Starting /dee2/code/volunteer_pipeline.sh SRR12690187 current disk space = 3057054621696 free memory = 1150233324 SRR12690187 SRAfilesize ebdafc894f857b45a69a10ddf1c3b56f SRR12690187.sra SRR12690187.sra file validated SRR12690187 is paired end SRR12690187 is conventional basespace SRR12690187 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690187_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6155 37.0 37.0 37.0 37.0 37.0 2 36.28725 37.0 37.0 37.0 37.0 37.0 3 36.656 37.0 37.0 37.0 37.0 37.0 4 36.6325 37.0 37.0 37.0 37.0 37.0 5 36.7135 37.0 37.0 37.0 37.0 37.0 6 36.677 37.0 37.0 37.0 37.0 37.0 7 36.5775 37.0 37.0 37.0 37.0 37.0 8 36.559 37.0 37.0 37.0 37.0 37.0 9 36.577 37.0 37.0 37.0 37.0 37.0 10-14 36.587199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5674 37.0 37.0 37.0 37.0 37.0 20-24 36.536199999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.519 37.0 37.0 37.0 37.0 37.0 30-34 36.476600000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.46210000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4594 37.0 37.0 37.0 37.0 37.0 45-49 36.455 37.0 37.0 37.0 37.0 37.0 50-54 36.401599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3251 37.0 37.0 37.0 37.0 37.0 60-64 36.3695 37.0 37.0 37.0 37.0 37.0 65-69 36.294200000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3047 37.0 37.0 37.0 37.0 37.0 75-79 36.2864 37.0 37.0 37.0 37.0 37.0 80-84 36.216 37.0 37.0 37.0 37.0 37.0 85-89 36.23909999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.188900000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1923 37.0 37.0 37.0 37.0 37.0 100-104 36.0999 37.0 37.0 37.0 37.0 37.0 105-109 36.0718 37.0 37.0 37.0 37.0 37.0 110-114 36.1005 37.0 37.0 37.0 37.0 37.0 115-119 36.1006 37.0 37.0 37.0 37.0 37.0 120-124 36.029399999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0503 37.0 37.0 37.0 37.0 37.0 130-134 35.9721 37.0 37.0 37.0 37.0 37.0 135-139 35.949600000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.74059999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.724199999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.69425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 3.0 26 4.0 27 2.0 28 9.0 29 15.0 30 22.0 31 42.0 32 56.0 33 65.0 34 125.0 35 342.0 36 2953.0 37 358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.4 11.4 6.25 38.95 2 19.56248428463666 13.226049786271057 35.50414885592155 31.70731707317073 3 16.575 16.0 29.725 37.7 4 20.9 22.5 26.200000000000003 30.4 5 23.9 31.05 23.575 21.475 6 20.525 35.099999999999994 23.599999999999998 20.775 7 13.950000000000001 27.1 40.8 18.15 8 17.424999999999997 24.55 32.425 25.6 9 17.075000000000003 23.825 35.775 23.325000000000003 10-14 19.27 29.735 27.750000000000004 23.244999999999997 15-19 20.34 27.839999999999996 28.275 23.544999999999998 20-24 20.150000000000002 28.499999999999996 28.22 23.13 25-29 19.3 27.925 28.505000000000003 24.27 30-34 19.295 28.71 28.185 23.810000000000002 35-39 19.73 28.37 28.07 23.830000000000002 40-44 20.015 28.4 27.155 24.43 45-49 19.575 27.975 27.93 24.52 50-54 20.044999999999998 27.685 28.29 23.98 55-59 20.39 28.59 27.250000000000004 23.77 60-64 19.695 28.74 27.88 23.685000000000002 65-69 20.724999999999998 27.295 28.194999999999997 23.785 70-74 20.34 27.985 27.675 24.0 75-79 19.96 27.860000000000003 