Starting /dee2/code/volunteer_pipeline.sh SRR12690196 current disk space = 3057474170880 free memory = 1083233936 SRR12690196 SRAfilesize a306f8c70f7731fa08166b7173fd4381 SRR12690196.sra SRR12690196.sra file validated SRR12690196 is paired end SRR12690196 is conventional basespace SRR12690196 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690196_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.549 37.0 37.0 37.0 37.0 37.0 2 36.31575 37.0 37.0 37.0 37.0 37.0 3 36.5755 37.0 37.0 37.0 37.0 37.0 4 36.5985 37.0 37.0 37.0 37.0 37.0 5 36.624 37.0 37.0 37.0 37.0 37.0 6 36.6245 37.0 37.0 37.0 37.0 37.0 7 36.564 37.0 37.0 37.0 37.0 37.0 8 36.5775 37.0 37.0 37.0 37.0 37.0 9 36.604 37.0 37.0 37.0 37.0 37.0 10-14 36.590700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.590599999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5707 37.0 37.0 37.0 37.0 37.0 25-29 36.49499999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.4696 37.0 37.0 37.0 37.0 37.0 35-39 36.479600000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.48179999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.4204 37.0 37.0 37.0 37.0 37.0 50-54 36.4019 37.0 37.0 37.0 37.0 37.0 55-59 36.401599999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.40500000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2918 37.0 37.0 37.0 37.0 37.0 70-74 36.356700000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.3183 37.0 37.0 37.0 37.0 37.0 80-84 36.2401 37.0 37.0 37.0 37.0 37.0 85-89 36.2597 37.0 37.0 37.0 37.0 37.0 90-94 36.2802 37.0 37.0 37.0 37.0 37.0 95-99 36.147999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1418 37.0 37.0 37.0 37.0 37.0 105-109 36.1505 37.0 37.0 37.0 37.0 37.0 110-114 36.08069999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0732 37.0 37.0 37.0 37.0 37.0 120-124 35.995 37.0 37.0 37.0 37.0 37.0 125-129 35.9365 37.0 37.0 37.0 37.0 37.0 130-134 35.905100000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.9568 37.0 37.0 37.0 37.0 37.0 140-144 35.7057 37.0 37.0 37.0 37.0 37.0 145-149 35.7574 37.0 37.0 37.0 37.0 37.0 150-151 35.5715 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 1.0 25 1.0 26 3.0 27 7.0 28 12.0 29 12.0 30 35.0 31 22.0 32 54.0 33 78.0 34 102.0 35 345.0 36 2968.0 37 357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.375 12.075 6.2 36.35 2 20.71733132681214 12.791572610985705 33.533985452721346 32.95711060948081 3 17.75 16.075 27.425 38.75 4 20.95 22.575 25.35 31.125000000000004 5 23.549999999999997 29.4 24.15 22.900000000000002 6 21.75 33.125 23.3 21.825 7 16.650000000000002 26.85 39.1 17.4 8 16.825000000000003 26.25 32.7 24.224999999999998 9 18.025 22.925 35.5 23.549999999999997 10-14 19.96 29.325000000000003 27.839999999999996 22.875 15-19 20.29 28.43 27.67 23.61 20-24 20.415 27.650000000000002 27.810000000000002 24.125 25-29 19.98 27.515 28.505000000000003 24.0 30-34 20.294999999999998 27.525 27.700000000000003 24.48 35-39 20.544999999999998 27.925 27.765 23.765 40-44 20.435 27.38 27.800000000000004 24.385 45-49 20.22 27.965 27.295 24.52 50-54 20.62 28.165000000000003 27.189999999999998 24.025 55-59 19.865 28.599999999999998 27.02 24.515 60-64 20.28 28.125 27.525 24.07 65-69 21.185000000000002 27.71 27.615000000000002 23.49 70-74 21.0 27.35 