Starting /dee2/code/volunteer_pipeline.sh SRR12690189 current disk space = 3057007329280 free memory = 1332990960 SRR12690189 SRAfilesize 092a4cff4c128786d1faa851acb5d45c SRR12690189.sra SRR12690189.sra file validated SRR12690189 is paired end SRR12690189 is conventional basespace SRR12690189 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690189_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.588 37.0 37.0 37.0 37.0 37.0 2 36.461 37.0 37.0 37.0 37.0 37.0 3 36.624 37.0 37.0 37.0 37.0 37.0 4 36.5935 37.0 37.0 37.0 37.0 37.0 5 36.6395 37.0 37.0 37.0 37.0 37.0 6 36.588 37.0 37.0 37.0 37.0 37.0 7 36.559 37.0 37.0 37.0 37.0 37.0 8 36.6015 37.0 37.0 37.0 37.0 37.0 9 36.609 37.0 37.0 37.0 37.0 37.0 10-14 36.6279 37.0 37.0 37.0 37.0 37.0 15-19 36.6008 37.0 37.0 37.0 37.0 37.0 20-24 36.5693 37.0 37.0 37.0 37.0 37.0 25-29 36.5444 37.0 37.0 37.0 37.0 37.0 30-34 36.4668 37.0 37.0 37.0 37.0 37.0 35-39 36.4897 37.0 37.0 37.0 37.0 37.0 40-44 36.439 37.0 37.0 37.0 37.0 37.0 45-49 36.4137 37.0 37.0 37.0 37.0 37.0 50-54 36.4138 37.0 37.0 37.0 37.0 37.0 55-59 36.3874 37.0 37.0 37.0 37.0 37.0 60-64 36.3452 37.0 37.0 37.0 37.0 37.0 65-69 36.2924 37.0 37.0 37.0 37.0 37.0 70-74 36.272400000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.321200000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2779 37.0 37.0 37.0 37.0 37.0 85-89 36.270300000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.2659 37.0 37.0 37.0 37.0 37.0 95-99 36.207300000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.134499999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.128699999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.11880000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.0741 37.0 37.0 37.0 37.0 37.0 120-124 36.1271 37.0 37.0 37.0 37.0 37.0 125-129 36.0841 37.0 37.0 37.0 37.0 37.0 130-134 36.0029 37.0 37.0 37.0 37.0 37.0 135-139 36.001400000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.8207 37.0 37.0 37.0 37.0 37.0 145-149 35.816500000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.694 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 1.0 22 0.0 23 2.0 24 1.0 25 2.0 26 4.0 27 6.0 28 9.0 29 13.0 30 35.0 31 28.0 32 47.0 33 68.0 34 112.0 35 289.0 36 2975.0 37 406.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.725 12.9 6.275 35.099999999999994 2 20.536609829488466 12.88866599799398 36.83550651955868 29.739217652958878 3 17.125 16.375 28.425 38.074999999999996 4 21.875 24.7 24.2 29.225 5 24.0 30.375000000000004 23.875 21.75 6 22.0 33.525 23.225 21.25 7 16.225 27.800000000000004 37.8 18.175 8 17.4 27.224999999999998 31.175000000000004 24.2 9 17.8 24.349999999999998 35.025 22.825 10-14 20.11 29.125 27.63 23.135 15-19 19.885 28.12 28.265 23.73 20-24 20.25 27.61 28.29 23.849999999999998 25-29 20.145 27.389999999999997 28.345 24.12 30-34 19.485 28.115000000000002 27.825 24.575 35-39 20.505000000000003 27.889999999999997 27.689999999999998 23.915 40-44 20.565 28.105000000000004 27.689999999999998 23.64 45-49 20.119999999999997 28.155 28.060000000000002 23.665 50-54 21.01 27.615000000000002 27.544999999999998 23.830000000000002 55-59 20.485 28.044999999999998 27.48 23.990000000000002 60-64 20.665 28.17 27.200000000000003 23.965 65-69 20.330000000000002 27.889999999999997 