Starting /dee2/code/volunteer_pipeline.sh SRR12690190 current disk space = 3057570164736 free memory = 1575174872 SRR12690190 SRAfilesize dcb07a208e1cfad12a22143e3e4b5975 SRR12690190.sra SRR12690190.sra file validated SRR12690190 is paired end SRR12690190 is conventional basespace SRR12690190 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690190_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.654 37.0 37.0 37.0 37.0 37.0 2 36.45125 37.0 37.0 37.0 37.0 37.0 3 36.5255 37.0 37.0 37.0 37.0 37.0 4 36.5715 37.0 37.0 37.0 37.0 37.0 5 36.5565 37.0 37.0 37.0 37.0 37.0 6 36.649 37.0 37.0 37.0 37.0 37.0 7 36.478 37.0 37.0 37.0 37.0 37.0 8 36.62 37.0 37.0 37.0 37.0 37.0 9 36.535 37.0 37.0 37.0 37.0 37.0 10-14 36.609 37.0 37.0 37.0 37.0 37.0 15-19 36.5592 37.0 37.0 37.0 37.0 37.0 20-24 36.5609 37.0 37.0 37.0 37.0 37.0 25-29 36.5388 37.0 37.0 37.0 37.0 37.0 30-34 36.461 37.0 37.0 37.0 37.0 37.0 35-39 36.5016 37.0 37.0 37.0 37.0 37.0 40-44 36.4882 37.0 37.0 37.0 37.0 37.0 45-49 36.4257 37.0 37.0 37.0 37.0 37.0 50-54 36.4197 37.0 37.0 37.0 37.0 37.0 55-59 36.326299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4009 37.0 37.0 37.0 37.0 37.0 65-69 36.3579 37.0 37.0 37.0 37.0 37.0 70-74 36.3625 37.0 37.0 37.0 37.0 37.0 75-79 36.3098 37.0 37.0 37.0 37.0 37.0 80-84 36.2522 37.0 37.0 37.0 37.0 37.0 85-89 36.269099999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2611 37.0 37.0 37.0 37.0 37.0 95-99 36.2239 37.0 37.0 37.0 37.0 37.0 100-104 36.1646 37.0 37.0 37.0 37.0 37.0 105-109 36.1649 37.0 37.0 37.0 37.0 37.0 110-114 36.1662 37.0 37.0 37.0 37.0 37.0 115-119 36.133399999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.0142 37.0 37.0 37.0 37.0 37.0 125-129 36.0146 37.0 37.0 37.0 37.0 37.0 130-134 35.9837 37.0 37.0 37.0 37.0 37.0 135-139 35.9123 37.0 37.0 37.0 37.0 37.0 140-144 35.7608 37.0 37.0 37.0 37.0 37.0 145-149 35.7291 37.0 37.0 37.0 37.0 37.0 150-151 35.510999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 2.0 24 1.0 25 4.0 26 7.0 27 5.0 28 7.0 29 15.0 30 19.0 31 33.0 32 53.0 33 77.0 34 94.0 35 312.0 36 3031.0 37 337.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.925000000000004 11.675 6.775 38.625 2 20.33558727773604 12.922614575507138 36.01302278988229 30.728775356874532 3 16.925 15.475 28.475 39.125 4 22.6 23.25 25.15 28.999999999999996 5 22.900000000000002 28.775000000000002 26.35 21.975 6 20.724999999999998 32.45 24.825 22.0 7 16.900000000000002 26.474999999999998 39.65 16.975 8 18.55 26.724999999999998 32.625 22.1 9 17.025000000000002 24.349999999999998 36.125 22.5 10-14 19.66 29.38 27.339999999999996 23.62 15-19 20.724999999999998 28.055000000000003 27.12 24.099999999999998 20-24 19.475 28.265 28.13 24.13 25-29 20.395 28.26 27.38 23.965 30-34 20.43 27.415 28.194999999999997 23.96 35-39 20.53 27.395000000000003 28.389999999999997 23.685000000000002 40-44 20.895 28.03 26.950000000000003 24.125 45-49 20.5 28.449999999999996 27.325 23.724999999999998 50-54 21.035 27.950000000000003 27.13 23.885 55-59 20.705000000000002 27.805000000000003 27.465 24.025 60-64 20.595 27.97 27.435 24.0 65-69 20.3 28.53 28.050000000000004 23.119999999999997 70-74 20.810000000000002 27.889999999999997 27.694999999999997 23.605 75-79 20.669999999999998 27.675 27.715 23.94 80-84 20.82 27.63 