27.855 24.325 80-84 20.02 27.915 28.42 23.645 85-89 20.19 27.92 28.03 23.86 90-94 19.805 28.694999999999997 27.41 24.09 95-99 20.47 27.73 28.075 23.724999999999998 100-104 20.695 28.57 27.71 23.025000000000002 105-109 20.95 28.355000000000004 27.1 23.595 110-114 20.369999999999997 27.575 28.155 23.9 115-119 21.325 28.02 27.200000000000003 23.455000000000002 120-124 20.275000000000002 28.62 27.13 23.974999999999998 125-129 20.865000000000002 27.584999999999997 27.85 23.7 130-134 20.625 28.305000000000003 27.284999999999997 23.785 135-139 20.82 28.194999999999997 27.52 23.465 140-144 21.295 27.435 26.724999999999998 24.545 145-149 21.465 27.700000000000003 27.51 23.325000000000003 150-151 20.7625 27.575 27.625 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 2.5 25 3.5 26 5.0 27 7.5 28 8.5 29 13.5 30 20.5 31 25.0 32 28.5 33 43.5 34 59.0 35 71.0 36 87.5 37 100.5 38 124.5 39 151.5 40 183.5 41 219.5 42 247.0 43 259.0 44 260.5 45 247.5 46 246.5 47 237.5 48 236.0 49 221.0 50 165.5 51 144.0 52 128.0 53 101.0 54 77.5 55 69.5 56 60.0 57 45.0 58 31.5 59 17.5 60 11.5 61 9.5 62 8.0 63 5.0 64 3.5 65 2.0 66 0.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.9 #Duplication Level Percentage of deduplicated Percentage of total 1 89.76640711902112 80.7 2 9.315906562847609 16.75 3 0.8620689655172413 2.325 4 0.027808676307007785 0.1 5 0.027808676307007785 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCTGGACATGAGGGAGAAAATCTCTGCTACCACTGGATTGGTTTTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.3875 0.0 0.0 0.0 0.0 118-119 2.5999999999999996 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 3.8375 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.55 0.0 0.0 0.0 0.0 132-133 4.9375 0.0 0.0 0.0 0.0 134-135 5.3125 0.0 0.0 0.0 0.0 136-137 5.824999999999999 0.0 0.0 0.0 0.0 138-139 6.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATGT 10 0.006830828 145.0 3 GGACTTG 10 0.006830828 145.0 3 CAAAGAA 10 0.006830828 145.0 5 >>END_MODULE SRR12690187 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690187_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1425 37.0 37.0 37.0 37.0 37.0 2 35.717 37.0 37.0 37.0 37.0 37.0 3 35.975 37.0 37.0 37.0 37.0 37.0 4 35.9535 37.0 37.0 37.0 37.0 37.0 5 36.078 37.0 37.0 37.0 37.0 37.0 6 36.006 37.0 37.0 37.0 37.0 37.0 7 36.1675 37.0 37.0 37.0 37.0 37.0 8 36.098 37.0 37.0 37.0 37.0 37.0 9 36.181 37.0 37.0 37.0 37.0 37.0 10-14 36.08970000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.118100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.077 37.0 37.0 37.0 37.0 37.0 25-29 36.013400000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.9365 37.0 37.0 37.0 37.0 37.0 35-39 35.912099999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.91369999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.945100000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.8085 37.0 37.0 37.0 37.0 37.0 55-59 35.8583 37.0 37.0 37.0 37.0 37.0 60-64 35.8384 37.0 37.0 37.0 37.0 37.0 65-69 35.791900000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.6978 37.0 37.0 37.0 37.0 37.0 75-79 35.7513 37.0 37.0 37.0 37.0 37.0 80-84 35.7495 37.0 37.0 37.0 37.0 37.0 85-89 35.6495 37.0 37.0 37.0 37.0 37.0 90-94 35.6196 37.0 37.0 37.0 37.0 37.0 95-99 35.6824 37.0 37.0 37.0 37.0 37.0 100-104 35.6969 