27.73 24.05 70-74 20.955 27.560000000000002 27.644999999999996 23.84 75-79 21.22 27.744999999999997 27.67 23.365 80-84 20.755000000000003 28.384999999999998 27.650000000000002 23.21 85-89 21.26 27.87 27.310000000000002 23.56 90-94 21.25 27.85 27.834999999999997 23.064999999999998 95-99 21.065 28.815 27.21 22.91 100-104 20.955 28.28 28.16 22.605 105-109 21.115000000000002 27.950000000000003 27.439999999999998 23.494999999999997 110-114 21.25 28.01 27.675 23.064999999999998 115-119 21.755 28.199999999999996 27.145000000000003 22.900000000000002 120-124 21.52 28.084999999999997 27.185 23.21 125-129 21.485000000000003 28.215 27.38 22.919999999999998 130-134 21.48 27.994999999999997 27.139999999999997 23.385 135-139 21.21 27.084999999999997 27.834999999999997 23.87 140-144 21.945 26.86 27.04 24.154999999999998 145-149 21.3 28.199999999999996 26.8 23.7 150-151 21.85 28.449999999999996 26.8375 22.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 2.0 24 2.0 25 4.0 26 6.0 27 9.5 28 10.0 29 10.5 30 15.5 31 18.5 32 21.5 33 27.5 34 49.5 35 72.5 36 83.5 37 97.0 38 125.0 39 152.0 40 181.5 41 216.0 42 243.0 43 245.5 44 245.0 45 251.5 46 252.5 47 245.0 48 233.0 49 211.5 50 186.5 51 162.5 52 126.0 53 95.0 54 87.5 55 79.5 56 58.0 57 46.5 58 33.0 59 23.5 60 20.0 61 15.0 62 8.0 63 5.0 64 3.0 65 3.0 66 3.0 67 2.0 68 2.5 69 2.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.225 #Duplication Level Percentage of deduplicated Percentage of total 1 90.55139927957883 81.69999999999999 2 8.229426433915211 14.85 3 1.0806317539484622 2.9250000000000003 4 0.11083402604599613 0.4 5 0.02770850651149903 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGCATGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 4 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.3 0.0 0.0 0.0 0.0 118-119 2.525 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.525 0.0 0.0 0.0 0.0 126-127 3.9875 0.0 0.0 0.0 0.0 128-129 4.2375 0.0 0.0 0.0 0.0 130-131 4.5875 0.0 0.0 0.0 0.0 132-133 4.887499999999999 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690189 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690189_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.17 37.0 37.0 37.0 37.0 37.0 2 35.739 37.0 37.0 37.0 37.0 37.0 3 35.979 37.0 37.0 37.0 37.0 37.0 4 35.93 37.0 37.0 37.0 37.0 37.0 5 36.233 37.0 37.0 37.0 37.0 37.0 6 36.143 37.0 37.0 37.0 37.0 37.0 7 36.13 37.0 37.0 37.0 37.0 37.0 8 36.2005 37.0 37.0 37.0 37.0 37.0 9 36.137 37.0 37.0 37.0 37.0 37.0 10-14 36.12679999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.063 37.0 37.0 37.0 37.0 37.0 20-24 36.122800000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.99059999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.9556 37.0 37.0 37.0 37.0 37.0 35-39 35.9551 37.0 37.0 37.0 37.0 37.0 40-44 35.9011 37.0 37.0 37.0 37.0 37.0 45-49 35.922000000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.798700000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.8814 37.0 37.0 37.0 37.0 37.0 60-64 35.7819 37.0 37.0 37.0 37.0 37.0 65-69 35.775 37.0 37.0 37.0 37.0 37.0 70-74 35.6551 37.0 37.0 37.0 37.0 37.0 75-79 35.7171 37.0 37.0 37.0 37.0 37.0 80-84 35.7299 37.0 37.0 37.0 37.0 37.0 85-89 35.7056 37.0 37.0 37.0 37.0 37.0 90-94 35.6331 37.0 