Starting /dee2/code/volunteer_pipeline.sh SRR12690188 current disk space = 3056991571968 free memory = 1105326420 SRR12690188 SRAfilesize e5f5672a71aacbde7de48f094cee3ce3 SRR12690188.sra SRR12690188.sra file validated SRR12690188 is paired end SRR12690188 is conventional basespace SRR12690188 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690188_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.723 37.0 37.0 37.0 37.0 37.0 2 36.488 37.0 37.0 37.0 37.0 37.0 3 36.568 37.0 37.0 37.0 37.0 37.0 4 36.574 37.0 37.0 37.0 37.0 37.0 5 36.597 37.0 37.0 37.0 37.0 37.0 6 36.5565 37.0 37.0 37.0 37.0 37.0 7 36.501 37.0 37.0 37.0 37.0 37.0 8 36.567 37.0 37.0 37.0 37.0 37.0 9 36.644 37.0 37.0 37.0 37.0 37.0 10-14 36.5635 37.0 37.0 37.0 37.0 37.0 15-19 36.5244 37.0 37.0 37.0 37.0 37.0 20-24 36.5456 37.0 37.0 37.0 37.0 37.0 25-29 36.462900000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4717 37.0 37.0 37.0 37.0 37.0 35-39 36.4789 37.0 37.0 37.0 37.0 37.0 40-44 36.43659999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.3726 37.0 37.0 37.0 37.0 37.0 50-54 36.3722 37.0 37.0 37.0 37.0 37.0 55-59 36.2961 37.0 37.0 37.0 37.0 37.0 60-64 36.2889 37.0 37.0 37.0 37.0 37.0 65-69 36.2277 37.0 37.0 37.0 37.0 37.0 70-74 36.2124 37.0 37.0 37.0 37.0 37.0 75-79 36.267599999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.2034 37.0 37.0 37.0 37.0 37.0 85-89 36.195899999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.1339 37.0 37.0 37.0 37.0 37.0 95-99 36.0726 37.0 37.0 37.0 37.0 37.0 100-104 36.0526 37.0 37.0 37.0 37.0 37.0 105-109 36.1071 37.0 37.0 37.0 37.0 37.0 110-114 36.036300000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.9707 37.0 37.0 37.0 37.0 37.0 120-124 35.8356 37.0 37.0 37.0 37.0 37.0 125-129 35.8146 37.0 37.0 37.0 37.0 37.0 130-134 35.675599999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5537 37.0 37.0 37.0 37.0 37.0 140-144 35.246700000000004 37.0 37.0 37.0 37.0 37.0 145-149 34.9966 37.0 37.0 37.0 29.8 37.0 150-151 34.706500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 2.0 20 1.0 21 0.0 22 1.0 23 2.0 24 0.0 25 8.0 26 4.0 27 6.0 28 15.0 29 15.0 30 16.0 31 44.0 32 97.0 33 94.0 34 152.0 35 315.0 36 2894.0 37 332.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.575 12.325 9.025 37.075 2 20.64128256513026 14.754509018036071 32.565130260521045 32.03907815631262 3 18.05 18.4 26.974999999999998 36.575 4 21.075 26.775 23.35 28.799999999999997 5 22.900000000000002 32.7 22.650000000000002 21.75 6 21.275 35.375 22.975 20.375 7 16.475 24.15 42.0 17.375 8 19.025 25.4 30.85 24.725 9 18.95 24.25 32.975 23.825 10-14 19.84 30.055 26.790000000000003 23.315 15-19 20.385 28.12 27.939999999999998 23.555 20-24 20.365 28.265 27.744999999999997 23.625 25-29 20.62 28.444999999999997 27.029999999999998 23.905 30-34 20.075000000000003 29.005 27.339999999999996 23.580000000000002 35-39 20.18 27.76 28.044999999999998 24.015 40-44 20.44 28.74 27.275 23.544999999999998 45-49 20.380000000000003 28.625 27.165 23.830000000000002 50-54 20.755000000000003 27.935 27.215 24.095 55-59 20.705000000000002 27.905 27.634999999999998 23.755000000000003 60-64 20.064999999999998 28.585 27.595 23.755000000000003 65-69 20.974999999999998 28.144999999999996 27.055 23.825 70-74 20.244999999999997 28.78 27.79 23.185 75-79 20.835 28.305000000000003 27.36 23.5 80-84 21.105 28.24 27.439999999999998 23.215 85-89 21.11 28.73 26.889999999999997 23.27 90-94 21.2 28.084999999999997 27.11 23.605 95-99 20.66 28.299999999999997 27.265 23.775 100-104 20.845 28.38 27.62 23.155 105-109 21.265 28.49 27.015 23.23 110-114 21.435000000000002 28.055000000000003 27.105 23.405 115-119 21.12 28.105000000000004 26.39 24.385 120-124 21.240000000000002 28.34 26.334999999999997 24.085 125-129 21.89 28.935 25.255 23.919999999999998 130-134 21.759999999999998 28.365000000000002 25.7 24.175 135-139 21.275 28.01 26.0 24.715 140-144 22.025 27.67 25.240000000000002 25.064999999999998 145-149 21.78 27.810000000000002 25.669999999999998 24.740000000000002 150-151 22.3875 28.175 24.2 25.