Starting /dee2/code/volunteer_pipeline.sh SRR12690193 current disk space = 3057386455040 free memory = 1114638604 SRR12690193 SRAfilesize c2872bc3815bbd6e9201510e484e3214 SRR12690193.sra SRR12690193.sra file validated SRR12690193 is paired end SRR12690193 is conventional basespace SRR12690193 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690193_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5725 37.0 37.0 37.0 37.0 37.0 2 36.37125 37.0 37.0 37.0 37.0 37.0 3 36.5805 37.0 37.0 37.0 37.0 37.0 4 36.566 37.0 37.0 37.0 37.0 37.0 5 36.6265 37.0 37.0 37.0 37.0 37.0 6 36.614 37.0 37.0 37.0 37.0 37.0 7 36.5195 37.0 37.0 37.0 37.0 37.0 8 36.5925 37.0 37.0 37.0 37.0 37.0 9 36.583 37.0 37.0 37.0 37.0 37.0 10-14 36.6063 37.0 37.0 37.0 37.0 37.0 15-19 36.5704 37.0 37.0 37.0 37.0 37.0 20-24 36.5715 37.0 37.0 37.0 37.0 37.0 25-29 36.5012 37.0 37.0 37.0 37.0 37.0 30-34 36.5021 37.0 37.0 37.0 37.0 37.0 35-39 36.5158 37.0 37.0 37.0 37.0 37.0 40-44 36.497499999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.4578 37.0 37.0 37.0 37.0 37.0 50-54 36.4504 37.0 37.0 37.0 37.0 37.0 55-59 36.3985 37.0 37.0 37.0 37.0 37.0 60-64 36.365899999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3522 37.0 37.0 37.0 37.0 37.0 70-74 36.3721 37.0 37.0 37.0 37.0 37.0 75-79 36.3373 37.0 37.0 37.0 37.0 37.0 80-84 36.280899999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.3334 37.0 37.0 37.0 37.0 37.0 90-94 36.27479999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.251799999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2068 37.0 37.0 37.0 37.0 37.0 105-109 36.1702 37.0 37.0 37.0 37.0 37.0 110-114 36.134699999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1243 37.0 37.0 37.0 37.0 37.0 120-124 36.0176 37.0 37.0 37.0 37.0 37.0 125-129 36.0669 37.0 37.0 37.0 37.0 37.0 130-134 35.980399999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.0411 37.0 37.0 37.0 37.0 37.0 140-144 35.8077 37.0 37.0 37.0 37.0 37.0 145-149 35.7937 37.0 37.0 37.0 37.0 37.0 150-151 35.6 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 5.0 26 1.0 27 6.0 28 9.0 29 19.0 30 31.0 31 42.0 32 42.0 33 61.0 34 104.0 35 284.0 36 3015.0 37 380.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.225 12.575 7.375 37.824999999999996 2 20.180496365003762 12.860366006517923 33.51717222361494 33.441965404863375 3 16.35 15.35 30.3 38.0 4 21.375 22.400000000000002 25.75 30.475 5 22.95 31.25 23.575 22.225 6 20.599999999999998 33.525 23.849999999999998 22.025 7 15.45 26.875 39.65 18.025 8 16.975 26.625 32.675 23.724999999999998 9 16.55 24.75 34.449999999999996 24.25 10-14 19.48 29.755 27.785 22.98 15-19 20.21 28.26 27.415 24.115000000000002 20-24 19.99 28.395 27.589999999999996 24.025 25-29 20.385 28.134999999999998 27.27 24.21 30-34 20.330000000000002 27.925 27.74 24.005000000000003 35-39 20.195 27.889999999999997 27.55 24.365000000000002 40-44 20.65 27.750000000000004 27.77 23.830000000000002 45-49 20.535 27.615000000000002 28.244999999999997 23.605 50-54 20.724999999999998 27.800000000000004 27.58 23.895 55-59 20.59 27.87 27.689999999999998 23.849999999999998 60-64 20.125 28.42 27.589999999999996 23.865 65-69 20.575 27.715 27.97 23.74 70-74 20.53 28.095 27.884999999999998 23.49 75-79 20.45 27.485 28.315 23.75 80-84 20.43 27.92 27.48 24.169999999999998 85-89 21.2 27.855 27.58 23.365 90-94 21.01 28.04 27.555000000000003 23.395 95-99 20.9 27.71 27.77 23.62 100-104 21.22 28.215 27.32 23.244999999999997 105-109 20.65 27.73 28.315 23.305 110-114 21.32 28.27 27.005000000000003 23.405 115-119 20.830000000000002 27.82 27.705000000000002 23.645 120-124 20.445 27.875 28.134999999999998 23.544999999999998 125-129 21.3 27.355 27.92 23.425 130-134 21.15 28.23 27.52 23.1 135-139 21.485000000000003 28.15 27.415 22.95 140-144 21.305 27.61 27.625 23.46 145-149 21.240000000000002 28.875 27.235 22.650000000000002 150-151 20.9875 28.599999999999998 26.787499999999998 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 2.5 25 3.5 26 3.5 27 6.0 28 8.0 29 8.5 30 12.5 31 16.5 32 19.5 33 28.5 34 44.5 35 57.5 36 75.5 37 103.0 38 120.0 39 141.5 40 177.5 41 205.5 42 235.0 43 272.5 44 280.5 45 271.0 46 263.5 47 257.5 48 233.0 49 218.0 50 206.5 51 160.5 52 126.5 53 100.5 54 72.0 55 65.5 56 61.0 57 37.5 58 26.5 59 24.5 60 18.5 61 10.5 62 4.5 63 5.0 64 4.0 65 2.0 66 1.0 67 0.