37.0 37.0 37.0 37.0 95-99 35.6354 37.0 37.0 37.0 37.0 37.0 100-104 35.661500000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.6481 37.0 37.0 37.0 37.0 37.0 110-114 35.587 37.0 37.0 37.0 37.0 37.0 115-119 35.5266 37.0 37.0 37.0 37.0 37.0 120-124 35.408 37.0 37.0 37.0 37.0 37.0 125-129 35.3341 37.0 37.0 37.0 32.2 37.0 130-134 35.3185 37.0 37.0 37.0 37.0 37.0 135-139 35.1809 37.0 37.0 37.0 27.4 37.0 140-144 35.1842 37.0 37.0 37.0 29.8 37.0 145-149 34.99589999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.46425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 1.0 20 3.0 21 6.0 22 5.0 23 2.0 24 10.0 25 14.0 26 12.0 27 15.0 28 20.0 29 23.0 30 33.0 31 44.0 32 85.0 33 122.0 34 240.0 35 639.0 36 2497.0 37 219.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.7 27.525 9.3 24.474999999999998 2 26.625 27.85 30.075000000000003 15.45 3 19.900000000000002 27.325 33.1 19.675 4 22.175 34.75 24.025 19.05 5 25.45 37.325 21.425 15.8 6 20.150000000000002 40.2 20.95 18.7 7 21.475 23.200000000000003 37.05 18.275 8 21.975 25.874999999999996 28.000000000000004 24.15 9 21.775 25.474999999999998 29.325000000000003 23.425 10-14 23.06 30.354999999999997 25.91 20.674999999999997 15-19 23.13 28.845 27.12 20.905 20-24 22.955000000000002 28.775000000000002 27.47 20.8 25-29 23.06 28.360000000000003 27.644999999999996 20.935000000000002 30-34 22.34 28.439999999999998 28.055000000000003 21.165 35-39 22.91 27.305 28.37 21.415 40-44 23.105 27.644999999999996 27.955000000000002 21.295 45-49 23.005 28.470000000000002 27.675 20.849999999999998 50-54 23.325000000000003 27.72 27.98 20.974999999999998 55-59 22.97 28.285 27.785 20.96 60-64 23.06 28.33 27.560000000000002 21.05 65-69 23.02 28.025 27.555000000000003 21.4 70-74 23.035 27.555000000000003 28.389999999999997 21.02 75-79 23.575 27.865000000000002 27.389999999999997 21.17 80-84 23.974999999999998 27.955000000000002 27.169999999999998 20.9 85-89 24.145 28.075 27.055 20.724999999999998 90-94 24.375 27.52 27.185 20.919999999999998 95-99 24.060000000000002 27.905 26.715 21.32 100-104 23.665 28.015 27.634999999999998 20.685000000000002 105-109 24.08 27.939999999999998 27.02 20.96 110-114 24.060000000000002 28.485 26.97 20.485 115-119 23.849999999999998 28.065 27.229999999999997 20.855 120-124 23.855 27.905 27.12 21.12 125-129 24.01 27.534999999999997 27.46 20.995 130-134 24.68 27.735 26.88 20.705000000000002 135-139 25.395 26.840000000000003 27.275 20.49 140-144 25.715 27.145000000000003 26.645000000000003 20.495 145-149 25.995 27.755000000000003 26.495 19.755 150-151 24.962500000000002 28.3625 26.424999999999997 20.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 2.0 15 1.5 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.5 23 2.5 24 3.5 25 4.5 26 6.5 27 5.5 28 7.0 29 13.5 30 18.0 31 23.5 32 30.5 33 40.5 34 49.0 35 69.0 36 87.0 37 118.5 38 153.5 39 178.5 40 201.0 41 218.5 42 257.0 43 254.5 44 246.0 45 262.0 46 255.5 47 228.5 48 201.0 49 191.5 50 172.5 51 139.0 52 110.0 53 91.0 54 80.5 55 63.5 56 48.0 57 38.0 58 29.0 59 20.0 60 14.0 61 12.5 62 8.0 63 4.5 64 2.5 65 2.5 66 2.5 67 1.5 68 0.5 69 1.0 70 1.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 1.0 92 1.0 93 0.0 94 0.0 95 0.5 96 0.5 97 1.0 98 2.0 99 2.