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 3.5 25 2.5 26 2.0 27 4.5 28 7.0 29 11.0 30 17.5 31 19.0 32 25.0 33 36.5 34 49.0 35 62.5 36 79.0 37 99.5 38 124.5 39 147.0 40 190.5 41 215.5 42 223.5 43 256.5 44 267.5 45 249.0 46 254.0 47 267.5 48 235.5 49 211.5 50 194.5 51 161.5 52 123.5 53 95.5 54 73.0 55 60.5 56 59.5 57 47.0 58 33.0 59 24.0 60 15.5 61 11.5 62 8.0 63 2.0 64 1.5 65 1.5 66 0.5 67 2.0 68 2.5 69 0.5 70 1.5 71 2.5 72 2.0 73 2.5 74 2.5 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.75 #Duplication Level Percentage of deduplicated Percentage of total 1 92.42506811989101 84.8 2 6.485013623978202 11.899999999999999 3 0.7629427792915531 2.1 4 0.32697547683923706 1.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.30000000000000004 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.4625 0.0 0.0 0.0 0.0 78-79 0.6875 0.0 0.0 0.0 0.0 80-81 0.8500000000000001 0.0 0.0 0.0 0.0 82-83 1.0375 0.0 0.0 0.0 0.0 84-85 1.15 0.0 0.0 0.0 0.0 86-87 1.2875 0.0 0.0 0.0 0.0 88-89 1.4625 0.0 0.0 0.0 0.0 90-91 1.825 0.0 0.0 0.0 0.0 92-93 2.175 0.0 0.0 0.0 0.0 94-95 2.6125 0.0 0.0 0.0 0.0 96-97 3.0625 0.0 0.0 0.0 0.0 98-99 3.5 0.0 0.0 0.0 0.0 100-101 3.9749999999999996 0.0 0.0 0.0 0.0 102-103 4.3625 0.0 0.0 0.0 0.0 104-105 4.925000000000001 0.0 0.0 0.0 0.0 106-107 5.5 0.0 0.0 0.0 0.0 108-109 6.125 0.0 0.0 0.0 0.0 110-111 6.875 0.0 0.0 0.0 0.0 112-113 7.6125 0.0 0.0 0.0 0.0 114-115 8.2875 0.0 0.0 0.0 0.0 116-117 9.125 0.0 0.0 0.0 0.0 118-119 10.0625 0.0 0.0 0.0 0.0 120-121 10.875 0.0 0.0 0.0 0.0 122-123 11.6125 0.0 0.0 0.0 0.0 124-125 12.850000000000001 0.0 0.0 0.0 0.0 126-127 13.825 0.0 0.0 0.0 0.0 128-129 14.7625 0.0 0.0 0.0 0.0 130-131 15.875 0.0 0.0 0.0 0.0 132-133 16.925 0.0 0.0 0.0 0.0 134-135 17.8875 0.0 0.0 0.0 0.0 136-137 18.95 0.0 0.0 0.0 0.0 138-139 20.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690188 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690188_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3775 37.0 37.0 37.0 37.0 37.0 2 36.2125 37.0 37.0 37.0 37.0 37.0 3 36.2905 37.0 37.0 37.0 37.0 37.0 4 36.3135 37.0 37.0 37.0 37.0 37.0 5 36.309 37.0 37.0 37.0 37.0 37.0 6 36.265 37.0 37.0 37.0 37.0 37.0 7 36.337 37.0 37.0 37.0 37.0 37.0 8 36.3655 37.0 37.0 37.0 37.0 37.0 9 36.349 37.0 37.0 37.0 37.0 37.0 10-14 36.3207 37.0 37.0 37.0 37.0 37.0 15-19 36.313900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.352 37.0 37.0 37.0 37.0 37.0 25-29 36.2186 37.0 37.0 37.0 37.0 37.0 30-34 36.2428 37.0 37.0 37.0 37.0 37.0 35-39 36.2195 37.0 37.0 37.0 37.0 37.0 40-44 36.18920000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.1881 37.0 37.0 37.0 37.0 37.0 50-54 36.104699999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.137299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.070499999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.074299999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.969800000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.987 37.0 37.0 37.0 37.0 37.0 80-84 36.00750000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.997699999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.9318 37.0 37.0 37.0 37.0 37.0 95-99 35.9491 37.0 37.0 37.0 37.0 37.0 100-104 36.0081 