27.46 24.09 85-89 20.835 28.634999999999998 26.995 23.535 90-94 21.345 28.13 26.979999999999997 23.544999999999998 95-99 21.8 28.044999999999998 27.245 22.91 100-104 21.6 28.37 26.540000000000003 23.49 105-109 20.995 27.525 27.500000000000004 23.98 110-114 21.224999999999998 28.035 27.095000000000002 23.645 115-119 21.25 28.134999999999998 27.389999999999997 23.225 120-124 20.925 27.98 27.175 23.919999999999998 125-129 20.91 28.225 27.169999999999998 23.695 130-134 21.07 28.244999999999997 27.01 23.674999999999997 135-139 21.305 28.125 27.150000000000002 23.419999999999998 140-144 21.83 28.175 26.355 23.64 145-149 21.275 28.15 26.41 24.165 150-151 21.875 28.075 26.0 24.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 2.5 26 4.5 27 7.5 28 9.0 29 8.0 30 13.5 31 24.0 32 27.0 33 29.0 34 41.5 35 60.0 36 79.5 37 100.5 38 109.0 39 126.5 40 168.0 41 205.5 42 224.0 43 247.0 44 258.5 45 247.0 46 252.0 47 279.5 48 273.0 49 224.0 50 198.0 51 178.5 52 145.5 53 98.5 54 77.5 55 70.5 56 54.0 57 46.5 58 30.5 59 23.0 60 19.5 61 13.5 62 6.0 63 2.0 64 2.5 65 1.0 66 1.5 67 1.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.6030534351145 84.0 2 7.8244274809160315 14.35 3 0.49073064340239914 1.35 4 0.08178844056706652 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.1500000000000004 0.0 0.0 0.0 0.0 114-115 2.4000000000000004 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 2.9625000000000004 0.0 0.0 0.0 0.0 120-121 3.4125 0.0 0.0 0.0 0.0 122-123 3.6500000000000004 0.0 0.0 0.0 0.0 124-125 3.925 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.975 0.0 0.0 0.0 0.0 132-133 5.6625 0.0 0.0 0.0 0.0 134-135 6.1125 0.0 0.0 0.0 0.0 136-137 6.85 0.0 0.0 0.0 0.0 138-139 7.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCGGCA 10 0.006830828 145.0 1 CAGCAGC 10 0.006830828 145.0 6 ACCATGG 10 0.006830828 145.0 145 CGGCAGT 10 0.006830828 145.0 3 CCGGCAG 10 0.006830828 145.0 2 >>END_MODULE SRR12690190 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690190_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.216 37.0 37.0 37.0 37.0 37.0 2 36.007 37.0 37.0 37.0 37.0 37.0 3 36.176 37.0 37.0 37.0 37.0 37.0 4 36.1905 37.0 37.0 37.0 37.0 37.0 5 36.339 37.0 37.0 37.0 37.0 37.0 6 36.2195 37.0 37.0 37.0 37.0 37.0 7 36.2605 37.0 37.0 37.0 37.0 37.0 8 36.268 37.0 37.0 37.0 37.0 37.0 9 36.3045 37.0 37.0 37.0 37.0 37.0 10-14 36.25939999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.2735 37.0 37.0 37.0 37.0 37.0 20-24 36.2606 37.0 37.0 37.0 37.0 37.0 25-29 36.2295 37.0 37.0 37.0 37.0 37.0 30-34 36.212399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.1392 37.0 37.0 37.0 37.0 37.0 40-44 36.113299999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.107600000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.0295 37.0 37.0 37.0 37.0 37.0 55-59 36.0968 37.0 37.0 37.0 37.0 37.0 60-64 36.0098 37.0 37.0 37.0 37.0 37.0 65-69 36.0045 37.0 37.0 37.0 37.0 37.0 70-74 35.899300000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.9206 37.0 37.0 37.0 37.0 37.0 80-84 35.940599999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.928700000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.830200000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.8414 37.0 37.0 37.0 37.0 37.0 100-104 