Starting /dee2/code/volunteer_pipeline.sh SRR12690191 current disk space = 3057324544000 free memory = 1461125292 SRR12690191 SRAfilesize ab85e38d307128b6b79cb43ee4bc2a71 SRR12690191.sra SRR12690191.sra file validated SRR12690191 is paired end SRR12690191 is conventional basespace SRR12690191 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690191_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.617 37.0 37.0 37.0 37.0 37.0 2 36.37525 37.0 37.0 37.0 37.0 37.0 3 36.579 37.0 37.0 37.0 37.0 37.0 4 36.6285 37.0 37.0 37.0 37.0 37.0 5 36.618 37.0 37.0 37.0 37.0 37.0 6 36.6835 37.0 37.0 37.0 37.0 37.0 7 36.556 37.0 37.0 37.0 37.0 37.0 8 36.659 37.0 37.0 37.0 37.0 37.0 9 36.5565 37.0 37.0 37.0 37.0 37.0 10-14 36.620400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6159 37.0 37.0 37.0 37.0 37.0 20-24 36.6026 37.0 37.0 37.0 37.0 37.0 25-29 36.5574 37.0 37.0 37.0 37.0 37.0 30-34 36.5116 37.0 37.0 37.0 37.0 37.0 35-39 36.548 37.0 37.0 37.0 37.0 37.0 40-44 36.5244 37.0 37.0 37.0 37.0 37.0 45-49 36.4925 37.0 37.0 37.0 37.0 37.0 50-54 36.446299999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.4351 37.0 37.0 37.0 37.0 37.0 60-64 36.4039 37.0 37.0 37.0 37.0 37.0 65-69 36.3639 37.0 37.0 37.0 37.0 37.0 70-74 36.3793 37.0 37.0 37.0 37.0 37.0 75-79 36.3366 37.0 37.0 37.0 37.0 37.0 80-84 36.2547 37.0 37.0 37.0 37.0 37.0 85-89 36.3076 37.0 37.0 37.0 37.0 37.0 90-94 36.293899999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.232299999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1988 37.0 37.0 37.0 37.0 37.0 105-109 36.195100000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.188900000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1239 37.0 37.0 37.0 37.0 37.0 120-124 36.0776 37.0 37.0 37.0 37.0 37.0 125-129 36.02479999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.995400000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.9896 37.0 37.0 37.0 37.0 37.0 140-144 35.8024 37.0 37.0 37.0 37.0 37.0 145-149 35.8347 37.0 37.0 37.0 37.0 37.0 150-151 35.62025 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 2.0 25 0.0 26 1.0 27 7.0 28 5.0 29 12.0 30 21.0 31 34.0 32 49.0 33 73.0 34 130.0 35 301.0 36 3003.0 37 361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.95 12.15 8.55 41.349999999999994 2 20.37641154328733 13.249686323713927 36.26097867001255 30.112923462986195 3 17.65 14.475 27.55 40.325 4 22.05 23.0 25.424999999999997 29.525000000000002 5 22.925 28.875 25.825 22.375 6 21.275 33.6 24.15 20.974999999999998 7 15.7 25.874999999999996 41.25 17.175 8 17.224999999999998 26.825 33.050000000000004 22.900000000000002 9 17.549999999999997 22.925 36.25 23.275000000000002 10-14 19.12 29.865000000000002 27.975 23.04 15-19 20.275000000000002 28.04 27.915 23.77 20-24 19.950000000000003 27.625 28.310000000000002 24.115000000000002 25-29 19.685 28.804999999999996 27.765 23.745 30-34 20.005 27.900000000000002 28.21 23.885 35-39 19.395 28.105000000000004 28.005000000000003 24.495 40-44 20.125 28.375 27.77 23.73 45-49 20.560000000000002 28.34 28.000000000000004 23.1 50-54 20.035 28.285 27.88 23.799999999999997 55-59 20.485 28.26 27.975 23.28 60-64 19.915 28.475 27.334999999999997 24.275 65-69 20.57 28.59 27.265 23.575 70-74 20.630000000000003 