37.0 37.0 37.0 37.0 37.0 105-109 35.9457 37.0 37.0 37.0 37.0 37.0 110-114 35.854600000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.792500000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.675599999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.615700000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.4877 37.0 37.0 37.0 37.0 37.0 135-139 35.362 37.0 37.0 37.0 37.0 37.0 140-144 35.1511 37.0 37.0 37.0 32.2 37.0 145-149 34.97259999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.326499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 2.0 16 4.0 17 2.0 18 0.0 19 3.0 20 1.0 21 4.0 22 2.0 23 7.0 24 2.0 25 10.0 26 11.0 27 11.0 28 6.0 29 20.0 30 30.0 31 45.0 32 53.0 33 110.0 34 174.0 35 437.0 36 2710.0 37 350.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.05 23.0 11.325000000000001 24.625 2 30.4 25.374999999999996 28.199999999999996 16.025 3 21.975 27.650000000000002 30.3 20.075000000000003 4 24.8 33.1 23.35 18.75 5 25.5 34.625 21.575 18.3 6 22.3 38.224999999999994 22.675 16.8 7 21.5 21.349999999999998 36.9 20.25 8 22.625 25.775 27.35 24.25 9 21.925 25.7 30.349999999999998 22.025 10-14 23.93 29.21 25.669999999999998 21.19 15-19 23.419999999999998 28.910000000000004 27.325 20.345 20-24 23.36 28.16 27.905 20.575 25-29 22.98 28.325 27.400000000000002 21.295 30-34 22.88 28.12 27.88 21.12 35-39 23.235 27.825 27.755000000000003 21.185000000000002 40-44 23.294999999999998 28.199999999999996 27.889999999999997 20.615 45-49 23.189999999999998 28.16 27.689999999999998 20.96 50-54 22.74 27.87 28.310000000000002 21.08 55-59 23.48 28.22 27.534999999999997 20.765 60-64 23.585 27.965 27.325 21.125 65-69 23.48 27.91 27.825 20.785 70-74 23.115 27.74 27.389999999999997 21.755 75-79 23.535 28.04 26.919999999999998 21.505 80-84 23.315 28.04 27.49 21.154999999999998 85-89 23.97 27.98 27.345000000000002 20.705000000000002 90-94 24.01 27.439999999999998 27.334999999999997 21.215 95-99 24.315 28.494999999999997 26.924999999999997 20.265 100-104 25.174999999999997 27.439999999999998 26.889999999999997 20.495 105-109 24.46 27.905 27.305 20.330000000000002 110-114 25.025 28.37 26.724999999999998 19.88 115-119 25.56 28.415000000000003 26.355 19.67 120-124 25.735000000000003 28.425 25.785000000000004 20.055 125-129 25.795 28.139999999999997 26.32 19.744999999999997 130-134 27.115000000000002 27.77 25.775 19.34 135-139 27.339999999999996 27.650000000000002 25.83 19.18 140-144 27.315 27.800000000000004 25.66 19.225 145-149 27.779999999999998 27.405 25.745 19.07 150-151 28.8375 27.450000000000003 24.8125 18.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.5 9 1.0 10 1.5 11 1.5 12 0.5 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 3.0 23 3.0 24 2.0 25 1.0 26 1.0 27 5.0 28 6.0 29 8.5 30 18.0 31 22.0 32 25.5 33 31.0 34 43.5 35 58.5 36 77.0 37 118.0 38 143.5 39 157.0 40 183.0 41 209.5 42 243.0 43 262.0 44 261.5 45 266.0 46 266.5 47 256.5 48 235.5 49 192.5 50 158.0 51 144.5 52 125.5 53 101.5 54 86.5 55 70.5 56 51.0 57 33.0 58 22.5 59 19.5 60 13.5 61 10.5 62 10.0 63 8.0 64 4.5 65 1.5 66 0.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.5 95 1.0 96 0.5 97 0.5 98 0.0 99 0.0 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.15740231150248 83.72500000000001 2 6.769400110071547 12.3 3 0.6329113924050633 1.725 4 0.24766097963676387 0.8999999999999999 5 0.0550357732526142 0.25 6 0.0275178866263071 0.15 7 0.0 0.0 8 0.0550357732526142 0.4 9 0.0275178866263071 0.22499999999999998 >10 0.0275178866263071 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 8 0.2 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 8 0.2 