0.6 5 0.05624296962879641 0.25 6 0.05624296962879641 0.3 7 0.0 0.0 8 0.028121484814398204 0.2 9 0.0 0.0 >10 0.05624296962879641 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTAGGTTATCTCGTAT 15 0.375 TruSeq Adapter, Index 22 (97% over 41bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTAGGTTATCGCGTAT 10 0.25 TruSeq Adapter, Index 22 (97% over 41bp) GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGT 8 0.2 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGC 6 0.15 No Hit CTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACAC 6 0.15 No Hit CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCT 5 0.125 No Hit GATTGGTCTATTGTGGAGGCATGAGGCGCTATGTTTTCTTGAGCAAATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.2375 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.6499999999999999 0.0 0.0 0.0 0.0 82-83 0.725 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.025 0.0 0.0 0.0 0.0 88-89 1.2125 0.0 0.0 0.0 0.0 90-91 1.375 0.0 0.0 0.0 0.0 92-93 1.6625 0.0 0.0 0.0 0.0 94-95 2.0125 0.0 0.0 0.0 0.0 96-97 2.375 0.0 0.0 0.0 0.0 98-99 2.6875 0.0 0.0 0.0 0.0 100-101 3.0999999999999996 0.0 0.0 0.0 0.0 102-103 3.55 0.0 0.0 0.0 0.0 104-105 4.1125 0.0 0.0 0.0 0.0 106-107 4.675000000000001 0.0 0.0 0.0 0.0 108-109 5.1625 0.0 0.0 0.0 0.0 110-111 6.1 0.0 0.0 0.0 0.0 112-113 6.625 0.0 0.0 0.0 0.0 114-115 7.449999999999999 0.0 0.0 0.0 0.0 116-117 8.2875 0.0 0.0 0.0 0.0 118-119 9.2125 0.0 0.0 0.0 0.0 120-121 10.0875 0.0 0.0 0.0 0.0 122-123 10.9625 0.0 0.0 0.0 0.0 124-125 11.675 0.0 0.0 0.0 0.0 126-127 12.675 0.0 0.0 0.0 0.0 128-129 13.8 0.0 0.0 0.0 0.0 130-131 14.875 0.0 0.0 0.0 0.0 132-133 16.35 0.0 0.0 0.0 0.0 134-135 17.737499999999997 0.0 0.0 0.0 0.0 136-137 18.9625 0.0 0.0 0.0 0.0 138-139 20.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATAAA 10 0.006830828 145.0 5 GGAAGGT 10 0.006830828 145.0 8 ACAGGAA 10 0.006830828 145.0 5 TTAACAG 10 0.006830828 145.0 2 CAGGAAG 10 0.006830828 145.0 6 CTCAAGA 10 0.006830828 145.0 1 CATAAAA 10 0.006830828 145.0 6 TAGTAGT 20 0.00593511 29.0 100-104 >>END_MODULE SRR12690185 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690185_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5475 37.0 37.0 37.0 37.0 37.0 2 36.338 37.0 37.0 37.0 37.0 37.0 3 36.36 37.0 37.0 37.0 37.0 37.0 4 36.4275 37.0 37.0 37.0 37.0 37.0 5 36.393 37.0 37.0 37.0 37.0 37.0 6 36.4075 37.0 37.0 37.0 37.0 37.0 7 36.4025 37.0 37.0 37.0 37.0 37.0 8 36.4285 37.0 37.0 37.0 37.0 37.0 9 36.4425 37.0 37.0 37.0 37.0 37.0 10-14 36.3505 37.0 37.0 37.0 37.0 37.0 15-19 36.359500000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.363 37.0 37.0 37.0 37.0 37.0 25-29 36.2622 37.0 37.0 37.0 37.0 37.0 30-34 36.2165 37.0 37.0 37.0 37.0 37.0 35-39 36.2551 37.0 37.0 37.0 37.0 37.0 40-44 36.2325 37.0 37.0 37.0 37.0 37.0 45-49 36.200900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.138 37.0 37.0 37.0 37.0 37.0 55-59 36.1911 37.0 37.0 37.0 37.0 37.0 60-64 36.0957 37.0 37.0 37.0 37.0 37.0 65-69 36.1008 37.0 37.0 37.0 37.0 37.0 70-74 36.0425 37.0 37.0 37.0 37.0 37.0 75-79 36.059900000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.090599999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0651 37.0 37.0 37.0 37.0 37.0 90-94 36.043 37.0 37.0 37.0 37.0 37.0 95-99 36.05030000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.071600000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.069500000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.9662 37.0 37.0 37.0 37.0 37.0 115-119 35.8281 37.0 37.0 37.0 37.0 37.0 120-124 35.6729 37.0 37.0 37.0 37.0 37.0 125-129 35.5852 37.0 37.0 37.0 37.0 37.0 130-134 35.4105 37.0 37.0 37.0 37.0 37.0 135-139 35.216 37.0 37.0 37.0 34.6 37.0 140-144 35.0207 37.0 37.0 37.0 27.4 37.0 145-149 34.6283 37.0 37.0 37.0 25.0 37.0 150-151 34.110749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 3.0 15 2.0 16 2.0 17 3.0 18 0.0 19 1.0 20 4.0 21 3.0 22 6.0 23 5.0 24 5.0 25 7.0 26 12.0 27 15.0 28 10.0 29 17.0 30 27.0 31 36.0 32 55.0 33 97.0 34 171.0 35 425.0 36 2746.0 37 345.