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.3 #Duplication Level Percentage of deduplicated Percentage of total 1 90.66998892580288 81.875 2 8.277962347729789 14.95 3 0.9136212624584719 2.475 4 0.08305647840531562 0.3 5 0.0 0.0 6 0.0 0.0 7 0.02768549280177187 0.17500000000000002 8 0.0 0.0 9 0.02768549280177187 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.9125 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 4.0125 0.0 0.0 0.0 0.0 128-129 4.2625 0.0 0.0 0.0 0.0 130-131 4.6125 0.0 0.0 0.0 0.0 132-133 4.9125 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638670 spots for SRR12690189.sra Written 638670 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra Read 638663 spots for SRR12690189.sra Written 638663 spots for SRR12690189.sra SRR ids: ['SRR12690189.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p3ppui2m SRR12690189.sra spots: 12773267 blocks: [[1, 638663], [638664, 1277326], [1277327, 1915989], [1915990, 2554652], [2554653, 3193315], [3193316, 3831978], [3831979, 4470641], [4470642, 5109304], [5109305, 5747967], [5747968, 6386630], [6386631, 7025293], [7025294, 7663956], [7663957, 8302619], [8302620, 8941282], [8941283, 9579945], [9579946, 10218608], [10218609, 10857271], [10857272, 11495934], [11495935, 12134597], [12134598, 12773267]] SRR12690189 file size 4319214 SRR12690189 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690189 SRR12690189_1.fastq SRR12690189_2.fastq Input file: SRR12690189_1.fastq Paired file: SRR12690189_2.fastq trimmed: SRR12690189-trimmed-pair1.fastq, SRR12690189-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:53:39 2025 >> started Mon Feb 10 21:53:54 2025 >> done (15.603s) 12773267 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 25420 ( 0.20%) empty read pairs filtered out after trimming by size control 12747810 (99.80%) read pairs available; of these: 1249170 ( 9.80%) trimmed read pairs available after processing 11498640 (90.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 3 0.00% 21 3 0.00% 22 7 0.00% 23 5 0.00% 24 8 0.00% 25 6 0.00% 26 8 0.00% 27 14 0.00% 28 16 0.00% 29 12 0.00% 30 15 0.00% 31 16 0.00% 32 15 0.00% 33 22 0.00% 34 16 0.00% 35 23 0.00% 36 17 0.00% 37 18 0.00% 38 20 0.00% 39 15 0.00% 40 18 0.00% 41 29 0.00% 42 19 0.00% 43 23 0.00% 44 30 0.00% 45 24 0.00% 46 31 0.00% 47 31 0.00% 48 40 0.00% 49 40 0.00% 50 50 0.00% 51 57 0.00% 52 59 0.00% 53 59 0.00% 54 60 0.00% 55 71 0.00% 56 94 0.00% 57 74 0.00% 58 126 0.00% 59 110 0.00% 60 135 0.00% 61 144 0.00% 62 159 0.00% 63 190 0.00% 64 239 0.00% 65 229 0.00% 66 271 0.00% 67 311 0.00% 68 341 0.00% 69 362 0.00% 70 466 0.00% 71 564 0.00% 72 568 0.00% 73 691 0.01% 74 712 0.01% 75 809 0.01% 76 905 0.01% 77 1025 0.01% 78 1132 0.01% 79 1288 0.01% 80 1374 0.01% 81 1563 0.01% 82 1692 0.01% 83 1865 0.01% 84 2230 0.02% 85 2393 0.02% 86 2619 0.02% 87 2728 0.02% 88 3166 0.02% 89 3285 0.03% 90 3543 0.03% 91 4011 0.03% 92 4304 0.03% 93 4736 0.04% 94 4980 0.04% 95 5425 0.04% 96 5788 0.05% 97 6173 0.05% 98 6690 0.05% 99 6969 0.05% 100 7482 0.06% 101 7884 0.06% 102 8341 0.07% 103 9071 0.07% 104 9181 0.07% 105 9929 0.08% 106 10340 0.08% 107 10855 0.09% 108 11398 0.09% 109 11855 0.09% 110 12362 0.10% 111 12743 0.10% 112 13475 0.11% 113 14224 0.11% 114 14544 0.11% 115 15331 0.12% 116 