27.884999999999998 27.834999999999997 23.65 75-79 20.61 28.215 27.915 23.26 80-84 20.265 28.43 28.12 23.185 85-89 21.07 27.76 27.615000000000002 23.555 90-94 20.544999999999998 27.92 27.875 23.66 95-99 20.19 27.975 27.675 24.16 100-104 20.895 28.055000000000003 27.615000000000002 23.435 105-109 21.02 27.689999999999998 27.82 23.47 110-114 20.305 27.084999999999997 29.07 23.54 115-119 21.255 28.305000000000003 27.21 23.23 120-124 20.62 27.889999999999997 28.125 23.365 125-129 20.705000000000002 27.92 27.865000000000002 23.51 130-134 21.02 28.360000000000003 27.22 23.400000000000002 135-139 21.349999999999998 28.42 26.779999999999998 23.45 140-144 21.185000000000002 28.215 27.295 23.305 145-149 21.355 28.125 27.255000000000003 23.265 150-151 21.3 28.175 27.375 23.150000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 2.0 24 4.5 25 5.5 26 5.0 27 8.5 28 9.0 29 7.5 30 11.0 31 20.0 32 26.0 33 36.0 34 51.5 35 65.5 36 78.0 37 100.5 38 140.0 39 164.5 40 182.5 41 210.5 42 235.5 43 258.5 44 251.5 45 249.0 46 286.5 47 274.5 48 235.5 49 218.5 50 189.0 51 153.5 52 110.5 53 90.5 54 88.0 55 69.0 56 47.5 57 30.0 58 20.5 59 19.5 60 15.0 61 7.5 62 3.0 63 2.0 64 4.0 65 4.0 66 2.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.15627574842077 82.975 2 7.964844822850865 14.499999999999998 3 0.7964844822850866 2.175 4 0.027464982147761604 0.1 5 0.05492996429552321 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCATAAATAAATCGAACACCAACACCAGCATCATCTCCTTCCTGTCCTT 5 0.125 No Hit CTTCATTAAAACCACACCAGAGGCCACAGACATGGCCAATACATAACAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.45 0.0 0.0 0.0 0.0 116-117 1.7625000000000002 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 2.9375 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.324999999999999 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 5.1125 0.0 0.0 0.0 0.0 136-137 5.612500000000001 0.0 0.0 0.0 0.0 138-139 6.050000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAAGG 10 0.006830828 145.0 8 GATAAAA 10 0.006830828 145.0 6 ATAAAAG 10 0.006830828 145.0 7 TCCACCT 10 0.006830828 145.0 2 CCACCTT 25 8.7132835E-4 87.0 3 >>END_MODULE SRR12690191 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690191_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8815 37.0 37.0 37.0 37.0 37.0 2 35.7215 37.0 37.0 37.0 37.0 37.0 3 35.654 37.0 37.0 37.0 37.0 37.0 4 35.879 37.0 37.0 37.0 37.0 37.0 5 36.039 37.0 37.0 37.0 37.0 37.0 6 35.857 37.0 37.0 37.0 37.0 37.0 7 35.9225 37.0 37.0 37.0 37.0 37.0 8 36.091 37.0 37.0 37.0 37.0 37.0 9 36.042 37.0 37.0 37.0 37.0 37.0 10-14 36.004200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.0266 37.0 37.0 37.0 37.0 37.0 20-24 36.0162 37.0 37.0 37.0 37.0 37.0 25-29 35.9576 37.0 37.0 37.0 37.0 37.0 30-34 35.9032 37.0 37.0 37.0 37.0 37.0 35-39 35.8921 37.0 37.0 37.0 37.0 37.0 40-44 35.879900000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.940999999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.795100000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.8381 37.0 37.0 37.0 37.0 37.0 60-64 35.7661 37.0 37.0 37.0 37.0 37.0 65-69 35.648199999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.6295 37.0 37.0 37.0 37.0 37.0 75-79 