Starting /dee2/code/volunteer_pipeline.sh SRR12690195 current disk space = 3057686757376 free memory = 1573311812 SRR12690195 SRAfilesize cba12d6d3ba6bcc6a5605a39cc9f90ba SRR12690195.sra SRR12690195.sra file validated SRR12690195 is paired end SRR12690195 is conventional basespace SRR12690195 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690195_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.677 37.0 37.0 37.0 37.0 37.0 2 36.33525 37.0 37.0 37.0 37.0 37.0 3 36.599 37.0 37.0 37.0 37.0 37.0 4 36.633 37.0 37.0 37.0 37.0 37.0 5 36.627 37.0 37.0 37.0 37.0 37.0 6 36.697 37.0 37.0 37.0 37.0 37.0 7 36.563 37.0 37.0 37.0 37.0 37.0 8 36.683 37.0 37.0 37.0 37.0 37.0 9 36.6095 37.0 37.0 37.0 37.0 37.0 10-14 36.6352 37.0 37.0 37.0 37.0 37.0 15-19 36.6174 37.0 37.0 37.0 37.0 37.0 20-24 36.609500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5447 37.0 37.0 37.0 37.0 37.0 30-34 36.4842 37.0 37.0 37.0 37.0 37.0 35-39 36.510200000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4951 37.0 37.0 37.0 37.0 37.0 45-49 36.4686 37.0 37.0 37.0 37.0 37.0 50-54 36.471700000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.4209 37.0 37.0 37.0 37.0 37.0 60-64 36.402899999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.37949999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.379000000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.349599999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.3485 37.0 37.0 37.0 37.0 37.0 85-89 36.3232 37.0 37.0 37.0 37.0 37.0 90-94 36.3154 37.0 37.0 37.0 37.0 37.0 95-99 36.2639 37.0 37.0 37.0 37.0 37.0 100-104 36.2299 37.0 37.0 37.0 37.0 37.0 105-109 36.1864 37.0 37.0 37.0 37.0 37.0 110-114 36.2057 37.0 37.0 37.0 37.0 37.0 115-119 36.1297 37.0 37.0 37.0 37.0 37.0 120-124 36.1083 37.0 37.0 37.0 37.0 37.0 125-129 36.0786 37.0 37.0 37.0 37.0 37.0 130-134 36.039199999999994 37.0 37.0 37.0 37.0 37.0 135-139 36.0536 37.0 37.0 37.0 37.0 37.0 140-144 35.81099999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.8424 37.0 37.0 37.0 37.0 37.0 150-151 35.664249999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 4.0 27 6.0 28 13.0 29 14.0 30 18.0 31 28.0 32 50.0 33 62.0 34 99.0 35 297.0 36 3036.0 37 371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.775 12.275 6.9750000000000005 40.975 2 19.59748427672956 12.805031446540879 36.65408805031446 30.943396226415093 3 18.2 14.95 29.9 36.95 4 21.8 22.925 25.75 29.525000000000002 5 23.200000000000003 30.4 24.65 21.75 6 22.2 31.7 23.799999999999997 22.3 7 16.05 27.725 38.975 17.25 8 18.2 25.525 32.35 23.925 9 18.375 24.925 35.0 21.7 10-14 20.32 28.43 27.58 23.669999999999998 15-19 20.055 28.134999999999998 27.894999999999996 23.915 20-24 20.665 27.965 27.32 24.05 25-29 19.99 28.59 27.51 23.91 30-34 20.305 28.185 27.46 24.05 35-39 20.45 28.485 27.29 23.775 40-44 20.775 28.000000000000004 27.57 23.655 45-49 21.09 27.439999999999998 27.544999999999998 23.925 50-54 20.294999999999998 27.54 27.66 24.505 55-59 20.575 27.46 27.725 24.240000000000002 60-64 20.335 28.050000000000004 27.675 23.94 65-69 20.69 27.900000000000002 27.505000000000003 23.905 70-74 20.615 28.32 27.445000000000004 23.62 75-79 21.044999999999998 27.685 27.375 23.895 80-84 20.7 27.96 27.79 