Starting /dee2/code/volunteer_pipeline.sh SRR12690192 current disk space = 3057359855616 free memory = 1210710500 SRR12690192 SRAfilesize 2cad6fd6dc94fdc0af344486b1558f84 SRR12690192.sra SRR12690192.sra file validated SRR12690192 is paired end SRR12690192 is conventional basespace SRR12690192 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690192_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.624 37.0 37.0 37.0 37.0 37.0 2 36.4325 37.0 37.0 37.0 37.0 37.0 3 36.54 37.0 37.0 37.0 37.0 37.0 4 36.63 37.0 37.0 37.0 37.0 37.0 5 36.628 37.0 37.0 37.0 37.0 37.0 6 36.5875 37.0 37.0 37.0 37.0 37.0 7 36.492 37.0 37.0 37.0 37.0 37.0 8 36.6255 37.0 37.0 37.0 37.0 37.0 9 36.538 37.0 37.0 37.0 37.0 37.0 10-14 36.6016 37.0 37.0 37.0 37.0 37.0 15-19 36.6053 37.0 37.0 37.0 37.0 37.0 20-24 36.5967 37.0 37.0 37.0 37.0 37.0 25-29 36.5227 37.0 37.0 37.0 37.0 37.0 30-34 36.4942 37.0 37.0 37.0 37.0 37.0 35-39 36.47130000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4491 37.0 37.0 37.0 37.0 37.0 45-49 36.4668 37.0 37.0 37.0 37.0 37.0 50-54 36.3977 37.0 37.0 37.0 37.0 37.0 55-59 36.3449 37.0 37.0 37.0 37.0 37.0 60-64 36.3246 37.0 37.0 37.0 37.0 37.0 65-69 36.302499999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.3347 37.0 37.0 37.0 37.0 37.0 75-79 36.3161 37.0 37.0 37.0 37.0 37.0 80-84 36.2515 37.0 37.0 37.0 37.0 37.0 85-89 36.3015 37.0 37.0 37.0 37.0 37.0 90-94 36.220299999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.2285 37.0 37.0 37.0 37.0 37.0 100-104 36.2051 37.0 37.0 37.0 37.0 37.0 105-109 36.148199999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1494 37.0 37.0 37.0 37.0 37.0 115-119 36.11749999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.079699999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0597 37.0 37.0 37.0 37.0 37.0 130-134 36.0124 37.0 37.0 37.0 37.0 37.0 135-139 36.001 37.0 37.0 37.0 37.0 37.0 140-144 35.787099999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.794 37.0 37.0 37.0 37.0 37.0 150-151 35.535 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 0.0 25 3.0 26 2.0 27 7.0 28 13.0 29 14.0 30 22.0 31 31.0 32 45.0 33 83.0 34 114.0 35 309.0 36 2979.0 37 375.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.225 12.325 7.1 38.35 2 20.160481444332998 13.390170511534604 35.05516549648947 31.39418254764293 3 17.474999999999998 15.4 28.249999999999996 38.875 4 21.25 23.400000000000002 26.625 28.725 5 23.375 29.9 23.599999999999998 23.125 6 19.950000000000003 33.4 23.150000000000002 23.5 7 16.625 27.125 38.7 17.549999999999997 8 17.525 27.525 31.3 23.65 9 17.95 23.474999999999998 35.725 22.85 10-14 19.96 29.060000000000002 27.800000000000004 23.18 15-19 20.24 27.839999999999996 27.675 24.245 20-24 20.380000000000003 27.87 27.755000000000003 23.995 25-29 20.48 27.98 27.55 23.990000000000002 30-34 20.865000000000002 27.735 27.339999999999996 24.060000000000002 35-39 20.794999999999998 27.755000000000003 27.365000000000002 24.085 40-44 20.775 28.52 26.995 23.71 45-49 20.785 27.474999999999998 27.98 23.76 50-54 20.77 27.800000000000004 27.665 23.765 55-59 20.549999999999997 27.500000000000004 27.52 24.43 60-64 20.369999999999997 28.165000000000003 27.33 24.135 65-69 21.01 27.375 27.55 24.065 70-74 20.91 27.445000000000004 27.865000000000002 23.78 75-79 20.669999999999998 