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.85 25.3 10.274999999999999 28.575 2 27.6 29.525000000000002 26.450000000000003 16.425 3 21.625 29.375 27.1 21.9 4 23.525 35.375 22.875 18.224999999999998 5 25.7 35.949999999999996 21.0 17.349999999999998 6 22.8 39.300000000000004 19.825 18.075 7 21.6 23.724999999999998 35.099999999999994 19.575 8 22.3 26.174999999999997 25.05 26.474999999999998 9 21.4 25.924999999999997 28.575 24.099999999999998 10-14 24.515 29.68 24.59 21.215 15-19 24.45 28.565 25.55 21.435000000000002 20-24 24.11 29.2 25.205 21.485000000000003 25-29 23.365 28.015 26.575 22.045 30-34 23.935000000000002 28.444999999999997 25.91 21.709999999999997 35-39 24.435000000000002 28.825 25.22 21.52 40-44 23.905 28.655 25.71 21.73 45-49 23.185 27.76 26.314999999999998 22.74 50-54 24.37 27.900000000000002 25.474999999999998 22.255 55-59 24.93 26.974999999999998 26.779999999999998 21.315 60-64 23.830000000000002 27.73 25.679999999999996 22.759999999999998 65-69 24.77 27.134999999999998 25.83 22.264999999999997 70-74 24.19 27.435 25.990000000000002 22.384999999999998 75-79 23.895 26.97 25.974999999999998 23.16 80-84 23.905 27.639999999999997 25.615 22.84 85-89 24.635 27.355 25.385 22.625 90-94 24.529999999999998 27.67 25.369999999999997 22.43 95-99 24.89 27.685 25.455 21.97 100-104 25.775 28.12 24.905 21.2 105-109 25.35 27.705000000000002 25.66 21.285 110-114 25.985000000000003 27.305 25.665 21.044999999999998 115-119 26.8 27.415 24.79 20.995 120-124 26.765 27.58 25.705 19.950000000000003 125-129 27.6 27.38 24.845 20.175 130-134 28.355000000000004 27.125 24.59 19.93 135-139 29.095 26.775 25.035 19.095000000000002 140-144 30.564999999999998 27.055 23.905 18.475 145-149 31.790000000000003 25.435000000000002 24.11 18.665000000000003 150-151 33.5 26.687499999999996 23.150000000000002 16.662499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.5 11 1.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.5 21 1.5 22 0.0 23 1.5 24 2.0 25 1.0 26 1.0 27 4.0 28 7.0 29 7.5 30 7.0 31 8.0 32 11.0 33 13.0 34 22.5 35 34.0 36 45.0 37 58.0 38 81.5 39 116.0 40 151.0 41 171.0 42 211.5 43 248.5 44 271.0 45 298.0 46 286.0 47 259.0 48 260.5 49 248.0 50 192.5 51 160.0 52 151.5 53 131.5 54 110.5 55 93.0 56 71.0 57 57.0 58 44.0 59 30.0 60 21.5 61 20.5 62 21.0 63 15.0 64 6.0 65 1.0 66 1.0 67 2.5 68 2.0 69 0.5 70 1.0 71 1.0 72 1.5 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 1.5 92 1.5 93 1.0 94 1.0 95 1.0 96 2.0 97 2.0 98 1.5 99 2.0 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.375 #Duplication Level Percentage of deduplicated Percentage of total 1 89.92927864214994 79.475 2 8.401697312588402 14.85 3 1.272984441301273 3.375 4 0.14144271570014144 0.5 5 0.11315417256011315 0.5 6 0.028288543140028287 0.15 7 0.0 0.0 8 0.028288543140028287 0.2 9 0.0 0.0 >10 0.08486562942008487 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 14 0.35000000000000003 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 12 0.3 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 8 0.2 No Hit CTATCTTTTCTTTCCGATTTAACACTAGATTGTAAGAAAGGAAGGAAAAA 6 0.15 No Hit CATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit AGTGAGAATGCAGAGAGTGTTTGGTGCGGCCGCGAGGAGGTCTCTGTCTC 5 0.125 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.2375 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.2625 0.0 0.0 0.0 0.0 68-69 0.3125 0.0 0.0 0.0 0.0 70-71 0.325 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.45 