35.881600000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.835899999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.7625 37.0 37.0 37.0 37.0 37.0 115-119 35.6851 37.0 37.0 37.0 37.0 37.0 120-124 35.6225 37.0 37.0 37.0 37.0 37.0 125-129 35.5967 37.0 37.0 37.0 37.0 37.0 130-134 35.44070000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.44070000000001 37.0 37.0 37.0 34.6 37.0 140-144 35.4292 37.0 37.0 37.0 37.0 37.0 145-149 35.286199999999994 37.0 37.0 37.0 34.6 37.0 150-151 34.740750000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 2.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 3.0 22 2.0 23 3.0 24 6.0 25 4.0 26 6.0 27 9.0 28 15.0 29 29.0 30 29.0 31 36.0 32 52.0 33 112.0 34 185.0 35 591.0 36 2670.0 37 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.925 26.25 10.025 25.8 2 27.500000000000004 27.900000000000002 28.4 16.2 3 19.875 28.375 32.425 19.325 4 23.9 33.025 23.575 19.5 5 24.675 37.75 20.724999999999998 16.85 6 21.075 40.025 21.425 17.474999999999998 7 21.349999999999998 21.85 38.224999999999994 18.575 8 21.125 26.900000000000002 27.275 24.7 9 20.825 25.424999999999997 30.225 23.525 10-14 23.355 29.755 26.1 20.79 15-19 22.689999999999998 28.99 26.595000000000002 21.725 20-24 23.14 28.299999999999997 26.935 21.625 25-29 23.325000000000003 28.189999999999998 27.37 21.115000000000002 30-34 22.855 28.470000000000002 27.694999999999997 20.979999999999997 35-39 22.67 28.025 27.415 21.89 40-44 23.02 28.225 27.495000000000005 21.26 45-49 22.845 28.415000000000003 27.99 20.75 50-54 22.485 28.494999999999997 27.51 21.51 55-59 22.795 28.28 26.91 22.015 60-64 23.080000000000002 28.299999999999997 26.68 21.94 65-69 23.275000000000002 28.175 26.905 21.645 70-74 23.355 27.325 27.57 21.75 75-79 23.015 27.384999999999998 27.685 21.915000000000003 80-84 22.63 28.389999999999997 27.095000000000002 21.884999999999998 85-89 23.32 27.534999999999997 27.565 21.58 90-94 23.235 28.175 26.71 21.88 95-99 23.990000000000002 27.860000000000003 27.169999999999998 20.979999999999997 100-104 23.885 27.700000000000003 27.089999999999996 21.325 105-109 23.94 27.355 27.334999999999997 21.37 110-114 22.82 28.349999999999998 27.505000000000003 21.325 115-119 23.685000000000002 27.250000000000004 27.33 21.735 120-124 24.104999999999997 27.534999999999997 27.51 20.849999999999998 125-129 23.685000000000002 27.205000000000002 27.825 21.285 130-134 24.14 27.515 27.305 21.04 135-139 24.560000000000002 27.805000000000003 26.900000000000002 20.735 140-144 24.404999999999998 27.889999999999997 26.6 21.105 145-149 25.345000000000002 27.450000000000003 25.825 21.38 150-151 25.7625 28.199999999999996 25.75 20.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 2.0 25 1.5 26 2.5 27 3.5 28 6.0 29 7.0 30 8.5 31 11.5 32 21.5 33 29.0 34 38.0 35 57.5 36 74.5 37 106.0 38 136.5 39 153.5 40 191.0 41 234.0 42 242.5 43 256.0 44 280.0 45 281.5 46 259.0 47 244.0 48 236.0 49 200.5 50 194.5 51 173.0 52 120.5 53 97.5 54 75.5 55 64.0 56 50.5 57 33.0 58 29.5 59 22.0 60 12.5 61 12.0 62 10.0 63 3.5 64 1.0 65 0.0 66 0.0 67 0.