37.0 37.0 37.0 37.0 37.0 105-109 35.6211 37.0 37.0 37.0 37.0 37.0 110-114 35.5625 37.0 37.0 37.0 37.0 37.0 115-119 35.4985 37.0 37.0 37.0 37.0 37.0 120-124 35.4037 37.0 37.0 37.0 37.0 37.0 125-129 35.299200000000006 37.0 37.0 37.0 32.2 37.0 130-134 35.3728 37.0 37.0 37.0 37.0 37.0 135-139 35.2446 37.0 37.0 37.0 32.2 37.0 140-144 35.127700000000004 37.0 37.0 37.0 27.4 37.0 145-149 34.9511 37.0 37.0 37.0 25.0 37.0 150-151 34.46625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 3.0 16 2.0 17 2.0 18 0.0 19 0.0 20 1.0 21 4.0 22 5.0 23 4.0 24 9.0 25 12.0 26 6.0 27 15.0 28 23.0 29 30.0 30 44.0 31 46.0 32 69.0 33 125.0 34 218.0 35 694.0 36 2497.0 37 185.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.525 25.874999999999996 9.075 23.525 2 28.975 28.225 28.225 14.575 3 20.25 28.599999999999998 30.75 20.4 4 22.425 34.75 24.85 17.974999999999998 5 25.074999999999996 35.625 22.900000000000002 16.400000000000002 6 21.475 38.775 22.0 17.75 7 20.925 23.599999999999998 37.15 18.325 8 20.575 27.075 27.775 24.575 9 22.575 25.025 29.075 23.325000000000003 10-14 23.98 29.34 26.395000000000003 20.285 15-19 23.445 28.64 27.395000000000003 20.52 20-24 22.745 28.985 27.355 20.915 25-29 22.7 28.615000000000002 27.66 21.025 30-34 22.58 28.64 28.08 20.7 35-39 22.475 28.244999999999997 27.62 21.66 40-44 22.939999999999998 28.384999999999998 27.060000000000002 21.615000000000002 45-49 22.325 28.105000000000004 28.535 21.035 50-54 23.265 28.29 27.62 20.825 55-59 22.770000000000003 28.294999999999998 27.57 21.365000000000002 60-64 23.549999999999997 27.800000000000004 27.27 21.38 65-69 22.705000000000002 28.415000000000003 27.85 21.029999999999998 70-74 23.3 28.33 27.405 20.965 75-79 23.445 28.13 27.395000000000003 21.029999999999998 80-84 23.735 28.115000000000002 27.165 20.985 85-89 23.885 28.225 27.175 20.715 90-94 23.645 28.235 27.105 21.015 95-99 23.57 27.884999999999998 27.63 20.915 100-104 24.085 28.355000000000004 27.134999999999998 20.424999999999997 105-109 23.25 28.48 27.505000000000003 20.765 110-114 23.735 28.18 27.215 20.87 115-119 23.75 27.565 27.705000000000002 20.979999999999997 120-124 24.15 27.985 27.41 20.455000000000002 125-129 24.779999999999998 27.839999999999996 27.04 20.34 130-134 24.705 27.845 27.169999999999998 20.28 135-139 25.275 28.16 26.665 19.900000000000002 140-144 25.41 27.79 26.61 20.19 145-149 25.185000000000002 28.09 26.985 19.74 150-151 24.875 27.462500000000002 27.250000000000004 20.4125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.5 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 1.5 19 2.0 20 1.0 21 1.0 22 1.5 23 3.0 24 4.0 25 4.5 26 6.5 27 9.5 28 8.5 29 10.5 30 20.5 31 24.5 32 32.0 33 35.0 34 43.0 35 67.0 36 86.5 37 106.5 38 133.0 39 170.5 40 212.5 41 240.5 42 255.5 43 251.0 44 241.0 45 256.5 46 258.0 47 242.5 48 218.0 49 186.5 50 174.5 51 146.0 52 98.5 53 85.0 54 85.0 55 64.5 56 44.0 57 33.5 58 29.5 59 29.0 60 19.0 61 10.0 62 7.5 63 5.5 64 6.0 65 2.5 66 1.5 67 1.5 68 1.0 69 1.0 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 1.0 97 0.5 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.025 #Duplication Level Percentage of deduplicated Percentage of total 1 90.19716745348514 81.2 2 8.830880311024716 15.9 3 0.860871980005554 2.325 4 0.0 0.0 5 0.027770063871146906 0.125 6 0.0833101916134407 