27.075 28.215 24.04 80-84 20.53 27.615000000000002 28.255000000000003 23.599999999999998 85-89 19.965 27.47 27.884999999999998 24.68 90-94 20.735 27.57 27.694999999999997 24.0 95-99 20.8 28.325 27.43 23.445 100-104 20.560000000000002 28.335 27.389999999999997 23.715 105-109 21.2 27.51 27.41 23.880000000000003 110-114 21.145 28.134999999999998 27.125 23.595 115-119 21.85 28.27 27.04 22.84 120-124 21.165 27.310000000000002 27.375 24.15 125-129 20.685000000000002 28.01 27.26 24.044999999999998 130-134 20.974999999999998 28.105000000000004 27.060000000000002 23.86 135-139 21.2 27.805000000000003 26.825 24.169999999999998 140-144 21.279999999999998 27.639999999999997 27.37 23.71 145-149 21.345 27.505000000000003 26.795 24.355 150-151 21.05 27.9375 26.400000000000002 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 2.0 24 1.0 25 0.0 26 1.5 27 4.0 28 8.5 29 12.0 30 15.0 31 17.0 32 20.0 33 27.5 34 38.0 35 54.5 36 68.5 37 96.0 38 124.0 39 134.0 40 166.0 41 202.0 42 220.0 43 255.5 44 283.5 45 271.0 46 266.5 47 280.0 48 240.0 49 211.5 50 210.5 51 159.0 52 121.0 53 108.5 54 78.0 55 68.0 56 67.0 57 46.0 58 27.5 59 21.5 60 22.0 61 18.0 62 11.0 63 4.0 64 2.5 65 3.5 66 5.0 67 2.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.73936750272628 84.125 2 7.606324972737187 13.950000000000001 3 0.5452562704471101 1.5 4 0.08178844056706652 0.3 5 0.02726281352235551 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGGGCTTCTAATCACTGAGGTAGAATGAAACATTTTGCTATCATGCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.375 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.1125 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.7 0.0 0.0 0.0 0.0 122-123 4.25 0.0 0.0 0.0 0.0 124-125 4.9125 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.075 0.0 0.0 0.0 0.0 130-131 6.525 0.0 0.0 0.0 0.0 132-133 6.8125 0.0 0.0 0.0 0.0 134-135 7.275 0.0 0.0 0.0 0.0 136-137 7.8375 0.0 0.0 0.0 0.0 138-139 8.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCGCC 10 0.006830828 145.0 1 >>END_MODULE SRR12690192 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690192_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4805 37.0 37.0 37.0 37.0 37.0 2 36.2035 37.0 37.0 37.0 37.0 37.0 3 36.234 37.0 37.0 37.0 37.0 37.0 4 36.261 37.0 37.0 37.0 37.0 37.0 5 36.3215 37.0 37.0 37.0 37.0 37.0 6 36.2875 37.0 37.0 37.0 37.0 37.0 7 36.36 37.0 37.0 37.0 37.0 37.0 8 36.3795 37.0 37.0 37.0 37.0 37.0 9 36.3365 37.0 37.0 37.0 37.0 37.0 10-14 36.3137 37.0 37.0 37.0 37.0 37.0 15-19 36.334799999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.3232 37.0 37.0 37.0 37.0 37.0 25-29 36.2763 37.0 37.0 37.0 37.0 37.0 30-34 36.24249999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.254599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1529 37.0 37.0 37.0 37.0 37.0 45-49 36.162400000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.148 37.0 37.0 37.0 37.0 37.0 55-59 36.1025 37.0 37.0 37.0 37.0 37.0 60-64 36.1015 37.0 37.0 37.0 37.0 37.0 65-69 36.040499999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.02 37.0 37.0 37.0 37.0 37.0 75-79 35.979600000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.9798 37.0 37.0 37.0 37.0 37.0 85-89 35.981700000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.870200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.97709999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.9225 