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 91.76920973475526 83.89999999999999 2 7.383100902378999 13.5 3 0.628930817610063 1.725 4 0.16406890894175555 0.6 5 0.027344818156959255 0.125 6 0.027344818156959255 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 6 0.15 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8374999999999999 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.2999999999999998 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.9249999999999998 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.7125 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 3.9625 0.0 0.0 0.0 0.0 126-127 4.199999999999999 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.6875 0.0 0.0 0.0 0.0 134-135 6.125 0.0 0.0 0.0 0.0 136-137 6.85 0.0 0.0 0.0 0.0 138-139 7.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra Read 639596 spots for SRR12690190.sra Written 639596 spots for SRR12690190.sra Read 639581 spots for SRR12690190.sra Written 639581 spots for SRR12690190.sra SRR ids: ['SRR12690190.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__x0lv9vd SRR12690190.sra spots: 12791635 blocks: [[1, 639581], [639582, 1279162], [1279163, 1918743], [1918744, 2558324], [2558325, 3197905], [3197906, 3837486], [3837487, 4477067], [4477068, 5116648], [5116649, 5756229], [5756230, 6395810], [6395811, 7035391], [7035392, 7674972], [7674973, 8314553], [8314554, 8954134], [8954135, 9593715], [9593716, 10233296], [10233297, 10872877], [10872878, 11512458], [11512459, 12152039], [12152040, 12791635]] SRR12690190 file size 4325456 SRR12690190 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690190 SRR12690190_1.fastq SRR12690190_2.fastq Input file: SRR12690190_1.fastq Paired file: SRR12690190_2.fastq trimmed: SRR12690190-trimmed-pair1.fastq, SRR12690190-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:03:55 2025 >> started Mon Feb 10 23:04:15 2025 >> done (19.527s) 12791635 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 2588 ( 0.02%) empty read pairs filtered out after trimming by size control 12789016 (99.98%) read pairs available; of these: 1533401 (11.99%) trimmed read pairs available after processing 11255615 (88.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 5 0.00% 22 4 0.00% 23 7 0.00% 24 12 0.00% 25 18 0.00% 26 12 0.00% 27 9 0.00% 28 13 0.00% 29 11 0.00% 30 16 0.00% 31 24 0.00% 32 25 0.00% 33 12 0.00% 34 24 0.00% 35 20 0.00% 36 17 0.00% 37 34 0.00% 38 25 0.00% 39 22 0.00% 40 27 0.00% 41 38 0.00% 42 26 0.00% 43 38 0.00% 44 37 0.00% 45 38 0.00% 46 33 0.00% 47 57 0.00% 48 48 0.00% 49 64 0.00% 50 52 0.00% 51 77 0.00% 52 64 0.00% 53 79 0.00% 54 90 0.00% 55 110 0.00% 56 96 0.00% 57 102 0.00% 58 120 0.00% 59 156 0.00% 60 203 0.00% 61 244 0.00% 62 229 0.00% 63 289 0.00% 64 298 0.00% 65 301 0.00% 66 320 0.00% 67 421 0.00% 68 419 0.00% 69 464 0.00% 70 639 0.00% 71 675 0.01% 72 731 0.01% 73 835 0.01% 74 967 0.01% 75 1108 0.01% 76 1166 0.01% 77 1280 0.01% 78 1441 0.01% 79 1646 0.01% 80 1876 0.01% 81 2052 0.02% 82 2315 0.02% 83 2550 0.02% 84 2911 0.02% 85 3210 0.03% 86 3389 0.03% 87 3852 0.03% 88 4027 0.03% 89 4413 0.03% 90 4739 0.04% 91 5277 0.04% 92 5660 0.04% 93 6476 0.05% 94 6904 0.05% 95 7361 0.06% 96 7830 0.06% 97 8433 0.07% 98 8847 0.07% 99 9245 0.07% 100 10086 0.08% 101 10516 0.08% 102 11144 0.09% 103 11876 0.09% 104 12477 0.10% 105 13280 0.10% 106 13644 0.11% 107 14353 0.11% 108 15123 0.12% 109 15764 0.12% 110 16318 0.13% 111 16789 0.13% 112 17647 0.14% 113 18192 0.14% 