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCC 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CACAATACCAGCAAAAACCAGAACAAAAAACCTCTAGAATGGCCACTGTC 6 0.15 No Hit ACCCTTTTCAATACTGAAATCAACAAGAAATTGAACCAGTCTGAGTTTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 3.025 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.2 0.0 0.0 0.0 0.0 130-131 4.625 0.0 0.0 0.0 0.0 132-133 5.0125 0.0 0.0 0.0 0.0 134-135 5.4 0.0 0.0 0.0 0.0 136-137 5.925000000000001 0.0 0.0 0.0 0.0 138-139 6.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAAAA 10 0.006830828 145.0 7 >>END_MODULE Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra Read 656677 spots for SRR12690187.sra Written 656677 spots for SRR12690187.sra Read 656674 spots for SRR12690187.sra Written 656674 spots for SRR12690187.sra SRR ids: ['SRR12690187.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j7dp4yp2 SRR12690187.sra spots: 13133483 blocks: [[1, 656674], [656675, 1313348], [1313349, 1970022], [1970023, 2626696], [2626697, 3283370], [3283371, 3940044], [3940045, 4596718], [4596719, 5253392], [5253393, 5910066], [5910067, 6566740], [6566741, 7223414], [7223415, 7880088], [7880089, 8536762], [8536763, 9193436], [9193437, 9850110], [9850111, 10506784], [10506785, 11163458], [11163459, 11820132], [11820133, 12476806], [12476807, 13133483]] SRR12690187 file size 4441631 SRR12690187 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690187 SRR12690187_1.fastq SRR12690187_2.fastq Input file: SRR12690187_1.fastq Paired file: SRR12690187_2.fastq trimmed: SRR12690187-trimmed-pair1.fastq, SRR12690187-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:58:48 2025 >> started Mon Feb 10 21:59:09 2025 >> done (20.808s) 13133483 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 2750 ( 0.02%) empty read pairs filtered out after trimming by size control 13130703 (99.98%) read pairs available; of these: 1242544 ( 9.46%) trimmed read pairs available after processing 11888159 (90.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 4 0.00% 21 5 0.00% 22 9 0.00% 23 9 0.00% 24 13 0.00% 25 11 0.00% 26 12 0.00% 27 17 0.00% 28 17 0.00% 29 20 0.00% 30 9 0.00% 31 19 0.00% 32 18 0.00% 33 14 0.00% 34 20 0.00% 35 23 0.00% 36 19 0.00% 37 25 0.00% 38 23 0.00% 39 26 0.00% 40 21 0.00% 41 22 0.00% 42 30 0.00% 43 22 0.00% 44 20 0.00% 45 34 0.00% 46 35 0.00% 47 36 0.00% 48 42 0.00% 49 48 0.00% 50 42 0.00% 51 49 0.00% 52 64 0.00% 53 67 0.00% 54 60 0.00% 55 70 0.00% 56 91 0.00% 57 99 0.00% 58 125 0.00% 59 143 0.00% 60 145 0.00% 61 166 0.00% 62 194 0.00% 63 215 0.00% 64 221 0.00% 65 243 0.00% 66 273 0.00% 67 291 0.00% 68 328 0.00% 69 356 0.00% 70 427 0.00% 71 543 0.00% 72 606 0.00% 73 696 0.01% 74 730 0.01% 75 842 0.01% 76 854 0.01% 77 1032 0.01% 78 1214 0.01% 79 1202 0.01% 80 1414 0.01% 81 1604 0.01% 82 1838 0.01% 83 1930 0.01% 84 2212 0.02% 85 2479 0.02% 86 2798 0.02% 87 2886 0.02% 88 3121 0.02% 89 3297 0.03% 90 3643 0.03% 91 3940 0.03% 92 4443 0.03% 93 4982 0.04% 94 5194 0.04% 95 5490 0.04% 96 5871 0.04% 97 6209 0.05% 98 6666 0.05% 99 6930 0.05% 100 7552 0.06% 101 7856 0.06% 102 8667 0.07% 103 9336 0.07% 104 9401 0.07% 105 10118 0.08% 106 10596 0.08% 107 11045 0.08% 108 11501 0.09% 109 11773 0.09% 110 12139 0.09% 111 12944 0.10% 112 13710 0.10% 113 14145 0.11% 114 15001 0.11% 