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit GGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.30000000000000004 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.4625 0.0 0.0 0.0 0.0 78-79 0.6875 0.0 0.0 0.0 0.0 80-81 0.8500000000000001 0.0 0.0 0.0 0.0 82-83 1.0375 0.0 0.0 0.0 0.0 84-85 1.15 0.0 0.0 0.0 0.0 86-87 1.2875 0.0 0.0 0.0 0.0 88-89 1.4625 0.0 0.0 0.0 0.0 90-91 1.85 0.0 0.0 0.0 0.0 92-93 2.2 0.0 0.0 0.0 0.0 94-95 2.6375 0.0 0.0 0.0 0.0 96-97 3.0875 0.0 0.0 0.0 0.0 98-99 3.525 0.0 0.0 0.0 0.0 100-101 3.95 0.0 0.0 0.0 0.0 102-103 4.3375 0.0 0.0 0.0 0.0 104-105 4.925000000000001 0.0 0.0 0.0 0.0 106-107 5.5 0.0 0.0 0.0 0.0 108-109 6.125 0.0 0.0 0.0 0.0 110-111 6.9 0.0 0.0 0.0 0.0 112-113 7.6625 0.0 0.0 0.0 0.0 114-115 8.350000000000001 0.0 0.0 0.0 0.0 116-117 9.2 0.0 0.0 0.0 0.0 118-119 10.1375 0.0 0.0 0.0 0.0 120-121 10.9625 0.0 0.0 0.0 0.0 122-123 11.725 0.0 0.0 0.0 0.0 124-125 12.975000000000001 0.0 0.0 0.0 0.0 126-127 13.9625 0.0 0.0 0.0 0.0 128-129 14.925 0.0 0.0 0.0 0.0 130-131 16.0125 0.0 0.0 0.0 0.0 132-133 17.05 0.0 0.0 0.0 0.0 134-135 18.025 0.0 0.0 0.0 0.0 136-137 19.0875 0.0 0.0 0.0 0.0 138-139 20.200000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901116 spots for SRR12690188.sra Written 901116 spots for SRR12690188.sra Read 901122 spots for SRR12690188.sra Written 901122 spots for SRR12690188.sra SRR ids: ['SRR12690188.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w81524pw SRR12690188.sra spots: 18022326 blocks: [[1, 901116], [901117, 1802232], [1802233, 2703348], [2703349, 3604464], [3604465, 4505580], [4505581, 5406696], [5406697, 6307812], [6307813, 7208928], [7208929, 8110044], [8110045, 9011160], [9011161, 9912276], [9912277, 10813392], [10813393, 11714508], [11714509, 12615624], [12615625, 13516740], [13516741, 14417856], [14417857, 15318972], [15318973, 16220088], [16220089, 17121204], [17121205, 18022326]] SRR12690188 file size 6103074 SRR12690188 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690188 SRR12690188_1.fastq SRR12690188_2.fastq Input file: SRR12690188_1.fastq Paired file: SRR12690188_2.fastq trimmed: SRR12690188-trimmed-pair1.fastq, SRR12690188-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:55:50 2025 >> started Mon Feb 10 21:56:20 2025 >> done (29.613s) 18022326 read pairs processed; of these: 77 ( 0.00%) short read pairs filtered out after trimming by size control 28166 ( 0.16%) empty read pairs filtered out after trimming by size control 17994083 (99.84%) read pairs available; of these: 4895235 (27.20%) trimmed read pairs available after processing 13098848 (72.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 11 0.00% 20 10 0.00% 21 6 0.00% 22 9 0.00% 23 16 0.00% 24 27 0.00% 25 28 0.00% 26 29 0.00% 27 40 0.00% 28 42 0.00% 29 36 0.00% 30 32 0.00% 31 30 0.00% 32 38 0.00% 33 48 0.00% 34 47 0.00% 35 64 0.00% 36 66 0.00% 37 63 0.00% 38 80 0.00% 39 84 0.00% 40 104 0.00% 41 130 0.00% 42 118 0.00% 43 144 0.00% 44 132 0.00% 45 155 0.00% 46 183 0.00% 47 225 0.00% 48 277 0.00% 49 309 0.00% 50 379 0.00% 51 446 0.00% 52 504 0.00% 53 544 0.00% 54 547 0.00% 55 587 0.00% 56 645 0.00% 57 782 0.00% 58 864 0.00% 59 1082 0.01% 60 1332 0.01% 61 1687 0.01% 62 1780 0.01% 63 1911 0.01% 64 2128 0.01% 65 2272 0.01% 66 2475 0.01% 67 2669 0.01% 68 3257 0.02% 69 3742 0.02% 70 4499 0.03% 71 4918 0.03% 72 5950 0.03% 73 6676 0.04% 74 7110 0.04% 75 7930 0.04% 76 8465 0.05% 77 9072 0.05% 78 10000 0.06% 79 11310 0.06% 80 12700 0.07% 81 14408 0.08% 82 16270 0.09% 83 17762 0.10% 84 19765 0.11% 85 20966 0.12% 86 22106 0.12% 87 23239 0.13% 88 25495 0.14% 89 26341 0.15% 90 29507 0.16% 91 31854 0.18% 