Starting /dee2/code/volunteer_pipeline.sh SRR12690194 current disk space = 3057206300672 free memory = 1177936360 SRR12690194 SRAfilesize 1c0e0ca1cdb13b8e4f948eb18f4296fc SRR12690194.sra SRR12690194.sra file validated SRR12690194 is paired end SRR12690194 is conventional basespace SRR12690194 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690194_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5465 37.0 37.0 37.0 37.0 37.0 2 36.24925 37.0 37.0 37.0 37.0 37.0 3 36.586 37.0 37.0 37.0 37.0 37.0 4 36.5665 37.0 37.0 37.0 37.0 37.0 5 36.573 37.0 37.0 37.0 37.0 37.0 6 36.6 37.0 37.0 37.0 37.0 37.0 7 36.5985 37.0 37.0 37.0 37.0 37.0 8 36.5825 37.0 37.0 37.0 37.0 37.0 9 36.566 37.0 37.0 37.0 37.0 37.0 10-14 36.5806 37.0 37.0 37.0 37.0 37.0 15-19 36.574 37.0 37.0 37.0 37.0 37.0 20-24 36.535199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4765 37.0 37.0 37.0 37.0 37.0 30-34 36.435399999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.4601 37.0 37.0 37.0 37.0 37.0 40-44 36.4477 37.0 37.0 37.0 37.0 37.0 45-49 36.428799999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.4041 37.0 37.0 37.0 37.0 37.0 55-59 36.3118 37.0 37.0 37.0 37.0 37.0 60-64 36.3168 37.0 37.0 37.0 37.0 37.0 65-69 36.284800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.301 37.0 37.0 37.0 37.0 37.0 75-79 36.2569 37.0 37.0 37.0 37.0 37.0 80-84 36.164 37.0 37.0 37.0 37.0 37.0 85-89 36.2574 37.0 37.0 37.0 37.0 37.0 90-94 36.2238 37.0 37.0 37.0 37.0 37.0 95-99 36.19010000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.1171 37.0 37.0 37.0 37.0 37.0 105-109 36.1177 37.0 37.0 37.0 37.0 37.0 110-114 36.111000000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.0554 37.0 37.0 37.0 37.0 37.0 120-124 35.9972 37.0 37.0 37.0 37.0 37.0 125-129 35.985299999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.9107 37.0 37.0 37.0 37.0 37.0 135-139 35.8881 37.0 37.0 37.0 37.0 37.0 140-144 35.6387 37.0 37.0 37.0 37.0 37.0 145-149 35.6148 37.0 37.0 37.0 37.0 37.0 150-151 35.327 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 1.0 26 3.0 27 9.0 28 9.0 29 29.0 30 26.0 31 33.0 32 54.0 33 80.0 34 126.0 35 335.0 36 2919.0 37 374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.425 13.05 4.925 37.6 2 19.889641334336595 13.669425633308252 35.164283922748936 31.27664910960622 3 17.25 15.65 27.750000000000004 39.35 4 21.4 23.7 24.7 30.2 5 22.975 29.425 25.55 22.05 6 21.95 32.25 24.175 21.625 7 16.175 27.3 40.675 15.85 8 19.275000000000002 24.55 32.6 23.575 9 16.85 25.45 35.199999999999996 22.5 10-14 20.215 28.93 27.875 22.98 15-19 20.035 28.075 27.735 24.154999999999998 20-24 19.735 28.444999999999997 27.889999999999997 23.93 25-29 20.255000000000003 28.060000000000002 27.474999999999998 24.21 30-34 19.814999999999998 29.049999999999997 27.255000000000003 23.880000000000003 35-39 20.185 28.449999999999996 27.025 24.34 40-44 20.54 28.405 27.689999999999998 23.365 45-49 19.439999999999998 28.660000000000004 27.195000000000004 24.705 50-54 20.255000000000003 27.99 27.639999999999997 24.115000000000002 55-59 20.53 28.565 27.1 23.805 60-64 20.435 27.685 27.915 23.965 65-69 20.23 27.48 28.205000000000002 24.085 70-74 20.415 28.565 27.605 23.415 75-79 20.195 