115 15668 0.12% 116 16016 0.12% 117 16613 0.13% 118 17105 0.13% 119 17482 0.13% 120 18557 0.14% 121 19078 0.15% 122 20213 0.15% 123 20897 0.16% 124 21376 0.16% 125 22003 0.17% 126 23200 0.18% 127 23833 0.18% 128 23857 0.18% 129 24695 0.19% 130 25762 0.20% 131 25600 0.19% 132 26747 0.20% 133 28036 0.21% 134 28570 0.22% 135 29535 0.22% 136 30066 0.23% 137 30239 0.23% 138 30839 0.23% 139 31606 0.24% 140 32255 0.25% 141 33485 0.26% 142 34250 0.26% 143 35045 0.27% 144 36208 0.28% 145 36966 0.28% 146 37365 0.28% 147 37968 0.29% 148 38323 0.29% 149 38419 0.29% 150 39921 0.30% 151 11888159 90.54% 13130703 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=24 prefix-density=0.41 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=13.19 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=5.4 sequence=GCTCCAAGCATGGCCCACCTGGAATGGATGACTTCAAGCTCACGGTTCTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=24 prefix-density=0.70 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=66.98 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.2 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAA SRR12690187 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:59:50 Started mapping on | Feb 10 21:59:50 Finished on | Feb 10 22:01:06 Mapping speed, Million of reads per hour | 621.98 Number of input reads | 13130703 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12391320 Uniquely mapped reads % | 94.37% Average mapped length | 296.47 Number of splices: Total | 11882172 Number of splices: Annotated (sjdb) | 11574027 Number of splices: GT/AG | 11646357 Number of splices: GC/AG | 190281 Number of splices: AT/AC | 10319 Number of splices: Non-canonical | 35215 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.06 Insertion rate per base | 0.03% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309924 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 100035 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 429459 429459 429459 N_multimapping 309924 309924 309924 N_noFeature 571441 12232480 633068 N_ambiguous 173025 865 75319 UnstrandedReadsAssigned:11646854 PositiveStrandReadsAssigned:157975 NegativeStrandReadsAssigned:11682933 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690187 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690187-trimmed-pair1.fastq SRR12690187-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,130,703 reads, 11,755,919 reads pseudoaligned [quant] estimated average fragment length: 259.945 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 985 rounds 52401 SRR12690187.ke.tsv 34699 SRR12690187.se.tsv 87100 total ==> SRR12690187.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.05 332 14.6979 Potri.005G024800.1.v4.1 1035 776.055 235 23.5816 Potri.004G059700.1.v4.1 961 702.195 6 0.665413 Potri.007G009000.2.v4.1 1416 1157.05 0 0 Potri.003G141000.2.v4.1 2943 2684.05 373 10.8222 Potri.016G087400.1.v4.1 270 81.272 589 564.381 Potri.015G069301.1.v4.1 564 319.186 0 0 Potri.010G195200.1.v4.1 1773 1514.05 8 0.411478 Potri.012G127500.1.v4.1 977 718.121 107 11.6034 ==> SRR12690187.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 54 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 164 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12690187 completed mapping pipeline successfully