16010 0.13% 117 16864 0.13% 118 17489 0.14% 119 17761 0.14% 120 18719 0.15% 121 19451 0.15% 122 19858 0.16% 123 20667 0.16% 124 21536 0.17% 125 21836 0.17% 126 23281 0.18% 127 23557 0.18% 128 24516 0.19% 129 24824 0.19% 130 25771 0.20% 131 26265 0.21% 132 27013 0.21% 133 28137 0.22% 134 28633 0.22% 135 29567 0.23% 136 30088 0.24% 137 30841 0.24% 138 31251 0.25% 139 32593 0.26% 140 33215 0.26% 141 33651 0.26% 142 34675 0.27% 143 35134 0.28% 144 36271 0.28% 145 37326 0.29% 146 37721 0.30% 147 38350 0.30% 148 39376 0.31% 149 39722 0.31% 150 40803 0.32% 151 11498640 90.20% 12747810 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=27 prefix-density=0.51 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=34 fanout-score=12.05 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=3.5 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAG criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=30 prefix-density=0.68 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=228.03 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=20.8 sequence=AGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTCGCCGGGTGCCAGTGACAAGCCTACGGGCACTTCCCAACGTGGGGGAGTCTCTTCTTGGCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCA SRR12690189 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:54:40 Started mapping on | Feb 10 21:54:40 Finished on | Feb 10 21:56:07 Mapping speed, Million of reads per hour | 527.50 Number of input reads | 12747810 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12053915 Uniquely mapped reads % | 94.56% Average mapped length | 296.41 Number of splices: Total | 12179235 Number of splices: Annotated (sjdb) | 11908621 Number of splices: GT/AG | 11936257 Number of splices: GC/AG | 197082 Number of splices: AT/AC | 7086 Number of splices: Non-canonical | 38810 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287710 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 83175 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 406185 406185 406185 N_multimapping 287710 287710 287710 N_noFeature 489733 11898924 536463 N_ambiguous 190416 720 81871 UnstrandedReadsAssigned:11373766 PositiveStrandReadsAssigned:154271 NegativeStrandReadsAssigned:11435581 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690189 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690189-trimmed-pair1.fastq SRR12690189-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,747,810 reads, 11,455,529 reads pseudoaligned [quant] estimated average fragment length: 253.001 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR12690189.ke.tsv 34699 SRR12690189.se.tsv 87100 total ==> SRR12690189.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766 415 18.4669 Potri.005G024800.1.v4.1 1035 782.999 109 10.9396 Potri.004G059700.1.v4.1 961 709.11 7 0.775748 Potri.007G009000.2.v4.1 1416 1164 0 0 Potri.003G141000.2.v4.1 2943 2691 645.553 18.8519 Potri.016G087400.1.v4.1 270 81.7544 364 349.886 Potri.015G069301.1.v4.1 564 323.258 0 0 Potri.010G195200.1.v4.1 1773 1521 9 0.464997 Potri.012G127500.1.v4.1 977 725.05 48 5.20247 ==> SRR12690189.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 148 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12690189 completed mapping pipeline successfully