27.615000000000002 28.37 23.82 80-84 20.69 28.005000000000003 27.595 23.71 85-89 20.255000000000003 28.405 27.395000000000003 23.945 90-94 20.11 27.73 27.644999999999996 24.515 95-99 20.44 27.91 27.450000000000003 24.2 100-104 20.995 28.34 27.16 23.505000000000003 105-109 21.055 27.529999999999998 27.015 24.4 110-114 20.669999999999998 28.325 27.33 23.674999999999997 115-119 20.635 27.55 28.065 23.75 120-124 20.62 27.88 27.73 23.77 125-129 21.08 28.1 27.185 23.635 130-134 20.945 27.515 27.295 24.245 135-139 21.25 27.694999999999997 26.900000000000002 24.154999999999998 140-144 21.13 27.655 26.669999999999998 24.545 145-149 21.005 28.29 26.435 24.27 150-151 21.825 27.450000000000003 26.137500000000003 24.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 5.0 27 5.5 28 6.5 29 9.0 30 13.0 31 24.5 32 30.0 33 39.5 34 55.5 35 62.0 36 67.5 37 101.5 38 135.0 39 153.0 40 167.0 41 193.0 42 229.0 43 257.0 44 276.0 45 273.0 46 262.0 47 251.5 48 243.5 49 216.0 50 166.0 51 147.5 52 138.0 53 107.0 54 80.5 55 65.0 56 52.0 57 44.0 58 30.0 59 19.0 60 21.0 61 14.5 62 10.5 63 5.5 64 3.5 65 3.0 66 2.0 67 1.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.225 #Duplication Level Percentage of deduplicated Percentage of total 1 90.41285674702134 81.575 2 8.506511499030202 15.35 3 0.914380714879468 2.475 4 0.1662510390689942 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 2.025 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.475 0.0 0.0 0.0 0.0 112-113 2.725 0.0 0.0 0.0 0.0 114-115 3.0999999999999996 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.625 0.0 0.0 0.0 0.0 120-121 4.0125 0.0 0.0 0.0 0.0 122-123 4.325 0.0 0.0 0.0 0.0 124-125 4.75 0.0 0.0 0.0 0.0 126-127 5.475 0.0 0.0 0.0 0.0 128-129 5.8125 0.0 0.0 0.0 0.0 130-131 6.3 0.0 0.0 0.0 0.0 132-133 6.9375 0.0 0.0 0.0 0.0 134-135 7.8125 0.0 0.0 0.0 0.0 136-137 8.337499999999999 0.0 0.0 0.0 0.0 138-139 8.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAAAC 10 0.006830828 145.0 2 CCTTCAT 10 0.006830828 145.0 1 >>END_MODULE SRR12690194 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690194_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2285 37.0 37.0 37.0 37.0 37.0 2 35.936 37.0 37.0 37.0 37.0 37.0 3 36.0745 37.0 37.0 37.0 37.0 37.0 4 36.191 37.0 37.0 37.0 37.0 37.0 5 36.1345 37.0 37.0 37.0 37.0 37.0 6 36.1035 37.0 37.0 37.0 37.0 37.0 7 36.176 37.0 37.0 37.0 37.0 37.0 8 36.2335 37.0 37.0 37.0 37.0 37.0 9 36.24 37.0 37.0 37.0 37.0 37.0 10-14 36.1519 37.0 37.0 37.0 37.0 37.0 15-19 36.1586 37.0 37.0 37.0 37.0 37.0 20-24 36.123400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.1143 37.0 37.0 37.0 37.0 37.0 30-34 36.047000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.033899999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.9251 37.0 37.0 37.0 37.0 37.0 45-49 35.8791 37.0 37.0 37.0 37.0 37.0 50-54 35.8821 37.0 37.0 37.0 37.0 37.0 55-59 35.9399 37.0 37.0 37.0 37.0 37.0 60-64 35.9024 37.0 37.0 37.0 37.0 37.0 65-69 35.8337 37.0 37.0 37.0 37.0 37.0 70-74 35.79729999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.77080000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.7791 37.0 37.0 37.0 37.0 37.0 85-89 35.71039999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.6217 