35.637299999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.6577 37.0 37.0 37.0 37.0 37.0 85-89 35.5989 37.0 37.0 37.0 37.0 37.0 90-94 35.459500000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.6076 37.0 37.0 37.0 37.0 37.0 100-104 35.561699999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.5229 37.0 37.0 37.0 37.0 37.0 110-114 35.4995 37.0 37.0 37.0 37.0 37.0 115-119 35.4 37.0 37.0 37.0 34.6 37.0 120-124 35.30159999999999 37.0 37.0 37.0 32.2 37.0 125-129 35.305600000000005 37.0 37.0 37.0 34.6 37.0 130-134 35.2678 37.0 37.0 37.0 29.8 37.0 135-139 35.1231 37.0 37.0 37.0 27.4 37.0 140-144 35.116299999999995 37.0 37.0 37.0 25.0 37.0 145-149 34.9045 37.0 37.0 37.0 25.0 37.0 150-151 34.377750000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 3.0 21 1.0 22 4.0 23 5.0 24 8.0 25 9.0 26 4.0 27 17.0 28 30.0 29 26.0 30 42.0 31 60.0 32 78.0 33 141.0 34 297.0 35 772.0 36 2350.0 37 147.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.225 23.95 11.325000000000001 30.5 2 26.924999999999997 28.499999999999996 28.775000000000002 15.8 3 19.0 31.6 29.549999999999997 19.85 4 22.725 33.925 24.75 18.6 5 24.375 35.699999999999996 22.1 17.825 6 19.775000000000002 39.175 24.425 16.625 7 19.85 22.35 37.7 20.1 8 21.525 25.224999999999998 27.750000000000004 25.5 9 22.3 24.474999999999998 29.875 23.35 10-14 22.64 29.815 26.515 21.029999999999998 15-19 22.185 28.754999999999995 27.52 21.54 20-24 22.43 28.21 27.875 21.485000000000003 25-29 22.515 28.384999999999998 28.21 20.89 30-34 22.395 28.73 27.82 21.055 35-39 22.425 28.199999999999996 28.29 21.085 40-44 22.475 28.084999999999997 28.555000000000003 20.885 45-49 22.295 28.345 28.005000000000003 21.355 50-54 21.915000000000003 28.225 28.265 21.595 55-59 22.689999999999998 28.084999999999997 27.625 21.6 60-64 23.330000000000002 27.63 27.505000000000003 21.535 65-69 22.575 28.405 27.655 21.365000000000002 70-74 23.1 27.925 27.375 21.6 75-79 22.37 27.905 27.79 21.935 80-84 22.805 28.435 27.200000000000003 21.560000000000002 85-89 23.355 27.765 27.794999999999998 21.085 90-94 22.935 28.075 27.67 21.32 95-99 22.939999999999998 27.765 27.675 21.62 100-104 23.74 27.860000000000003 27.339999999999996 21.060000000000002 105-109 23.875 27.655 27.565 20.905 110-114 23.57 28.115000000000002 27.16 21.154999999999998 115-119 24.185000000000002 29.03 26.465 20.32 120-124 24.085 28.33 27.055 20.53 125-129 24.355 28.49 26.61 20.544999999999998 130-134 24.92 27.744999999999997 27.705000000000002 19.63 135-139 24.665 28.044999999999998 27.11 20.18 140-144 24.98 28.51 26.655 19.855 145-149 25.775 28.115000000000002 26.150000000000002 19.96 150-151 25.5 27.2625 27.212500000000002 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 2.5 22 3.5 23 2.5 24 2.0 25 4.0 26 6.0 27 6.5 28 8.5 29 10.0 30 11.0 31 16.5 32 29.5 33 43.0 34 56.0 35 75.0 36 81.5 37 102.0 38 124.0 39 148.5 40 208.0 41 244.0 42 256.5 43 267.5 44 289.5 45 297.0 46 272.0 47 238.5 48 230.0 49 209.5 50 158.0 51 126.5 52 107.0 53 92.5 54 70.0 55 49.0 56 34.5 57 24.5 58 24.0 59 19.0 60 12.0 61 9.0 62 7.5 63 6.0 64 3.