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.8859649122807 83.8 2 6.798245614035088 12.4 3 1.1239035087719298 3.075 4 0.1644736842105263 0.6 5 0.027412280701754384 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 1.9249999999999998 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.4749999999999996 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.7375 0.0 0.0 0.0 0.0 132-133 5.1 0.0 0.0 0.0 0.0 134-135 5.4125 0.0 0.0 0.0 0.0 136-137 5.8375 0.0 0.0 0.0 0.0 138-139 6.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTAGT 10 0.006830828 145.0 6 CCTAGTT 10 0.006830828 145.0 7 >>END_MODULE SRR12690193 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690193_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.164 37.0 37.0 37.0 37.0 37.0 2 35.7705 37.0 37.0 37.0 37.0 37.0 3 35.94 37.0 37.0 37.0 37.0 37.0 4 36.006 37.0 37.0 37.0 37.0 37.0 5 36.156 37.0 37.0 37.0 37.0 37.0 6 36.1595 37.0 37.0 37.0 37.0 37.0 7 35.9345 37.0 37.0 37.0 37.0 37.0 8 36.0585 37.0 37.0 37.0 37.0 37.0 9 36.111 37.0 37.0 37.0 37.0 37.0 10-14 36.1471 37.0 37.0 37.0 37.0 37.0 15-19 36.11749999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.0638 37.0 37.0 37.0 37.0 37.0 25-29 36.054700000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.9994 37.0 37.0 37.0 37.0 37.0 35-39 36.0227 37.0 37.0 37.0 37.0 37.0 40-44 35.9373 37.0 37.0 37.0 37.0 37.0 45-49 35.949299999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.9033 37.0 37.0 37.0 37.0 37.0 55-59 35.905100000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.8528 37.0 37.0 37.0 37.0 37.0 65-69 35.8043 37.0 37.0 37.0 37.0 37.0 70-74 35.785 37.0 37.0 37.0 37.0 37.0 75-79 35.70399999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.8083 37.0 37.0 37.0 37.0 37.0 85-89 35.7724 37.0 37.0 37.0 37.0 37.0 90-94 35.669200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.7607 37.0 37.0 37.0 37.0 37.0 100-104 35.707800000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.695 37.0 37.0 37.0 37.0 37.0 110-114 35.6058 37.0 37.0 37.0 37.0 37.0 115-119 35.461200000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.49390000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.4933 37.0 37.0 37.0 37.0 37.0 130-134 35.379 37.0 37.0 37.0 34.6 37.0 135-139 35.300200000000004 37.0 37.0 37.0 34.6 37.0 140-144 35.2375 37.0 37.0 37.0 32.2 37.0 145-149 35.1129 37.0 37.0 37.0 27.4 37.0 150-151 34.565 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 6.0 15 2.0 16 1.0 17 1.0 18 0.0 19 1.0 20 0.0 21 3.0 22 3.0 23 13.0 24 4.0 25 4.0 26 8.0 27 16.0 28 19.0 29 29.0 30 37.0 31 35.0 32 70.0 33 109.0 34 231.0 35 648.0 36 2575.0 37 182.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.375 24.349999999999998 8.975 25.3 2 29.2 27.500000000000004 27.950000000000003 15.35 3 19.825 29.75 30.775000000000002 19.650000000000002 4 22.725 36.275 22.6 18.4 5 24.975 34.8 22.55 17.675 6 19.8 39.85 22.125 18.224999999999998 7 20.825 23.375 36.5 19.3 8 22.05 26.575 26.674999999999997 24.7 9 21.2 26.125 28.7 23.974999999999998 10-14 23.39 29.549999999999997 25.765 21.295 15-19 23.494999999999997 28.675 26.650000000000002 21.18 20-24 22.66 28.549999999999997 27.435 21.355 25-29 22.705000000000002 28.71 27.72 20.865000000000002 30-34 22.845 28.73 27.26 21.165 35-39 22.75 27.98 27.87 21.4 40-44 23.25 29.01 26.815 20.925 45-49 22.39 28.625 27.894999999999996 21.09 50-54 23.23 28.23 27.450000000000003 21.09 55-59 23.11 28.389999999999997 27.38 21.12 60-64 23.915 27.98 27.025 21.08 65-69 23.94 27.560000000000002 27.779999999999998 20.72 70-74 23.71 28.105000000000004 27.224999999999998 20.96 75-79 