Starting /dee2/code/volunteer_pipeline.sh SRR12690186 current disk space = 3057016053760 free memory = 1226684208 SRR12690186 SRAfilesize e12ef685695f4a3f5a5213738401bc0b SRR12690186.sra SRR12690186.sra file validated SRR12690186 is paired end SRR12690186 is conventional basespace SRR12690186 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690186_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6955 37.0 37.0 37.0 37.0 37.0 2 36.4775 37.0 37.0 37.0 37.0 37.0 3 36.6145 37.0 37.0 37.0 37.0 37.0 4 36.59 37.0 37.0 37.0 37.0 37.0 5 36.5945 37.0 37.0 37.0 37.0 37.0 6 36.621 37.0 37.0 37.0 37.0 37.0 7 36.514 37.0 37.0 37.0 37.0 37.0 8 36.5545 37.0 37.0 37.0 37.0 37.0 9 36.5045 37.0 37.0 37.0 37.0 37.0 10-14 36.6001 37.0 37.0 37.0 37.0 37.0 15-19 36.5492 37.0 37.0 37.0 37.0 37.0 20-24 36.522299999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4951 37.0 37.0 37.0 37.0 37.0 30-34 36.45640000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4273 37.0 37.0 37.0 37.0 37.0 40-44 36.43520000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.336800000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3404 37.0 37.0 37.0 37.0 37.0 55-59 36.2542 37.0 37.0 37.0 37.0 37.0 60-64 36.2467 37.0 37.0 37.0 37.0 37.0 65-69 36.206 37.0 37.0 37.0 37.0 37.0 70-74 36.2471 37.0 37.0 37.0 37.0 37.0 75-79 36.305 37.0 37.0 37.0 37.0 37.0 80-84 36.2345 37.0 37.0 37.0 37.0 37.0 85-89 36.2536 37.0 37.0 37.0 37.0 37.0 90-94 36.2377 37.0 37.0 37.0 37.0 37.0 95-99 36.15839999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.1392 37.0 37.0 37.0 37.0 37.0 105-109 36.107899999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.116 37.0 37.0 37.0 37.0 37.0 115-119 36.02290000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.9774 37.0 37.0 37.0 37.0 37.0 125-129 35.9236 37.0 37.0 37.0 37.0 37.0 130-134 35.8697 37.0 37.0 37.0 37.0 37.0 135-139 35.9619 37.0 37.0 37.0 37.0 37.0 140-144 35.6852 37.0 37.0 37.0 37.0 37.0 145-149 35.682 37.0 37.0 37.0 37.0 37.0 150-151 35.45025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 2.0 25 3.0 26 2.0 27 8.0 28 12.0 29 28.0 30 20.0 31 31.0 32 73.0 33 73.0 34 113.0 35 312.0 36 2981.0 37 337.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.65 14.45 8.5 36.4 2 22.344689378757515 13.627254509018035 30.66132264529058 33.366733466933866 3 16.2 16.425 28.299999999999997 39.074999999999996 4 20.674999999999997 20.974999999999998 25.324999999999996 33.025 5 22.55 26.025 25.674999999999997 25.75 6 23.125 30.95 22.875 23.05 7 16.625 28.050000000000004 37.325 18.0 8 18.875 28.249999999999996 30.5 22.375 9 17.625 25.174999999999997 34.5 22.7 10-14 19.7 28.075 27.284999999999997 24.94 15-19 20.46 26.995 27.655 24.89 20-24 20.09 27.810000000000002 27.229999999999997 24.87 25-29 20.44 27.395000000000003 26.47 25.695 30-34 20.25 27.38 27.275 25.095 35-39 20.69 26.795 27.18 25.335 40-44 20.369999999999997 27.584999999999997 27.055 24.990000000000002 45-49 21.154999999999998 27.334999999999997 26.91 24.6 50-54 20.715 27.105 27.315 24.865000000000002 55-59 20.605 26.889999999999997 27.155 25.35 60-64 21.94 25.990000000000002 27.26 24.81 65-69 20.805 26.640000000000004 27.034999999999997 25.52 70-74 21.645 27.339999999999996 26.205000000000002 24.81 75-79 21.58 26.8 27.045 24.575 80-84 21.41 26.765 26.505000000000003 25.319999999999997 85-89 21.365000000000002 27.315 26.3 25.019999999999996 90-94 21.25 27.63 26.305 24.815 95-99 21.575 26.495 27.61 24.32 100-104 21.740000000000002 26.484999999999996 27.365000000000002 24.41 105-109 22.025 26.919999999999998 26.290000000000003 24.765 110-114 22.41 26.779999999999998 27.11 23.7 115-119 21.490000000000002 27.200000000000003 26.615 24.695 120-124 21.224999999999998 26.85 26.88 25.045 125-129 22.48 26.729999999999997 25.885 24.905 130-134 22.33 26.355 25.979999999999997 25.335 135-139 22.36 26.25 26.775 24.615000000000002 140-144 22.325 26.605 26.31 24.759999999999998 145-149 22.275 26.040000000000003 26.405 25.28 150-151 21.4 26.6625 26.1125 25.