37.0 37.0 37.0 37.0 37.0 105-109 35.979200000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.8895 37.0 37.0 37.0 37.0 37.0 115-119 35.89110000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.7587 37.0 37.0 37.0 37.0 37.0 125-129 35.729 37.0 37.0 37.0 37.0 37.0 130-134 35.6529 37.0 37.0 37.0 37.0 37.0 135-139 35.61900000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.5004 37.0 37.0 37.0 37.0 37.0 145-149 35.379200000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.019499999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 4.0 14 3.0 15 3.0 16 2.0 17 1.0 18 2.0 19 0.0 20 1.0 21 3.0 22 5.0 23 6.0 24 9.0 25 3.0 26 6.0 27 9.0 28 13.0 29 18.0 30 21.0 31 35.0 32 54.0 33 66.0 34 148.0 35 455.0 36 2800.0 37 330.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.475 26.8 10.075000000000001 25.650000000000002 2 28.725 28.375 26.775 16.125 3 20.474999999999998 29.2 31.05 19.275000000000002 4 22.95 35.175 23.75 18.125 5 23.775 36.725 22.975 16.525000000000002 6 21.975 38.475 22.475 17.075000000000003 7 21.95 23.849999999999998 35.8 18.4 8 22.0 27.400000000000002 26.8 23.799999999999997 9 21.9 25.4 29.575000000000003 23.125 10-14 23.01 29.99 25.81 21.19 15-19 23.380000000000003 28.77 26.6 21.25 20-24 22.814999999999998 28.515 27.065 21.605 25-29 23.06 29.34 27.034999999999997 20.565 30-34 22.845 29.01 27.125 21.02 35-39 22.89 28.215 27.435 21.46 40-44 23.3 28.425 26.974999999999998 21.3 45-49 22.485 28.365000000000002 27.98 21.17 50-54 23.1 27.71 27.18 22.009999999999998 55-59 23.56 27.994999999999997 27.245 21.2 60-64 23.645 27.779999999999998 27.195000000000004 21.38 65-69 23.775 28.134999999999998 27.145000000000003 20.945 70-74 23.52 28.01 27.279999999999998 21.19 75-79 23.43 28.349999999999998 27.005000000000003 21.215 80-84 23.47 27.97 27.279999999999998 21.279999999999998 85-89 23.39 27.965 27.125 21.52 90-94 24.03 28.194999999999997 26.919999999999998 20.855 95-99 23.7 28.634999999999998 26.99 20.674999999999997 100-104 23.735 27.694999999999997 27.765 20.805 105-109 24.07 27.310000000000002 27.575 21.044999999999998 110-114 24.325 28.1 27.255000000000003 20.32 115-119 23.9 28.535 26.529999999999998 21.035 120-124 24.88 28.610000000000003 26.229999999999997 20.28 125-129 24.825 28.044999999999998 26.705000000000002 20.424999999999997 130-134 25.11 27.83 26.985 20.075000000000003 135-139 25.365 28.345 26.200000000000003 20.09 140-144 25.119999999999997 27.93 26.155 20.794999999999998 145-149 26.25 27.725 26.005 20.02 150-151 26.6625 27.462500000000002 26.200000000000003 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 1.5 8 0.5 9 0.0 10 1.5 11 2.0 12 1.0 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 1.0 24 1.0 25 0.5 26 1.0 27 1.0 28 6.0 29 10.0 30 11.0 31 17.0 32 22.5 33 32.0 34 44.0 35 51.5 36 73.5 37 107.5 38 141.0 39 165.5 40 185.0 41 218.5 42 249.0 43 262.0 44 281.5 45 277.5 46 265.0 47 256.0 48 229.0 49 208.0 50 173.0 51 145.5 52 122.5 53 98.5 54 87.5 55 69.0 56 46.0 57 29.0 58 20.5 59 17.0 60 15.0 61 11.5 62 5.5 63 4.0 64 2.5 65 3.0 66 3.5 67 1.0 68 1.0 69 1.0 70 1.5 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 1.5 96 1.