23.549999999999997 85-89 20.849999999999998 27.534999999999997 27.74 23.875 90-94 21.15 27.445000000000004 27.365000000000002 24.04 95-99 20.78 27.77 27.839999999999996 23.61 100-104 20.61 28.15 26.889999999999997 24.349999999999998 105-109 21.435000000000002 27.060000000000002 27.644999999999996 23.86 110-114 21.029999999999998 27.87 26.795 24.305 115-119 21.05 27.91 27.67 23.369999999999997 120-124 21.485000000000003 27.689999999999998 27.084999999999997 23.74 125-129 21.775 27.61 27.04 23.575 130-134 20.705000000000002 27.500000000000004 27.575 24.22 135-139 21.725 27.875 26.155 24.245 140-144 21.5 27.229999999999997 27.36 23.91 145-149 21.13 27.365000000000002 27.655 23.849999999999998 150-151 21.462500000000002 28.65 26.575 23.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 3.0 25 3.0 26 1.5 27 4.0 28 5.5 29 9.0 30 18.0 31 21.5 32 22.5 33 26.0 34 36.0 35 53.0 36 77.0 37 97.0 38 120.0 39 150.0 40 183.0 41 211.5 42 216.0 43 243.0 44 268.5 45 266.0 46 270.0 47 259.5 48 242.5 49 216.5 50 182.5 51 154.5 52 124.5 53 105.5 54 90.5 55 69.5 56 57.5 57 54.5 58 40.5 59 30.5 60 24.0 61 14.0 62 8.0 63 2.0 64 1.0 65 1.5 66 1.5 67 1.5 68 2.5 69 2.5 70 1.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 91.71225382932167 83.825 2 7.303063457330415 13.350000000000001 3 0.8479212253829322 2.325 4 0.13676148796498905 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.7999999999999998 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 2.9749999999999996 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.324999999999999 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.8125 0.0 0.0 0.0 0.0 134-135 6.45 0.0 0.0 0.0 0.0 136-137 6.8875 0.0 0.0 0.0 0.0 138-139 7.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690195 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690195_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.272 37.0 37.0 37.0 37.0 37.0 2 35.9575 37.0 37.0 37.0 37.0 37.0 3 36.075 37.0 37.0 37.0 37.0 37.0 4 36.07 37.0 37.0 37.0 37.0 37.0 5 36.1905 37.0 37.0 37.0 37.0 37.0 6 36.1335 37.0 37.0 37.0 37.0 37.0 7 36.1795 37.0 37.0 37.0 37.0 37.0 8 36.3065 37.0 37.0 37.0 37.0 37.0 9 36.2195 37.0 37.0 37.0 37.0 37.0 10-14 36.276700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.254000000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.223200000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.1238 37.0 37.0 37.0 37.0 37.0 30-34 36.1812 37.0 37.0 37.0 37.0 37.0 35-39 36.1151 37.0 37.0 37.0 37.0 37.0 40-44 36.0154 37.0 37.0 37.0 37.0 37.0 45-49 36.100500000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0126 37.0 37.0 37.0 37.0 37.0 55-59 36.0218 37.0 37.0 37.0 37.0 37.0 60-64 35.9138 37.0 37.0 37.0 37.0 37.0 65-69 35.94930000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.9032 37.0 37.0 37.0 37.0 37.0 75-79 35.8835 37.0 37.0 37.0 37.0 37.0 80-84 35.9043 37.0 37.0 37.0 37.0 37.0 85-89 35.894800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.7113 37.0 37.0 37.0 37.0 37.0 95-99 35.8464 37.0 37.0 37.0 37.0 37.0 100-104 35.8269 37.0 37.0 37.0 37.0 37.0 105-109 35.7411 37.0 37.0 37.0 37.0 37.0 110-114 35.7099 37.0 37.0 37.0 37.0 37.0 115-119 35.6723 37.0 37.0 37.0 37.0 37.0 120-124 35.601099999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.5336 37.0 37.0 37.0 37.0 37.0 130-134 35.4448 37.0 37.0 37.0 34.6 37.0 135-139 35.42 37.0 37.0 37.0 37.0 37.0 140-144 35.360699999999994 37.0 37.0 37.0 34.6 37.0 145-149 35.1831 37.0 37.0 37.0 27.4 37.0 150-151 34.74575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 2.0 15 4.