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.5 22 1.0 23 1.0 24 1.0 25 2.5 26 2.5 27 5.0 28 10.5 29 11.0 30 10.0 31 11.5 32 19.0 33 31.0 34 45.5 35 64.5 36 73.5 37 80.0 38 92.0 39 97.0 40 121.0 41 160.0 42 181.5 43 193.0 44 211.0 45 239.5 46 257.5 47 261.0 48 242.0 49 229.5 50 207.5 51 168.5 52 162.0 53 143.5 54 125.5 55 131.5 56 111.0 57 73.5 58 52.0 59 37.0 60 23.5 61 23.0 62 24.0 63 13.0 64 5.0 65 6.0 66 6.5 67 4.0 68 4.0 69 3.5 70 3.5 71 2.5 72 1.0 73 2.5 74 3.0 75 1.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.2 #Duplication Level Percentage of deduplicated Percentage of total 1 90.93680709534368 82.025 2 7.621951219512195 13.750000000000002 3 1.164079822616408 3.15 4 0.19401330376940135 0.7000000000000001 5 0.08314855875831485 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCT 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCATCACCATCTCGTTT 5 0.125 TruSeq Adapter, Index 3 (97% over 36bp) GCCAATACATAACAATGAAGAAGACACAAAGATAAAGACACTCACGGACA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.35 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 4.2375 0.0 0.0 0.0 0.0 124-125 4.7625 0.0 0.0 0.0 0.0 126-127 5.1625 0.0 0.0 0.0 0.0 128-129 5.5625 0.0 0.0 0.0 0.0 130-131 6.175 0.0 0.0 0.0 0.0 132-133 6.575 0.0 0.0 0.0 0.0 134-135 7.125 0.0 0.0 0.0 0.0 136-137 7.475 0.0 0.0 0.0 0.0 138-139 7.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690186 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690186_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3545 37.0 37.0 37.0 37.0 37.0 2 36.0485 37.0 37.0 37.0 37.0 37.0 3 36.016 37.0 37.0 37.0 37.0 37.0 4 36.1475 37.0 37.0 37.0 37.0 37.0 5 36.3155 37.0 37.0 37.0 37.0 37.0 6 36.108 37.0 37.0 37.0 37.0 37.0 7 36.185 37.0 37.0 37.0 37.0 37.0 8 36.3525 37.0 37.0 37.0 37.0 37.0 9 36.235 37.0 37.0 37.0 37.0 37.0 10-14 36.1649 37.0 37.0 37.0 37.0 37.0 15-19 36.181000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.1644 37.0 37.0 37.0 37.0 37.0 25-29 36.09530000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.0518 37.0 37.0 37.0 37.0 37.0 35-39 36.04 37.0 37.0 37.0 37.0 37.0 40-44 36.0022 37.0 37.0 37.0 37.0 37.0 45-49 35.9964 37.0 37.0 37.0 37.0 37.0 50-54 35.9518 37.0 37.0 37.0 37.0 37.0 55-59 35.951800000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.8684 37.0 37.0 37.0 37.0 37.0 65-69 35.903 37.0 37.0 37.0 37.0 37.0 70-74 35.7895 37.0 37.0 37.0 37.0 37.0 75-79 35.7946 37.0 37.0 37.0 37.0 37.0 80-84 35.887299999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.8571 37.0 37.0 37.0 37.0 37.0 90-94 35.7763 37.0 37.0 37.0 37.0 37.0 95-99 35.8306 37.0 37.0 37.0 37.0 37.0 100-104 35.8504 37.0 37.0 37.0 37.0 37.0 105-109 35.833600000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.744 37.0 37.0 37.0 37.0 37.0 115-119 35.7367 37.0 37.0 37.0 37.0 37.0 120-124 35.621700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.64450000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.5676 37.0 37.0 37.0 37.0 37.0 135-139 35.544500000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.441199999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.33200000000001 37.0 37.0 37.0 32.2 37.0 150-151 34.855999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 4.0 15 4.0 16 3.0 17 2.0 18 1.0 19 1.0 20 1.0 21 7.0 22 10.0 23 6.0 24 11.0 25 3.0 26 11.0 27 15.0 28 15.0 29 23.0 30 24.0 31 45.0 32 56.0 33 69.0 34 133.0 35 503.0 36 2783.0 37 264.