92 34220 0.19% 93 37141 0.21% 94 39691 0.22% 95 41737 0.23% 96 42160 0.23% 97 44140 0.25% 98 44741 0.25% 99 46961 0.26% 100 50401 0.28% 101 51453 0.29% 102 55155 0.31% 103 57328 0.32% 104 60186 0.33% 105 61643 0.34% 106 62401 0.35% 107 62978 0.35% 108 62971 0.35% 109 64866 0.36% 110 65874 0.37% 111 69103 0.38% 112 71781 0.40% 113 73356 0.41% 114 76799 0.43% 115 77834 0.43% 116 78637 0.44% 117 78300 0.44% 118 78912 0.44% 119 79042 0.44% 120 81652 0.45% 121 82305 0.46% 122 84350 0.47% 123 86790 0.48% 124 88893 0.49% 125 88709 0.49% 126 90206 0.50% 127 89881 0.50% 128 88607 0.49% 129 86900 0.48% 130 89288 0.50% 131 89594 0.50% 132 91087 0.51% 133 93821 0.52% 134 93817 0.52% 135 95527 0.53% 136 95338 0.53% 137 94866 0.53% 138 93869 0.52% 139 94680 0.53% 140 92894 0.52% 141 93632 0.52% 142 94714 0.53% 143 95491 0.53% 144 97748 0.54% 145 98029 0.54% 146 98511 0.55% 147 96768 0.54% 148 98209 0.55% 149 94851 0.53% 150 95836 0.53% 151 13098848 72.80% 17994083 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=10 prefix-density=0.55 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.21 sequence-density-rank=17 fanout-score=9.65 fanout-score-rank=1 prefix-density=1.36 prefix-fanout=1.5 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACCGCCTTTCCGGCTAGCGAAGGGGA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=21 prefix-density=0.45 prefix-fanout=2.3 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.14 sequence-density-rank=24 fanout-score=28.31 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=11.1 sequence=AAAGAAAAGAAAA SRR12690188 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:57:05 Started mapping on | Feb 10 21:57:06 Finished on | Feb 10 21:59:08 Mapping speed, Million of reads per hour | 530.97 Number of input reads | 17994083 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 16695696 Uniquely mapped reads % | 92.78% Average mapped length | 284.47 Number of splices: Total | 16103682 Number of splices: Annotated (sjdb) | 15678230 Number of splices: GT/AG | 15745019 Number of splices: GC/AG | 247432 Number of splices: AT/AC | 11425 Number of splices: Non-canonical | 99806 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 428126 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 71028 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.23% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 870261 870261 870261 N_multimapping 428126 428126 428126 N_noFeature 630638 16381535 748306 N_ambiguous 311169 1067 113968 UnstrandedReadsAssigned:15753889 PositiveStrandReadsAssigned:313094 NegativeStrandReadsAssigned:15833422 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=138 echo kmer=133 SRR12690188 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690188-trimmed-pair1.fastq SRR12690188-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,994,083 reads, 15,813,262 reads pseudoaligned [quant] estimated average fragment length: 200.118 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR12690188.ke.tsv 34699 SRR12690188.se.tsv 87100 total ==> SRR12690188.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.88 484 13.3967 Potri.005G024800.1.v4.1 1035 835.882 272 16.3825 Potri.004G059700.1.v4.1 961 761.892 25 1.65197 Potri.007G009000.2.v4.1 1416 1216.88 0 0 Potri.003G141000.2.v4.1 2943 2743.88 1099 20.1646 Potri.016G087400.1.v4.1 270 106.141 723.897 343.361 Potri.015G069301.1.v4.1 564 367.748 0 0 Potri.010G195200.1.v4.1 1773 1573.88 35 1.11957 Potri.012G127500.1.v4.1 977 777.887 150 9.70803 ==> SRR12690188.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR12690188 completed mapping pipeline successfully