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 3.0 22 2.0 23 4.0 24 2.0 25 7.0 26 9.0 27 9.0 28 16.0 29 21.0 30 32.0 31 30.0 32 66.0 33 108.0 34 223.0 35 616.0 36 2633.0 37 206.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.025 25.224999999999998 10.975 27.775 2 26.875 28.299999999999997 29.549999999999997 15.275 3 19.45 28.775000000000002 31.974999999999998 19.8 4 22.725 35.65 23.5 18.125 5 24.525 37.8 21.6 16.075 6 19.875 38.425 23.400000000000002 18.3 7 21.775 23.45 35.9 18.875 8 22.175 26.174999999999997 27.575 24.075 9 21.075 24.375 30.825000000000003 23.724999999999998 10-14 23.169999999999998 29.725 26.334999999999997 20.77 15-19 22.88 28.384999999999998 26.83 21.905 20-24 23.055 27.455000000000002 27.555000000000003 21.935 25-29 23.02 27.955000000000002 27.384999999999998 21.64 30-34 23.205000000000002 27.76 27.900000000000002 21.135 35-39 22.575 27.905 27.735 21.785 40-44 22.36 27.939999999999998 28.265 21.435000000000002 45-49 23.14 28.165000000000003 27.58 21.115000000000002 50-54 22.905 27.815 27.284999999999997 21.995 55-59 23.585 27.35 27.029999999999998 22.035 60-64 23.665 27.644999999999996 27.884999999999998 20.805 65-69 23.27 27.215 27.52 21.995 70-74 23.585 27.355 27.310000000000002 21.75 75-79 23.35 27.68 27.529999999999998 21.44 80-84 23.595 28.1 26.695 21.61 85-89 23.375 28.505000000000003 27.235 20.885 90-94 23.880000000000003 27.22 27.455000000000002 21.445 95-99 23.535 27.250000000000004 27.495000000000005 21.72 100-104 24.195 27.375 27.139999999999997 21.29 105-109 23.635 27.339999999999996 27.74 21.285 110-114 23.965 27.91 27.150000000000002 20.974999999999998 115-119 23.799999999999997 28.035 26.765 21.4 120-124 24.275 27.925 27.05 20.75 125-129 24.36 28.15 26.895000000000003 20.595 130-134 24.5 27.345000000000002 27.265 20.89 135-139 25.35 27.315 26.884999999999998 20.45 140-144 24.97 27.435 27.47 20.125 145-149 25.735000000000003 27.634999999999998 26.41 20.22 150-151 26.6125 26.974999999999998 26.5375 19.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.5 26 4.5 27 6.0 28 8.5 29 12.0 30 13.0 31 21.5 32 30.0 33 37.5 34 44.5 35 57.0 36 78.5 37 106.5 38 131.0 39 161.5 40 195.0 41 216.5 42 254.0 43 256.5 44 243.0 45 246.0 46 250.0 47 244.0 48 213.0 49 191.0 50 189.0 51 167.0 52 117.0 53 86.5 54 81.0 55 79.0 56 57.5 57 40.5 58 41.5 59 29.5 60 16.5 61 15.5 62 12.0 63 8.0 64 5.5 65 2.5 66 2.0 67 2.5 68 1.5 69 1.0 70 2.0 71 2.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.9 #Duplication Level Percentage of deduplicated Percentage of total 1 91.5016501650165 83.175 2 7.2607260726072615 13.200000000000001 3 1.0176017601760174 2.775 4 0.1925192519251925 0.7000000000000001 5 0.0 0.0 6 0.0275027502750275 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.7999999999999998 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 2.9749999999999996 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.324999999999999 0.0 0.0 0.0 0.0 128-129 4.824999999999999 0.0 0.0 0.0 0.0 130-131 5.3375 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.475 0.0 0.0 0.0 0.0 136-137 6.9625 0.0 0.0 0.0 0.0 138-139 7.