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.6625 0.0 0.0 0.0 0.0 82-83 0.725 0.0 0.0 0.0 0.0 84-85 0.9125 0.0 0.0 0.0 0.0 86-87 1.05 0.0 0.0 0.0 0.0 88-89 1.2125 0.0 0.0 0.0 0.0 90-91 1.375 0.0 0.0 0.0 0.0 92-93 1.6625 0.0 0.0 0.0 0.0 94-95 2.0125 0.0 0.0 0.0 0.0 96-97 2.375 0.0 0.0 0.0 0.0 98-99 2.6875 0.0 0.0 0.0 0.0 100-101 3.0999999999999996 0.0 0.0 0.0 0.0 102-103 3.525 0.0 0.0 0.0 0.0 104-105 4.1375 0.0 0.0 0.0 0.0 106-107 4.699999999999999 0.0 0.0 0.0 0.0 108-109 5.1875 0.0 0.0 0.0 0.0 110-111 6.1375 0.0 0.0 0.0 0.0 112-113 6.6875 0.0 0.0 0.0 0.0 114-115 7.550000000000001 0.0 0.0 0.0 0.0 116-117 8.45 0.0 0.0 0.0 0.0 118-119 9.4375 0.0 0.0 0.0 0.0 120-121 10.274999999999999 0.0 0.0 0.0 0.0 122-123 11.1375 0.0 0.0 0.0 0.0 124-125 11.850000000000001 0.0 0.0 0.0 0.0 126-127 12.825 0.0 0.0 0.0 0.0 128-129 13.9625 0.0 0.0 0.0 0.0 130-131 15.05 0.0 0.0 0.0 0.0 132-133 16.525 0.0 0.0 0.0 0.0 134-135 17.9625 0.0 0.0 0.0 0.0 136-137 19.15 0.0 0.0 0.0 0.0 138-139 20.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGACAA 10 0.006830828 145.0 6 AATAGAT 10 0.006830828 145.0 145 GACAAGG 10 0.006830828 145.0 8 AATGACA 10 0.006830828 145.0 5 CAAAAAT 10 0.006830828 145.0 1 GGGGGGG 95 1.00806574E-7 30.526318 145 CTACTAC 20 0.00593511 29.0 40-44 >>END_MODULE Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765638 spots for SRR12690185.sra Written 765638 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra Read 765622 spots for SRR12690185.sra Written 765622 spots for SRR12690185.sra SRR ids: ['SRR12690185.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qmhgvbbe SRR12690185.sra spots: 15312456 blocks: [[1, 765622], [765623, 1531244], [1531245, 2296866], [2296867, 3062488], [3062489, 3828110], [3828111, 4593732], [4593733, 5359354], [5359355, 6124976], [6124977, 6890598], [6890599, 7656220], [7656221, 8421842], [8421843, 9187464], [9187465, 9953086], [9953087, 10718708], [10718709, 11484330], [11484331, 12249952], [12249953, 13015574], [13015575, 13781196], [13781197, 14546818], [14546819, 15312456]] SRR12690185 file size 5182142 SRR12690185 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690185 SRR12690185_1.fastq SRR12690185_2.fastq Input file: SRR12690185_1.fastq Paired file: SRR12690185_2.fastq trimmed: SRR12690185-trimmed-pair1.fastq, SRR12690185-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:17:49 2025 >> started Mon Feb 10 22:18:05 2025 >> done (16.018s) 15312456 read pairs processed; of these: 155 ( 0.00%) short read pairs filtered out after trimming by size control 113287 ( 0.74%) empty read pairs filtered out after trimming by size control 15199014 (99.26%) read pairs available; of these: 4624056 (30.42%) trimmed read pairs available after processing 10574958 (69.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 13 0.00% 20 15 0.00% 21 26 0.00% 22 33 0.00% 23 57 0.00% 24 40 0.00% 25 86 0.00% 26 104 0.00% 27 104 0.00% 28 111 0.00% 29 111 0.00% 30 101 0.00% 31 162 0.00% 32 159 0.00% 33 157 0.00% 34 181 0.00% 35 211 0.00% 36 213 0.00% 37 270 0.00% 38 275 0.00% 39 273 0.00% 40 298 0.00% 41 319 0.00% 42 375 0.00% 43 374 0.00% 44 431 0.00% 45 458 0.00% 46 535 0.00% 47 542 0.00% 48 634 0.00% 49 722 0.00% 50 813 0.01% 51 815 0.01% 52 939 0.01% 53 928 0.01% 54 1006 0.01% 55 1030 0.01% 56 1151 0.01% 57 1178 0.01% 58 1328 0.01% 59 1296 0.01% 60 1502 0.01% 61 1520 0.01% 62 1729 0.01% 63 1850 0.01% 64 1937 0.01% 65 2130 0.01% 66 2267 0.01% 67 2350 0.02% 68 2624 0.02% 69 2767 0.02% 70 3206 0.02% 71 3443 0.02% 72 3891 0.03% 73 4671 0.03% 74 4538 0.03% 75 5407 0.04% 76 5328 0.04% 77 6253 0.04% 78 6516 0.04% 79 7373 0.05% 80 8181 0.05% 81 9071 0.06% 82 9741 0.06% 83 10657 0.07% 84 11655 0.08% 