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.375 25.0 11.075 22.55 2 30.049999999999997 27.725 25.674999999999997 16.55 3 24.125 28.375 27.275 20.225 4 22.975 35.3 22.8 18.925 5 25.7 35.925000000000004 21.15 17.224999999999998 6 24.025 38.2 20.3 17.474999999999998 7 21.575 23.9 34.575 19.950000000000003 8 22.7 27.800000000000004 24.725 24.775 9 24.0 25.575 27.250000000000004 23.175 10-14 24.154999999999998 29.715000000000003 24.365000000000002 21.765 15-19 24.08 28.694999999999997 25.619999999999997 21.605 20-24 24.165 28.305000000000003 25.895000000000003 21.634999999999998 25-29 23.595 27.71 26.700000000000003 21.995 30-34 23.36 27.98 26.33 22.33 35-39 23.599999999999998 27.925 26.484999999999996 21.990000000000002 40-44 23.695 28.249999999999996 26.490000000000002 21.565 45-49 24.349999999999998 28.299999999999997 25.779999999999998 21.57 50-54 24.495 27.875 25.53 22.1 55-59 24.735 27.644999999999996 26.19 21.43 60-64 24.72 27.02 25.525 22.735 65-69 24.84 27.29 25.935000000000002 21.935 70-74 24.855 27.74 25.16 22.245 75-79 24.64 27.18 25.564999999999998 22.615 80-84 24.855 27.815 25.295 22.035 85-89 25.03 27.195000000000004 25.650000000000002 22.125 90-94 25.39 27.265 25.52 21.825 95-99 25.085 27.650000000000002 25.380000000000003 21.884999999999998 100-104 25.21 28.055000000000003 25.3 21.435000000000002 105-109 25.235000000000003 27.265 26.085 21.415 110-114 25.505 27.295 26.0 21.2 115-119 26.015 27.85 24.94 21.195 120-124 25.924999999999997 27.810000000000002 25.045 21.22 125-129 26.22 27.775 24.86 21.145 130-134 25.705 27.224999999999998 25.374999999999996 21.695 135-139 26.365 26.435 25.874999999999996 21.325 140-144 26.045 27.68 25.165 21.11 145-149 26.435 27.445000000000004 25.074999999999996 21.044999999999998 150-151 26.875 28.475 24.887500000000003 19.7625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 1.0 7 1.0 8 1.0 9 1.5 10 1.0 11 0.0 12 1.0 13 1.5 14 0.5 15 0.5 16 1.0 17 1.5 18 1.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 1.5 25 1.0 26 3.5 27 4.0 28 4.0 29 6.0 30 7.0 31 6.5 32 9.0 33 20.0 34 23.5 35 29.0 36 41.0 37 61.0 38 79.5 39 110.5 40 156.5 41 179.0 42 207.5 43 245.5 44 276.0 45 280.0 46 276.5 47 269.0 48 248.5 49 218.5 50 189.5 51 168.0 52 146.0 53 135.0 54 115.0 55 103.5 56 81.5 57 49.5 58 40.0 59 39.5 60 35.5 61 24.5 62 16.0 63 11.5 64 10.0 65 7.0 66 4.5 67 2.5 68 0.0 69 1.5 70 1.5 71 1.5 72 3.0 73 2.5 74 1.0 75 1.0 76 1.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.5 84 1.0 85 0.5 86 1.5 87 1.5 88 0.0 89 0.5 90 1.5 91 1.0 92 0.5 93 1.5 94 1.0 95 1.0 96 1.0 97 0.0 98 0.5 99 0.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.91931402867584 80.85 2 7.675007028394715 13.65 3 1.012088838909193 2.7 4 0.1405678942929435 0.5 5 0.028113578858588697 0.125 6 0.056227157717177394 0.3 7 0.028113578858588697 0.17500000000000002 8 0.028113578858588697 0.2 9 0.028113578858588697 0.22499999999999998 >10 0.08434073657576609 1.275 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 26 0.65 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 14 0.35000000000000003 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 11 0.27499999999999997 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit CATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 7 0.17500000000000002 No Hit GGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAAG 6 0.15 No Hit ATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit GAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0125 0.0 0.0 112-113 2.35 0.0 0.025 0.0 0.0 114-115 2.625 0.0 0.025 0.0 0.0 116-117 3.075 0.0 0.025 0.0 0.0 118-119 3.4124999999999996 0.0 0.025 0.0 0.0 120-121 3.9125 0.0 0.025 0.0 0.0 122-123 4.25 0.0 0.025 0.0 0.0 124-125 4.7625 0.0 0.025 0.0 0.0 126-127 5.1625 0.0 0.025 0.0 0.0 128-129 5.5625 0.0 0.025 0.0 0.0 130-131 6.175 0.0 0.025 0.0 0.0 132-133 6.575 0.0 0.025 0.0 0.0 134-135 7.125 0.0 0.025 0.0 0.0 136-137 7.475 0.0 0.025 0.0 0.0 138-139 7.9875 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCATC 10 0.006830828 145.0 9 >>END_MODULE Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683947 spots for SRR12690186.sra Written 683947 spots for SRR12690186.sra Read 683966 spots for SRR12690186.sra Written 683966 spots for SRR12690186.sra SRR ids: ['SRR12690186.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9efa6vab SRR12690186.sra spots: 13678959 blocks: [[1, 683947], [683948, 1367894], [1367895, 2051841], [2051842, 2735788], [2735789, 3419735], [3419736, 4103682], [4103683, 4787629], [4787630, 5471576], [5471577, 6155523], [6155524, 6839470], [6839471, 7523417], [7523418, 8207364], [8207365, 8891311], [8891312, 9575258], [9575259, 10259205], [10259206, 10943152], [10943153, 11627099], [11627100, 12311046], [12311047, 12994993], [12994994, 13678959]] SRR12690186 file size 4627008 SRR12690186 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690186 SRR12690186_1.fastq SRR12690186_2.fastq Input file: SRR12690186_1.fastq Paired file: SRR12690186_2.fastq trimmed: SRR12690186-trimmed-pair1.fastq, SRR12690186-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:48:57 2025 >> started Mon Feb 10 21:49:12 2025 >> done (14.666s) 13678959 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 63948 ( 0.47%) empty read pairs filtered out after trimming by size control 13614974 (99.53%) read pairs available; of these: 1840514 (13.52%) trimmed read pairs available after processing 11774460 (86.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 12 0.00% 21 8 0.00% 22 10 0.00% 23 20 0.00% 24 15 0.00% 25 17 0.00% 26 26 0.00% 27 29 0.00% 28 32 0.00% 29 41 0.00% 30 35 0.00% 31 29 0.00% 32 34 0.00% 33 58 0.00% 34 32 0.00% 35 53 0.00% 36 48 0.00% 37 52 0.00% 38 67 0.00% 39 73 0.00% 40 63 0.00% 41 80 0.00% 42 72 0.00% 43 98 0.00% 44 59 0.00% 45 88 0.00% 46 103 0.00% 47 103 0.00% 48 127 0.00% 49 167 0.00% 50 137 0.00% 51 147 0.00% 52 184 0.00% 53 162 0.00% 54 187 0.00% 55 209 0.00% 56 213 0.00% 57 213 0.00% 58 278 0.00% 59 276 0.00% 60 310 0.00% 61 346 0.00% 62 370 0.00% 63 408 0.00% 64 489 0.00% 65 485 0.00% 66 568 0.00% 67 590 0.00% 68 642 0.00% 69 690 0.01% 70 883 0.01% 71 879 0.01% 72 1069 0.01% 73 1292 0.01% 74 1280 0.01% 75 1486 0.01% 76 1592 0.01% 77 1709 0.01% 78 1886 0.01% 79 2157 0.02% 80 2381 0.02% 81 2715 0.02% 82 2951 0.02% 83 3250 0.02% 84 3697 0.03% 85 4150 0.03% 86 4336 0.03% 87 4765 0.03% 88 5286 0.04% 89 5700 0.04% 90 6109 0.04% 91 6741 0.05% 92 7228 0.05% 93 7786 0.06% 94 8644 0.06% 95 9232 0.07% 96 9754 0.07% 97 10391 0.08% 98 11061 0.08% 99 11581 0.09% 100 12358 0.09% 101 12782 0.09% 102 13434 0.10% 103 14270 0.10% 104 15275 0.11% 105 15750 0.12% 106 16500 0.12% 107 17042 0.13% 108 18031 0.13% 109 18717 0.14% 110 19148 0.14% 111 20129 0.15% 112 