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.10005527915975 82.39999999999999 2 7.65616362631288 13.850000000000001 3 1.0226644555002764 2.775 4 0.08291873963515754 0.3 5 0.08291873963515754 0.375 6 0.055279159756771695 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 5 0.125 No Hit CGAAAGCCATCCTCTGAAACAACATCAATATGGCTCCTAAACTTTCCTGT 5 0.125 No Hit CGAAAGCCATTCTCTGAAAGAACATCAATATGGCTCCTAAACTTTCCTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.7625000000000002 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.3625 0.0 0.0 0.0 0.0 122-123 2.6624999999999996 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.225 0.0 0.0 0.0 0.0 132-133 4.5125 0.0 0.0 0.0 0.0 134-135 4.9875 0.0 0.0 0.0 0.0 136-137 5.487500000000001 0.0 0.0 0.0 0.0 138-139 5.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATCCC 10 0.006830828 145.0 3 >>END_MODULE Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 779009 spots for SRR12690191.sra Written 779009 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra Read 778992 spots for SRR12690191.sra Written 778992 spots for SRR12690191.sra SRR ids: ['SRR12690191.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ow6bnzt8 SRR12690191.sra spots: 15579857 blocks: [[1, 778992], [778993, 1557984], [1557985, 2336976], [2336977, 3115968], [3115969, 3894960], [3894961, 4673952], [4673953, 5452944], [5452945, 6231936], [6231937, 7010928], [7010929, 7789920], [7789921, 8568912], [8568913, 9347904], [9347905, 10126896], [10126897, 10905888], [10905889, 11684880], [11684881, 12463872], [12463873, 13242864], [13242865, 14021856], [14021857, 14800848], [14800849, 15579857]] SRR12690191 file size 5273016 SRR12690191 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690191 SRR12690191_1.fastq SRR12690191_2.fastq Input file: SRR12690191_1.fastq Paired file: SRR12690191_2.fastq trimmed: SRR12690191-trimmed-pair1.fastq, SRR12690191-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:27:57 2025 >> started Mon Feb 10 22:28:16 2025 >> done (19.388s) 15579857 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 1962 ( 0.01%) empty read pairs filtered out after trimming by size control 15577876 (99.99%) read pairs available; of these: 1379844 ( 8.86%) trimmed read pairs available after processing 14198032 (91.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 9 0.00% 23 4 0.00% 24 6 0.00% 25 13 0.00% 26 8 0.00% 27 7 0.00% 28 10 0.00% 29 12 0.00% 30 7 0.00% 31 14 0.00% 32 14 0.00% 33 12 0.00% 34 10 0.00% 35 16 0.00% 36 24 0.00% 37 15 0.00% 38 16 0.00% 39 20 0.00% 40 19 0.00% 41 32 0.00% 42 26 0.00% 43 28 0.00% 44 25 0.00% 45 36 0.00% 46 22 0.00% 47 50 0.00% 48 35 0.00% 49 39 0.00% 50 53 0.00% 51 56 0.00% 52 53 0.00% 53 78 0.00% 54 69 0.00% 55 87 0.00% 56 88 0.00% 57 91 0.00% 58 104 0.00% 59 117 0.00% 60 165 0.00% 61 151 0.00% 62 166 0.00% 63 187 0.00% 64 224 0.00% 65 228 0.00% 66 277 0.00% 67 327 0.00% 68 303 0.00% 69 394 0.00% 70 396 0.00% 71 527 0.00% 72 578 0.00% 73 666 0.00% 74 682 0.00% 75 794 0.01% 76 943 0.01% 77 987 0.01% 78 1149 0.01% 79 1244 0.01% 80 1400 0.01% 81 1523 0.01% 82 1730 0.01% 83 1861 0.01% 84 2164 0.01% 85 2422 0.02% 86 2581 0.02% 87 2826 0.02% 88 3217 0.02% 89 3429 0.02% 90 3678 0.02% 91 4147 0.03% 92 4432 0.03% 93 4763 0.03% 94 5112 0.03% 95 5515 0.04% 96 6025 0.04% 97 6489 0.04% 98 6964 0.04% 99 7246 0.05% 100 7917 0.05% 101 8103 0.05% 102 8493 0.05% 103 9286 0.06% 104 9772 0.06% 105 10367 