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGAA 10 0.006830828 145.0 4 GAAGAAC 10 0.006830828 145.0 2 AGAACTA 10 0.006830828 145.0 4 GAACTAC 10 0.006830828 145.0 5 AACTACC 10 0.006830828 145.0 6 ACTACCT 10 0.006830828 145.0 7 >>END_MODULE Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975822 spots for SRR12690195.sra Written 975822 spots for SRR12690195.sra Read 975834 spots for SRR12690195.sra Written 975834 spots for SRR12690195.sra SRR ids: ['SRR12690195.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gl_aeamw SRR12690195.sra spots: 19516452 blocks: [[1, 975822], [975823, 1951644], [1951645, 2927466], [2927467, 3903288], [3903289, 4879110], [4879111, 5854932], [5854933, 6830754], [6830755, 7806576], [7806577, 8782398], [8782399, 9758220], [9758221, 10734042], [10734043, 11709864], [11709865, 12685686], [12685687, 13661508], [13661509, 14637330], [14637331, 15613152], [15613153, 16588974], [16588975, 17564796], [17564797, 18540618], [18540619, 19516452]] SRR12690195 file size 6610843 SRR12690195 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690195 SRR12690195_1.fastq SRR12690195_2.fastq Input file: SRR12690195_1.fastq Paired file: SRR12690195_2.fastq trimmed: SRR12690195-trimmed-pair1.fastq, SRR12690195-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:30:46 2025 >> started Mon Feb 10 23:31:09 2025 >> done (22.903s) 19516452 read pairs processed; of these: 42 ( 0.00%) short read pairs filtered out after trimming by size control 2503 ( 0.01%) empty read pairs filtered out after trimming by size control 19513907 (99.99%) read pairs available; of these: 2154022 (11.04%) trimmed read pairs available after processing 17359885 (88.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 6 0.00% 21 7 0.00% 22 16 0.00% 23 14 0.00% 24 17 0.00% 25 10 0.00% 26 16 0.00% 27 16 0.00% 28 27 0.00% 29 22 0.00% 30 11 0.00% 31 14 0.00% 32 22 0.00% 33 38 0.00% 34 18 0.00% 35 20 0.00% 36 25 0.00% 37 28 0.00% 38 35 0.00% 39 37 0.00% 40 35 0.00% 41 45 0.00% 42 49 0.00% 43 46 0.00% 44 37 0.00% 45 50 0.00% 46 53 0.00% 47 46 0.00% 48 84 0.00% 49 82 0.00% 50 123 0.00% 51 111 0.00% 52 114 0.00% 53 124 0.00% 54 123 0.00% 55 139 0.00% 56 153 0.00% 57 178 0.00% 58 226 0.00% 59 225 0.00% 60 257 0.00% 61 300 0.00% 62 327 0.00% 63 392 0.00% 64 408 0.00% 65 497 0.00% 66 552 0.00% 67 612 0.00% 68 639 0.00% 69 840 0.00% 70 811 0.00% 71 967 0.00% 72 1157 0.01% 73 1229 0.01% 74 1458 0.01% 75 1620 0.01% 76 1814 0.01% 77 1927 0.01% 78 2293 0.01% 79 2344 0.01% 80 2613 0.01% 81 3070 0.02% 82 3447 0.02% 83 3746 0.02% 84 4160 0.02% 85 4580 0.02% 86 5079 0.03% 87 5474 0.03% 88 5816 0.03% 89 6217 0.03% 90 6878 0.04% 91 7478 0.04% 92 8037 0.04% 93 8880 0.05% 94 9270 0.05% 95 10202 0.05% 96 10873 0.06% 97 11620 0.06% 98 12291 0.06% 99 12758 0.07% 100 13712 0.07% 101 14126 0.07% 102 15228 0.08% 103 15756 0.08% 104 16647 0.09% 105 17626 0.09% 106 18587 0.10% 107 19156 0.10% 108 20263 0.10% 109 21188 0.11% 110 21597 0.11% 111 22865 0.12% 112 23906 0.12% 113 24451 0.13% 114 25730 