23.82 27.52 27.63 21.029999999999998 80-84 22.765 28.194999999999997 27.235 21.805 85-89 23.61 27.994999999999997 26.939999999999998 21.455 90-94 23.195 27.589999999999996 28.18 21.035 95-99 23.44 28.365000000000002 26.875 21.32 100-104 23.985 28.29 26.82 20.905 105-109 23.400000000000002 27.935 27.54 21.125 110-114 23.595 28.189999999999998 27.755000000000003 20.46 115-119 24.175 27.72 27.38 20.724999999999998 120-124 24.529999999999998 27.83 27.355 20.285 125-129 24.005000000000003 28.12 26.76 21.115000000000002 130-134 24.474999999999998 27.450000000000003 27.255000000000003 20.82 135-139 24.84 28.22 26.540000000000003 20.4 140-144 24.47 27.16 27.375 20.995 145-149 25.645 27.68 26.540000000000003 20.135 150-151 26.200000000000003 27.0125 27.537499999999998 19.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.5 12 2.0 13 1.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 2.0 24 2.5 25 2.0 26 4.5 27 6.5 28 6.5 29 9.5 30 11.0 31 15.5 32 24.0 33 30.0 34 34.5 35 55.5 36 72.5 37 90.5 38 117.0 39 153.5 40 214.5 41 240.5 42 241.5 43 279.5 44 298.0 45 286.5 46 297.5 47 272.0 48 223.5 49 196.5 50 167.5 51 138.5 52 104.5 53 80.0 54 77.0 55 66.5 56 43.5 57 28.0 58 20.5 59 20.0 60 17.0 61 9.0 62 5.5 63 3.0 64 2.0 65 2.5 66 2.0 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 1.0 97 1.0 98 0.0 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.0 #Duplication Level Percentage of deduplicated Percentage of total 1 92.03296703296702 83.75 2 6.675824175824176 12.15 3 1.0714285714285714 2.9250000000000003 4 0.08241758241758242 0.3 5 0.027472527472527472 0.125 6 0.027472527472527472 0.15 7 0.027472527472527472 0.17500000000000002 8 0.027472527472527472 0.2 9 0.027472527472527472 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 1.9500000000000002 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.2875 0.0 0.0 0.0 0.0 126-127 3.8125 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.8625 0.0 0.0 0.0 0.0 132-133 5.225 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 5.95 0.0 0.0 0.0 0.0 138-139 6.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728285 spots for SRR12690193.sra Written 728285 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra Read 728284 spots for SRR12690193.sra Written 728284 spots for SRR12690193.sra SRR ids: ['SRR12690193.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7giklyar SRR12690193.sra spots: 14565681 blocks: [[1, 728284], [728285, 1456568], [1456569, 2184852], [2184853, 2913136], [2913137, 3641420], [3641421, 4369704], [4369705, 5097988], [5097989, 5826272], [5826273, 6554556], [6554557, 7282840], [7282841, 8011124], [8011125, 8739408], [8739409, 9467692], [9467693, 10195976], [10195977, 10924260], [10924261, 11652544], [11652545, 12380828], [12380829, 13109112], [13109113, 13837396], [13837397, 14565681]] SRR12690193 file size 4928355 SRR12690193 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690193 SRR12690193_1.fastq SRR12690193_2.fastq Input file: SRR12690193_1.fastq Paired file: SRR12690193_2.fastq trimmed: SRR12690193-trimmed-pair1.fastq, SRR12690193-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:29:07 2025 >> started Mon Feb 10 22:29:24 2025 >> done (16.813s) 14565681 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 3972 ( 0.03%) empty read pairs filtered out after trimming by size control 14561681 (99.97%) read pairs available; of these: 1559877 (10.71%) trimmed read pairs available after processing 13001804 (89.