0.07% 106 10751 0.07% 107 11552 0.07% 108 12014 0.08% 109 12846 0.08% 110 13297 0.09% 111 14068 0.09% 112 14451 0.09% 113 15414 0.10% 114 15997 0.10% 115 16775 0.11% 116 17498 0.11% 117 18112 0.12% 118 18705 0.12% 119 19681 0.13% 120 20704 0.13% 121 21180 0.14% 122 22096 0.14% 123 22932 0.15% 124 23344 0.15% 125 24250 0.16% 126 25191 0.16% 127 25995 0.17% 128 26825 0.17% 129 27413 0.18% 130 28492 0.18% 131 29287 0.19% 132 29877 0.19% 133 31119 0.20% 134 31871 0.20% 135 32511 0.21% 136 33490 0.21% 137 34189 0.22% 138 35038 0.22% 139 36618 0.24% 140 37238 0.24% 141 38384 0.25% 142 39821 0.26% 143 40138 0.26% 144 41509 0.27% 145 41970 0.27% 146 43091 0.28% 147 43728 0.28% 148 44987 0.29% 149 44955 0.29% 150 47257 0.30% 151 14198032 91.14% 15577876 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=8 prefix-density=0.52 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=12.61 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.3 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=26 prefix-density=0.79 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=42.18 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12690191 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:29:24 Started mapping on | Feb 10 22:29:26 Finished on | Feb 10 22:31:32 Mapping speed, Million of reads per hour | 445.08 Number of input reads | 15577876 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14876977 Uniquely mapped reads % | 95.50% Average mapped length | 296.95 Number of splices: Total | 15321568 Number of splices: Annotated (sjdb) | 14939973 Number of splices: GT/AG | 15010528 Number of splices: GC/AG | 249148 Number of splices: AT/AC | 11157 Number of splices: Non-canonical | 50735 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366697 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 39666 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.81% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 334202 334202 334202 N_multimapping 366697 366697 366697 N_noFeature 553603 14692685 606921 N_ambiguous 231808 813 100356 UnstrandedReadsAssigned:14091566 PositiveStrandReadsAssigned:183479 NegativeStrandReadsAssigned:14169700 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690191 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690191-trimmed-pair1.fastq SRR12690191-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,577,876 reads, 14,187,092 reads pseudoaligned [quant] estimated average fragment length: 257.371 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR12690191.ke.tsv 34699 SRR12690191.se.tsv 87100 total ==> SRR12690191.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.63 420 14.7727 Potri.005G024800.1.v4.1 1035 778.629 233 18.5418 Potri.004G059700.1.v4.1 961 704.747 27 2.37387 Potri.007G009000.2.v4.1 1416 1159.63 0 0 Potri.003G141000.2.v4.1 2943 2686.63 741.432 17.0997 Potri.016G087400.1.v4.1 270 79.3998 790 616.5 Potri.015G069301.1.v4.1 564 320.163 0 0 Potri.010G195200.1.v4.1 1773 1516.63 12 0.490261 Potri.012G127500.1.v4.1 977 720.693 212 18.2268 ==> SRR12690191.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 414 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 11 SRR12690191 completed mapping pipeline successfully