0.13% 115 27135 0.14% 116 28077 0.14% 117 29219 0.15% 118 30407 0.16% 119 30821 0.16% 120 32254 0.17% 121 33119 0.17% 122 34275 0.18% 123 35758 0.18% 124 36846 0.19% 125 38330 0.20% 126 39131 0.20% 127 40481 0.21% 128 41800 0.21% 129 42721 0.22% 130 44164 0.23% 131 44853 0.23% 132 45846 0.23% 133 47790 0.24% 134 48610 0.25% 135 50281 0.26% 136 51294 0.26% 137 52062 0.27% 138 53649 0.27% 139 55157 0.28% 140 55978 0.29% 141 57094 0.29% 142 59011 0.30% 143 59669 0.31% 144 61200 0.31% 145 62247 0.32% 146 63549 0.33% 147 64654 0.33% 148 65543 0.34% 149 66777 0.34% 150 67997 0.35% 151 17359885 88.96% 19513907 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=12 prefix-density=0.73 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.24 sequence-density-rank=20 fanout-score=7.72 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=3.0 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=1.15 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=22 prefix-density=1.16 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=13.94 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12690195 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:31:53 Started mapping on | Feb 10 23:31:54 Finished on | Feb 10 23:34:00 Mapping speed, Million of reads per hour | 557.54 Number of input reads | 19513907 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18331212 Uniquely mapped reads % | 93.94% Average mapped length | 295.81 Number of splices: Total | 18214269 Number of splices: Annotated (sjdb) | 17862843 Number of splices: GT/AG | 17843478 Number of splices: GC/AG | 306978 Number of splices: AT/AC | 10630 Number of splices: Non-canonical | 53183 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438053 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 268785 % of reads mapped to too many loci | 1.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 744642 744642 744642 N_multimapping 438053 438053 438053 N_noFeature 723087 18087904 794221 N_ambiguous 286950 1223 114097 UnstrandedReadsAssigned:17321175 PositiveStrandReadsAssigned:242085 NegativeStrandReadsAssigned:17422894 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690195 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690195-trimmed-pair1.fastq SRR12690195-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,513,907 reads, 17,514,129 reads pseudoaligned [quant] estimated average fragment length: 246.177 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR12690195.ke.tsv 34699 SRR12690195.se.tsv 87100 total ==> SRR12690195.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.82 397 11.2368 Potri.005G024800.1.v4.1 1035 789.823 145 9.21206 Potri.004G059700.1.v4.1 961 715.885 17 1.19158 Potri.007G009000.2.v4.1 1416 1170.82 0 0 Potri.003G141000.2.v4.1 2943 2697.82 992.539 18.4609 Potri.016G087400.1.v4.1 270 83.7882 577 345.55 Potri.015G069301.1.v4.1 564 328.8 0 0 Potri.010G195200.1.v4.1 1773 1527.82 11 0.361275 Potri.012G127500.1.v4.1 977 731.85 217 14.8784 ==> SRR12690195.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 480 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 296 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1 SRR12690195 completed mapping pipeline successfully