37.0 37.0 37.0 37.0 37.0 95-99 35.6664 37.0 37.0 37.0 37.0 37.0 100-104 35.6971 37.0 37.0 37.0 37.0 37.0 105-109 35.704100000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6222 37.0 37.0 37.0 37.0 37.0 115-119 35.544200000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.505700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.445899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.345800000000004 37.0 37.0 37.0 34.6 37.0 135-139 35.2976 37.0 37.0 37.0 34.6 37.0 140-144 35.1681 37.0 37.0 37.0 29.8 37.0 145-149 35.0692 37.0 37.0 37.0 27.4 37.0 150-151 34.606 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 4.0 15 7.0 16 0.0 17 4.0 18 1.0 19 4.0 20 6.0 21 5.0 22 2.0 23 4.0 24 4.0 25 6.0 26 12.0 27 6.0 28 9.0 29 31.0 30 33.0 31 52.0 32 68.0 33 112.0 34 197.0 35 602.0 36 2574.0 37 251.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.9 25.2 9.25 24.65 2 27.800000000000004 27.925 28.749999999999996 15.525 3 20.825 28.025 31.525 19.625 4 24.375 35.025 23.625 16.975 5 23.925 38.375 21.425 16.275000000000002 6 22.400000000000002 38.574999999999996 21.825 17.2 7 20.674999999999997 23.45 38.425 17.45 8 20.575 27.075 26.5 25.85 9 22.05 25.424999999999997 29.9 22.625 10-14 23.745 29.24 26.255 20.76 15-19 23.580000000000002 27.534999999999997 27.79 21.095 20-24 23.445 28.555000000000003 27.025 20.974999999999998 25-29 23.205000000000002 28.175 27.67 20.95 30-34 22.97 28.17 27.955000000000002 20.905 35-39 22.2 28.09 28.34 21.37 40-44 23.145 27.935 28.01 20.91 45-49 23.189999999999998 28.405 27.744999999999997 20.66 50-54 23.52 28.444999999999997 27.48 20.555 55-59 23.005 28.055000000000003 27.505000000000003 21.435000000000002 60-64 24.055 28.005000000000003 27.26 20.68 65-69 22.975 28.485 28.035 20.505000000000003 70-74 23.53 28.415000000000003 27.229999999999997 20.825 75-79 23.895 28.249999999999996 26.825 21.029999999999998 80-84 23.425 28.12 27.785 20.669999999999998 85-89 22.85 28.315 27.43 21.404999999999998 90-94 23.49 27.72 27.900000000000002 20.89 95-99 23.995 28.03 27.205000000000002 20.77 100-104 23.64 27.87 27.355 21.135 105-109 23.810000000000002 28.610000000000003 27.075 20.505000000000003 110-114 24.345 28.24 27.245 20.169999999999998 115-119 24.345 27.85 27.224999999999998 20.580000000000002 120-124 24.855 27.565 27.46 20.119999999999997 125-129 24.69 28.349999999999998 26.38 20.580000000000002 130-134 24.775 28.02 26.56 20.645 135-139 25.290000000000003 27.845 26.805 20.06 140-144 25.174999999999997 28.435 26.415 19.975 145-149 26.619999999999997 28.110000000000003 25.695 19.575 150-151 27.712500000000002 27.6375 25.387500000000003 19.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.5 17 1.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 2.0 24 3.0 25 2.5 26 2.5 27 4.0 28 8.5 29 12.5 30 15.0 31 18.5 32 29.0 33 40.0 34 49.0 35 68.0 36 94.0 37 123.5 38 136.5 39 158.0 40 197.0 41 249.0 42 264.0 43 262.0 44 290.5 45 276.0 46 244.0 47 221.5 48 201.0 49 185.0 50 152.0 51 122.0 52 105.0 53 89.0 54 77.5 55 64.0 56 48.0 57 37.0 58 32.5 59 29.5 60 18.5 61 10.5 62 10.0 63 9.0 64 6.5 65 2.0 66 0.5 67 0.5 68 1.0 69 2.0 70 3.0 71 1.5 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.3 #Duplication