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.81446111869032 84.125 2 7.421555252387449 13.600000000000001 3 0.6275579809004093 1.725 4 0.08185538881309685 0.3 5 0.054570259208731244 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAACACGAACAGGAGAATCTGGTGTCCGGCCACTGCCGGCCTTGAAAG 5 0.125 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.325 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 3.0625 0.0 0.0 0.0 0.0 118-119 3.4 0.0 0.0 0.0 0.0 120-121 3.7 0.0 0.0 0.0 0.0 122-123 4.262499999999999 0.0 0.0 0.0 0.0 124-125 4.9625 0.0 0.0 0.0 0.0 126-127 5.612500000000001 0.0 0.0 0.0 0.0 128-129 6.125 0.0 0.0 0.0 0.0 130-131 6.574999999999999 0.0 0.0 0.0 0.0 132-133 6.8625 0.0 0.0 0.0 0.0 134-135 7.3375 0.0 0.0 0.0 0.0 136-137 7.887499999999999 0.0 0.0 0.0 0.0 138-139 8.475000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603531 spots for SRR12690192.sra Written 603531 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra Read 603521 spots for SRR12690192.sra Written 603521 spots for SRR12690192.sra SRR ids: ['SRR12690192.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_64hcf4mr SRR12690192.sra spots: 12070430 blocks: [[1, 603521], [603522, 1207042], [1207043, 1810563], [1810564, 2414084], [2414085, 3017605], [3017606, 3621126], [3621127, 4224647], [4224648, 4828168], [4828169, 5431689], [5431690, 6035210], [6035211, 6638731], [6638732, 7242252], [7242253, 7845773], [7845774, 8449294], [8449295, 9052815], [9052816, 9656336], [9656337, 10259857], [10259858, 10863378], [10863379, 11466899], [11466900, 12070430]] SRR12690192 file size 4080359 SRR12690192 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690192 SRR12690192_1.fastq SRR12690192_2.fastq Input file: SRR12690192_1.fastq Paired file: SRR12690192_2.fastq trimmed: SRR12690192-trimmed-pair1.fastq, SRR12690192-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:24:39 2025 >> started Mon Feb 10 22:24:53 2025 >> done (13.509s) 12070430 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 3559 ( 0.03%) empty read pairs filtered out after trimming by size control 12066850 (99.97%) read pairs available; of these: 1648106 (13.66%) trimmed read pairs available after processing 10418744 (86.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 3 0.00% 21 5 0.00% 22 5 0.00% 23 7 0.00% 24 9 0.00% 25 9 0.00% 26 14 0.00% 27 17 0.00% 28 11 0.00% 29 19 0.00% 30 15 0.00% 31 18 0.00% 32 15 0.00% 33 23 0.00% 34 20 0.00% 35 24 0.00% 36 21 0.00% 37 30 0.00% 38 27 0.00% 39 19 0.00% 40 21 0.00% 41 34 0.00% 42 32 0.00% 43 33 0.00% 44 34 0.00% 45 41 0.00% 46 40 0.00% 47 51 0.00% 48 49 0.00% 49 63 0.00% 50 73 0.00% 51 62 0.00% 52 76 0.00% 53 90 0.00% 54 75 0.00% 55 111 0.00% 56 108 0.00% 57 104 0.00% 58 142 0.00% 59 175 0.00% 60 191 0.00% 61 216 0.00% 62 190 0.00% 63 286 0.00% 64 299 0.00% 65 323 0.00% 66 361 0.00% 67 418 0.00% 68 493 0.00% 69 548 0.00% 70 549 0.00% 71 691 0.01% 72 763 0.01% 73 919 0.01% 74 1022 0.01% 75 1092 0.01% 76 1203 0.01% 77 1391 0.01% 78 1585 0.01% 79 1699 0.01% 80 1894 0.02% 81 2221 0.02% 82 2386 0.02% 83 2595 0.02% 84 3001 0.02% 85 3270 0.03% 86 3685 0.03% 87 4058 0.03% 88 4375 0.04% 89 4664 0.04% 90 5134 0.04% 91 5598 0.05% 92 6223 0.05% 93 6766 0.06% 94 7338 0.06% 95 8052 0.07% 96 8355 0.07% 97 9223 0.08% 98 9649 0.08% 99 10186 0.08% 100 10806 0.09% 101 11332 0.09% 102 12313 0.10% 103 12913 0.11% 