114 18964 0.15% 115 20043 0.16% 116 20645 0.16% 117 21260 0.17% 118 22335 0.17% 119 22986 0.18% 120 23338 0.18% 121 24716 0.19% 122 25105 0.20% 123 26196 0.20% 124 27023 0.21% 125 27651 0.22% 126 28772 0.22% 127 29422 0.23% 128 30248 0.24% 129 30531 0.24% 130 31817 0.25% 131 32006 0.25% 132 32910 0.26% 133 33653 0.26% 134 34396 0.27% 135 35621 0.28% 136 36450 0.29% 137 36710 0.29% 138 37285 0.29% 139 39009 0.31% 140 38772 0.30% 141 39233 0.31% 142 40908 0.32% 143 41083 0.32% 144 42532 0.33% 145 43261 0.34% 146 43534 0.34% 147 44170 0.35% 148 45177 0.35% 149 45321 0.35% 150 46392 0.36% 151 11255615 88.01% 12789016 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=10 prefix-density=0.87 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.18 sequence-density-rank=21 fanout-score=6.10 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=3.9 sequence=TGAGCTTCACCG criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=10 prefix-density=1.43 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=49.77 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR12690190 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:04:55 Started mapping on | Feb 10 23:04:55 Finished on | Feb 10 23:06:17 Mapping speed, Million of reads per hour | 561.47 Number of input reads | 12789016 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12094232 Uniquely mapped reads % | 94.57% Average mapped length | 295.32 Number of splices: Total | 12139517 Number of splices: Annotated (sjdb) | 11889983 Number of splices: GT/AG | 11897863 Number of splices: GC/AG | 203070 Number of splices: AT/AC | 8495 Number of splices: Non-canonical | 30089 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.10 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326109 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 51511 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.34% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 368675 368675 368675 N_multimapping 326109 326109 326109 N_noFeature 360215 11970488 394305 N_ambiguous 163608 547 73722 UnstrandedReadsAssigned:11570409 PositiveStrandReadsAssigned:123197 NegativeStrandReadsAssigned:11626205 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690190 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690190-trimmed-pair1.fastq SRR12690190-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,789,016 reads, 11,676,526 reads pseudoaligned [quant] estimated average fragment length: 243.623 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR12690190.ke.tsv 34699 SRR12690190.se.tsv 87100 total ==> SRR12690190.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.38 256 11.1923 Potri.005G024800.1.v4.1 1035 792.377 82 8.03256 Potri.004G059700.1.v4.1 961 718.415 24 2.59303 Potri.007G009000.2.v4.1 1416 1173.38 0 0 Potri.003G141000.2.v4.1 2943 2700.38 327.25 9.40646 Potri.016G087400.1.v4.1 270 85.232 551.836 502.55 Potri.015G069301.1.v4.1 564 330.075 0 0 Potri.010G195200.1.v4.1 1773 1530.38 6 0.304316 Potri.012G127500.1.v4.1 977 734.39 746 78.8467 ==> SRR12690190.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 55 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 134 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12690190 completed mapping pipeline successfully