Level Percentage of deduplicated Percentage of total 1 90.61461794019934 81.825 2 8.250276854928018 14.899999999999999 3 0.9689922480620154 2.625 4 0.13842746400885936 0.5 5 0.0 0.0 6 0.02768549280177187 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 2.025 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.475 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.65 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.325 0.0 0.0 0.0 0.0 124-125 4.75 0.0 0.0 0.0 0.0 126-127 5.4875 0.0 0.0 0.0 0.0 128-129 5.8375 0.0 0.0 0.0 0.0 130-131 6.325 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.7875 0.0 0.0 0.0 0.0 136-137 8.3125 0.0 0.0 0.0 0.0 138-139 8.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAAAA 10 0.006830828 145.0 5 >>END_MODULE Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra Read 813791 spots for SRR12690194.sra Written 813791 spots for SRR12690194.sra SRR ids: ['SRR12690194.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_he3i2v7j SRR12690194.sra spots: 16275820 blocks: [[1, 813791], [813792, 1627582], [1627583, 2441373], [2441374, 3255164], [3255165, 4068955], [4068956, 4882746], [4882747, 5696537], [5696538, 6510328], [6510329, 7324119], [7324120, 8137910], [8137911, 8951701], [8951702, 9765492], [9765493, 10579283], [10579284, 11393074], [11393075, 12206865], [12206866, 13020656], [13020657, 13834447], [13834448, 14648238], [14648239, 15462029], [15462030, 16275820]] SRR12690194 file size 5509535 SRR12690194 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690194 SRR12690194_1.fastq SRR12690194_2.fastq Input file: SRR12690194_1.fastq Paired file: SRR12690194_2.fastq trimmed: SRR12690194-trimmed-pair1.fastq, SRR12690194-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:14:31 2025 >> started Mon Feb 10 22:14:50 2025 >> done (19.247s) 16275820 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 4177 ( 0.03%) empty read pairs filtered out after trimming by size control 16271620 (99.97%) read pairs available; of these: 2016047 (12.39%) trimmed read pairs available after processing 14255573 (87.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 5 0.00% 21 4 0.00% 22 9 0.00% 23 6 0.00% 24 12 0.00% 25 18 0.00% 26 13 0.00% 27 10 0.00% 28 14 0.00% 29 15 0.00% 30 26 0.00% 31 14 0.00% 32 25 0.00% 33 20 0.00% 34 17 0.00% 35 26 0.00% 36 28 0.00% 37 23 0.00% 38 37 0.00% 39 46 0.00% 40 32 0.00% 41 18 0.00% 42 35 0.00% 43 35 0.00% 44 39 0.00% 45 58 0.00% 46 50 0.00% 47 52 0.00% 48 56 0.00% 49 90 0.00% 50 80 0.00% 51 113 0.00% 52 109 0.00% 53 134 0.00% 54 127 0.00% 55 143 0.00% 56 122 0.00% 57 192 0.00% 58 188 0.00% 59 273 0.00% 60 278 0.00% 61 297 0.00% 62 376 0.00% 63 424 0.00% 64 447 0.00% 65 493 0.00% 66 559 0.00% 67 648 0.00% 68 759 0.00% 69 852 0.01% 70 974 0.01% 71 1098 0.01% 72 1222 0.01% 73 1522 0.01% 74 1534 0.01% 75 1809 0.01% 76 2005 0.01% 77 2243 0.01% 78 2615 0.02% 79 2805 0.02% 80 3187 0.02% 81 3389 0.02% 82 3929 0.02% 83 4341 0.03% 84 4767 0.03% 85 5295 0.03% 86 5530 0.03% 87 6079 0.04% 88 6497 0.04% 89 6952 0.04% 90 7712 0.05% 91 8257 0.05% 92 8717 0.05% 93 9533 0.06% 94 10552 0.06% 95 11239 0.07% 96 11718 0.07% 97 12788 0.08% 98 13179 0.08% 99 13994 0.09% 100 14585 0.09% 101 15343 