104 13472 0.11% 105 14366 0.12% 106 15171 0.13% 107 15882 0.13% 108 16659 0.14% 109 17232 0.14% 110 17858 0.15% 111 18995 0.16% 112 19799 0.16% 113 19958 0.17% 114 21099 0.17% 115 22097 0.18% 116 22728 0.19% 117 23707 0.20% 118 24466 0.20% 119 24978 0.21% 120 26069 0.22% 121 26944 0.22% 122 27393 0.23% 123 28639 0.24% 124 29258 0.24% 125 29770 0.25% 126 31081 0.26% 127 31683 0.26% 128 32348 0.27% 129 33512 0.28% 130 34586 0.29% 131 34894 0.29% 132 35423 0.29% 133 36131 0.30% 134 37281 0.31% 135 38247 0.32% 136 38860 0.32% 137 38982 0.32% 138 39542 0.33% 139 41149 0.34% 140 41451 0.34% 141 42397 0.35% 142 43229 0.36% 143 44120 0.37% 144 44738 0.37% 145 45182 0.37% 146 46105 0.38% 147 45821 0.38% 148 47294 0.39% 149 47081 0.39% 150 48423 0.40% 151 10418744 86.34% 12066850 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.56 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=11.24 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=3.9 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=28 prefix-density=0.73 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=29.29 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.1 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12690192 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:25:36 Started mapping on | Feb 10 22:25:36 Finished on | Feb 10 22:27:03 Mapping speed, Million of reads per hour | 499.32 Number of input reads | 12066850 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11363736 Uniquely mapped reads % | 94.17% Average mapped length | 294.48 Number of splices: Total | 11350248 Number of splices: Annotated (sjdb) | 11123743 Number of splices: GT/AG | 11131820 Number of splices: GC/AG | 176243 Number of splices: AT/AC | 7224 Number of splices: Non-canonical | 34961 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303454 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 52496 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 399660 399660 399660 N_multimapping 303454 303454 303454 N_noFeature 326571 11227972 368173 N_ambiguous 168670 566 74183 UnstrandedReadsAssigned:10868495 PositiveStrandReadsAssigned:135198 NegativeStrandReadsAssigned:10921380 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690192 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690192-trimmed-pair1.fastq SRR12690192-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,066,850 reads, 10,943,856 reads pseudoaligned [quant] estimated average fragment length: 236.132 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR12690192.ke.tsv 34699 SRR12690192.se.tsv 87100 total ==> SRR12690192.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.87 343 15.9268 Potri.005G024800.1.v4.1 1035 799.868 278 28.7727 Potri.004G059700.1.v4.1 961 725.933 18 2.05272 Potri.007G009000.2.v4.1 1416 1180.87 0 0 Potri.003G141000.2.v4.1 2943 2707.87 479.729 14.6664 Potri.016G087400.1.v4.1 270 87.9565 477 448.956 Potri.015G069301.1.v4.1 564 336.383 0 0 Potri.010G195200.1.v4.1 1773 1537.87 22 1.18429 Potri.012G127500.1.v4.1 977 741.903 400 44.634 ==> SRR12690192.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 312 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 174 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR12690192 completed mapping pipeline successfully