21679 0.16% 113 21809 0.16% 114 23282 0.17% 115 23631 0.17% 116 24605 0.18% 117 25559 0.19% 118 26579 0.20% 119 26634 0.20% 120 28540 0.21% 121 29437 0.22% 122 30528 0.22% 123 32101 0.24% 124 32421 0.24% 125 32478 0.24% 126 34312 0.25% 127 34677 0.25% 128 35444 0.26% 129 35895 0.26% 130 37940 0.28% 131 37323 0.27% 132 38746 0.28% 133 40423 0.30% 134 40435 0.30% 135 42018 0.31% 136 42620 0.31% 137 42834 0.31% 138 43205 0.32% 139 46033 0.34% 140 45286 0.33% 141 47233 0.35% 142 49036 0.36% 143 49117 0.36% 144 51945 0.38% 145 51976 0.38% 146 52108 0.38% 147 52362 0.38% 148 55461 0.41% 149 53899 0.40% 150 56910 0.42% 151 11774460 86.48% 13614974 reads passed initial QC criterion=sequence-density sequence-density=2.33 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=2.32 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTGTGTAGCT criterion=fanout-score sequence-density=0.41 sequence-density-rank=17 fanout-score=10.24 fanout-score-rank=1 prefix-density=3.05 prefix-fanout=1.4 sequence=CCTCCATGACTCCAGTGTAGACATGGCTCTTCTCAGTC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.90 fanout-score-rank=15 prefix-density=0.93 prefix-fanout=3.1 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=31.66 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.6 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12690186 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:50:04 Started mapping on | Feb 10 21:50:04 Finished on | Feb 10 21:51:39 Mapping speed, Million of reads per hour | 515.94 Number of input reads | 13614974 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12340552 Uniquely mapped reads % | 90.64% Average mapped length | 294.53 Number of splices: Total | 13053764 Number of splices: Annotated (sjdb) | 12823508 Number of splices: GT/AG | 12813270 Number of splices: GC/AG | 176523 Number of splices: AT/AC | 16114 Number of splices: Non-canonical | 47857 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.66 Insertion rate per base | 0.03% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406321 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 404153 % of reads mapped to too many loci | 2.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.92% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 868101 868101 868101 N_multimapping 406321 406321 406321 N_noFeature 538947 11990656 595210 N_ambiguous 387775 1147 93246 UnstrandedReadsAssigned:11413830 PositiveStrandReadsAssigned:348749 NegativeStrandReadsAssigned:11652096 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690186 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690186-trimmed-pair1.fastq SRR12690186-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,614,974 reads, 11,850,928 reads pseudoaligned [quant] estimated average fragment length: 230.578 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR12690186.ke.tsv 34699 SRR12690186.se.tsv 87100 total ==> SRR12690186.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.42 733 14.445 Potri.005G024800.1.v4.1 1035 805.422 927 40.5639 Potri.004G059700.1.v4.1 961 731.438 38 1.831 Potri.007G009000.2.v4.1 1416 1186.42 0 0 Potri.003G141000.2.v4.1 2943 2713.42 228 2.96143 Potri.016G087400.1.v4.1 270 86.7492 1021 414.805 Potri.015G069301.1.v4.1 564 338.555 0 0 Potri.010G195200.1.v4.1 1773 1543.42 46 1.0504 Potri.012G127500.1.v4.1 977 747.422 87 4.10239 ==> SRR12690186.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 136 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12690186 completed mapping pipeline successfully