0.09% 102 16100 0.10% 103 16905 0.10% 104 17881 0.11% 105 18621 0.11% 106 19447 0.12% 107 20069 0.12% 108 21088 0.13% 109 21978 0.14% 110 22115 0.14% 111 23320 0.14% 112 24453 0.15% 113 24912 0.15% 114 25955 0.16% 115 27019 0.17% 116 28105 0.17% 117 28906 0.18% 118 29781 0.18% 119 29910 0.18% 120 31680 0.19% 121 32835 0.20% 122 33139 0.20% 123 34121 0.21% 124 35268 0.22% 125 35888 0.22% 126 37245 0.23% 127 37847 0.23% 128 38206 0.23% 129 39976 0.25% 130 40594 0.25% 131 41199 0.25% 132 42445 0.26% 133 43478 0.27% 134 44163 0.27% 135 44825 0.28% 136 45836 0.28% 137 46747 0.29% 138 47064 0.29% 139 48496 0.30% 140 48473 0.30% 141 49516 0.30% 142 50860 0.31% 143 51417 0.32% 144 53029 0.33% 145 53614 0.33% 146 54499 0.33% 147 55107 0.34% 148 55505 0.34% 149 56064 0.34% 150 57481 0.35% 151 14255573 87.61% 16271620 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=36 prefix-density=0.36 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=371.79 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=29 prefix-density=0.50 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=454.13 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=18.0 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12690194 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:16:06 Started mapping on | Feb 10 22:16:07 Finished on | Feb 10 22:18:19 Mapping speed, Million of reads per hour | 443.77 Number of input reads | 16271620 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15013689 Uniquely mapped reads % | 92.27% Average mapped length | 294.71 Number of splices: Total | 14175813 Number of splices: Annotated (sjdb) | 13733755 Number of splices: GT/AG | 13891427 Number of splices: GC/AG | 222866 Number of splices: AT/AC | 11372 Number of splices: Non-canonical | 50148 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423199 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 234271 % of reads mapped to too many loci | 1.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 834732 834732 834732 N_multimapping 423199 423199 423199 N_noFeature 710882 14784109 796081 N_ambiguous 240526 1304 95373 UnstrandedReadsAssigned:14062281 PositiveStrandReadsAssigned:228276 NegativeStrandReadsAssigned:14122235 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690194 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690194-trimmed-pair1.fastq SRR12690194-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,271,620 reads, 14,294,742 reads pseudoaligned [quant] estimated average fragment length: 249.901 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR12690194.ke.tsv 34699 SRR12690194.se.tsv 87100 total ==> SRR12690194.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.1 481 16.7622 Potri.005G024800.1.v4.1 1035 786.099 215 16.8616 Potri.004G059700.1.v4.1 961 712.231 0 0 Potri.007G009000.2.v4.1 1416 1167.1 0 0 Potri.003G141000.2.v4.1 2943 2694.1 674.878 15.4437 Potri.016G087400.1.v4.1 270 86.4419 1061 756.71 Potri.015G069301.1.v4.1 564 328.341 0 0 Potri.010G195200.1.v4.1 1773 1524.1 18 0.728111 Potri.012G127500.1.v4.1 977 728.154 162 13.7161 ==> SRR12690194.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR12690194 completed mapping pipeline successfully