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 6 0.00% 21 8 0.00% 22 9 0.00% 23 11 0.00% 24 7 0.00% 25 19 0.00% 26 19 0.00% 27 13 0.00% 28 18 0.00% 29 24 0.00% 30 19 0.00% 31 23 0.00% 32 21 0.00% 33 24 0.00% 34 26 0.00% 35 17 0.00% 36 22 0.00% 37 23 0.00% 38 33 0.00% 39 32 0.00% 40 31 0.00% 41 24 0.00% 42 43 0.00% 43 32 0.00% 44 47 0.00% 45 32 0.00% 46 49 0.00% 47 46 0.00% 48 57 0.00% 49 68 0.00% 50 75 0.00% 51 75 0.00% 52 82 0.00% 53 61 0.00% 54 99 0.00% 55 102 0.00% 56 114 0.00% 57 118 0.00% 58 119 0.00% 59 154 0.00% 60 185 0.00% 61 204 0.00% 62 237 0.00% 63 225 0.00% 64 313 0.00% 65 311 0.00% 66 314 0.00% 67 355 0.00% 68 384 0.00% 69 490 0.00% 70 553 0.00% 71 613 0.00% 72 714 0.00% 73 758 0.01% 74 826 0.01% 75 968 0.01% 76 1098 0.01% 77 1174 0.01% 78 1252 0.01% 79 1391 0.01% 80 1606 0.01% 81 1841 0.01% 82 2056 0.01% 83 2247 0.02% 84 2566 0.02% 85 2875 0.02% 86 2962 0.02% 87 3392 0.02% 88 3826 0.03% 89 3928 0.03% 90 4390 0.03% 91 4719 0.03% 92 5121 0.04% 93 5676 0.04% 94 5991 0.04% 95 6538 0.04% 96 7064 0.05% 97 7369 0.05% 98 8032 0.06% 99 8586 0.06% 100 9057 0.06% 101 9551 0.07% 102 10361 0.07% 103 10816 0.07% 104 11320 0.08% 105 12128 0.08% 106 12816 0.09% 107 13407 0.09% 108 13766 0.09% 109 14832 0.10% 110 15031 0.10% 111 15824 0.11% 112 17164 0.12% 113 17367 0.12% 114 18655 0.13% 115 19194 0.13% 116 19638 0.13% 117 21015 0.14% 118 21741 0.15% 119 22189 0.15% 120 23336 0.16% 121 23979 0.16% 122 24973 0.17% 123 25964 0.18% 124 27398 0.19% 125 27462 0.19% 126 28606 0.20% 127 29085 0.20% 128 29926 0.21% 129 31178 0.21% 130 32005 0.22% 131 32796 0.23% 132 33949 0.23% 133 35300 0.24% 134 36211 0.25% 135 36832 0.25% 136 37294 0.26% 137 38647 0.27% 138 39679 0.27% 139 40881 0.28% 140 41070 0.28% 141 42719 0.29% 142 44049 0.30% 143 44400 0.30% 144 46501 0.32% 145 46981 0.32% 146 47577 0.33% 147 48375 0.33% 148 49843 0.34% 149 50012 0.34% 150 52019 0.36% 151 13001804 89.29% 14561681 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=0.69 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=493.38 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=16.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=27 prefix-density=0.80 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=22.35 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR12690193 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:30:08 Started mapping on | Feb 10 22:30:08 Finished on | Feb 10 22:31:39 Mapping speed, Million of reads per hour | 576.07 Number of input reads | 14561681 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13720639 Uniquely mapped reads % | 94.22% Average mapped length | 296.07 Number of splices: Total | 14147616 Number of splices: Annotated (sjdb) | 13831291 Number of splices: GT/AG | 13872436 Number of splices: GC/AG | 212125 Number of splices: AT/AC | 9968 Number of splices: Non-canonical | 53087 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353536 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 87736 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.56% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 487506 487506 487506 N_multimapping 353536 353536 353536 N_noFeature 454248 13510417 510562 N_ambiguous 236084 918 81602 UnstrandedReadsAssigned:13030307 PositiveStrandReadsAssigned:209304 NegativeStrandReadsAssigned:13128475 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690193 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690193-trimmed-pair1.fastq SRR12690193-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,561,681 reads, 13,186,971 reads pseudoaligned [quant] estimated average fragment length: 243.416 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR12690193.ke.tsv 34699 SRR12690193.se.tsv 87100 total ==> SRR12690193.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.58 386 12.5157 Potri.005G024800.1.v4.1 1035 792.584 207 15.036 Potri.004G059700.1.v4.1 961 718.634 15 1.20169 Potri.007G009000.2.v4.1 1416 1173.58 0 0 Potri.003G141000.2.v4.1 2943 2700.58 503.917 10.7426 Potri.016G087400.1.v4.1 270 81.9143 543 381.635 Potri.015G069301.1.v4.1 564 330.084 0 0 Potri.010G195200.1.v4.1 1773 1530.58 41 1.54218 Potri.012G127500.1.v4.1 977 734.609 418 32.7588 ==> SRR12690193.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 229 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 250 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR12690193 completed mapping pipeline successfully