85 12644 0.08% 86 13830 0.09% 87 15152 0.10% 88 16115 0.11% 89 17243 0.11% 90 18506 0.12% 91 19828 0.13% 92 21079 0.14% 93 23218 0.15% 94 23999 0.16% 95 26682 0.18% 96 28012 0.18% 97 29555 0.19% 98 31007 0.20% 99 32314 0.21% 100 34530 0.23% 101 35816 0.24% 102 37163 0.24% 103 39046 0.26% 104 41120 0.27% 105 42230 0.28% 106 44574 0.29% 107 46601 0.31% 108 47509 0.31% 109 50991 0.34% 110 52258 0.34% 111 53957 0.36% 112 56436 0.37% 113 57174 0.38% 114 59670 0.39% 115 61579 0.41% 116 64621 0.43% 117 66681 0.44% 118 69302 0.46% 119 70425 0.46% 120 73629 0.48% 121 74812 0.49% 122 77309 0.51% 123 79733 0.52% 124 81308 0.53% 125 82053 0.54% 126 85069 0.56% 127 86492 0.57% 128 88842 0.58% 129 89615 0.59% 130 92560 0.61% 131 94135 0.62% 132 96046 0.63% 133 99191 0.65% 134 99031 0.65% 135 101171 0.67% 136 101325 0.67% 137 103947 0.68% 138 105263 0.69% 139 109077 0.72% 140 108575 0.71% 141 111997 0.74% 142 115267 0.76% 143 115274 0.76% 144 119681 0.79% 145 116873 0.77% 146 120218 0.79% 147 120012 0.79% 148 124905 0.82% 149 123239 0.81% 150 128047 0.84% 151 10574958 69.58% 15199014 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=33 prefix-density=0.68 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=191.52 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=9.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTGTGTAGCTTAATCAATC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=21 prefix-density=0.91 prefix-fanout=3.1 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=51.89 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=1.7 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGC SRR12690185 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:18:43 Started mapping on | Feb 10 22:18:43 Finished on | Feb 10 22:20:41 Mapping speed, Million of reads per hour | 463.70 Number of input reads | 15199014 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 14187212 Uniquely mapped reads % | 93.34% Average mapped length | 285.84 Number of splices: Total | 13858653 Number of splices: Annotated (sjdb) | 13622234 Number of splices: GT/AG | 13580934 Number of splices: GC/AG | 210474 Number of splices: AT/AC | 15497 Number of splices: Non-canonical | 51748 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358070 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 239564 % of reads mapped to too many loci | 1.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 653732 653732 653732 N_multimapping 358070 358070 358070 N_noFeature 411520 13945544 482857 N_ambiguous 276568 916 105571 UnstrandedReadsAssigned:13499124 PositiveStrandReadsAssigned:240752 NegativeStrandReadsAssigned:13598784 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=137 echo kmer=133 SRR12690185 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690185-trimmed-pair1.fastq SRR12690185-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,199,014 reads, 13,757,403 reads pseudoaligned [quant] estimated average fragment length: 176.28 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR12690185.ke.tsv 34699 SRR12690185.se.tsv 87100 total ==> SRR12690185.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1842.72 644 13.9819 Potri.005G024800.1.v4.1 1035 859.72 639 29.736 Potri.004G059700.1.v4.1 961 785.72 46 2.34222 Potri.007G009000.2.v4.1 1416 1240.72 0 0 Potri.003G141000.2.v4.1 2943 2767.72 202 2.9199 Potri.016G087400.1.v4.1 270 103.515 1538.06 594.443 Potri.015G069301.1.v4.1 564 388.999 0 0 Potri.010G195200.1.v4.1 1773 1597.72 120 3.00482 Potri.012G127500.1.v4.1 977 801.72 217 10.8287 ==> SRR12690185.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 220 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR12690185 completed mapping pipeline successfully