27.305 24.345 75-79 21.105 27.395000000000003 27.765 23.735 80-84 20.544999999999998 27.779999999999998 27.6 24.075 85-89 20.44 27.74 27.235 24.585 90-94 20.645 27.965 27.375 24.015 95-99 20.46 27.625 27.765 24.15 100-104 20.31 28.599999999999998 27.065 24.025 105-109 20.76 27.765 27.77 23.705000000000002 110-114 20.45 28.125 27.61 23.815 115-119 21.75 27.49 27.689999999999998 23.07 120-124 21.095 27.425 27.76 23.72 125-129 21.654999999999998 27.875 26.979999999999997 23.49 130-134 21.475 27.944999999999997 27.01 23.57 135-139 21.825 27.779999999999998 26.484999999999996 23.91 140-144 21.5 27.785 26.840000000000003 23.875 145-149 21.425 27.955000000000002 27.165 23.455000000000002 150-151 21.525 27.750000000000004 26.387500000000003 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.5 25 3.5 26 3.5 27 4.0 28 6.5 29 8.0 30 14.5 31 19.5 32 23.0 33 30.5 34 46.5 35 68.0 36 75.0 37 87.5 38 104.5 39 135.5 40 182.5 41 196.0 42 223.5 43 258.0 44 265.5 45 272.5 46 251.5 47 244.5 48 249.0 49 230.0 50 195.5 51 158.5 52 129.0 53 105.0 54 87.5 55 70.0 56 69.0 57 52.5 58 32.5 59 28.0 60 20.5 61 13.0 62 8.0 63 6.0 64 4.5 65 4.5 66 2.5 67 0.5 68 1.5 69 2.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.84619580038178 84.2 2 7.390237251158986 13.55 3 0.654485955822198 1.7999999999999998 4 0.08181074447777476 0.3 5 0.0 0.0 6 0.02727024815925825 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.1 0.0 0.0 0.0 0.0 116-117 2.4000000000000004 0.0 0.0 0.0 0.0 118-119 2.65 0.0 0.0 0.0 0.0 120-121 3.025 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.7249999999999996 0.0 0.0 0.0 0.0 126-127 3.8625 0.0 0.0 0.0 0.0 128-129 4.1375 0.0 0.0 0.0 0.0 130-131 4.8125 0.0 0.0 0.0 0.0 132-133 5.3375 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.2125 0.0 0.0 0.0 0.0 138-139 6.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690196 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690196_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.162 37.0 37.0 37.0 37.0 37.0 2 35.9315 37.0 37.0 37.0 37.0 37.0 3 35.947 37.0 37.0 37.0 37.0 37.0 4 36.0735 37.0 37.0 37.0 37.0 37.0 5 36.2005 37.0 37.0 37.0 37.0 37.0 6 36.095 37.0 37.0 37.0 37.0 37.0 7 36.028 37.0 37.0 37.0 37.0 37.0 8 36.2185 37.0 37.0 37.0 37.0 37.0 9 36.2095 37.0 37.0 37.0 37.0 37.0 10-14 36.1198 37.0 37.0 37.0 37.0 37.0 15-19 36.091 37.0 37.0 37.0 37.0 37.0 20-24 36.1757 37.0 37.0 37.0 37.0 37.0 25-29 36.0579 37.0 37.0 37.0 37.0 37.0 30-34 36.0163 37.0 37.0 37.0 37.0 37.0 35-39 35.981899999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.9296 37.0 37.0 37.0 37.0 37.0 45-49 35.9464 37.0 37.0 37.0 37.0 37.0 50-54 35.9193 37.0 37.0 37.0 37.0 37.0 55-59 35.9234 37.0 37.0 37.0 37.0 37.0 60-64 35.828900000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.866 37.0 37.0 37.0 37.0 37.0 70-74 35.740899999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.8003 37.0 37.0 37.0 37.0 37.0 80-84 35.8097 37.0 37.0 37.0 37.0 37.0 85-89 35.6999 37.0 37.0 37.0 37.0 37.0 90-94 35.68579999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.729299999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.7264 37.0 37.0 37.0 37.0 37.0 105-109 35.7511 37.0 37.0 37.0 37.0 37.0 110-114 35.6292 37.0 37.0 37.0 37.0 37.0 115-119 35.5741 37.0 37.0 37.0 37.0 37.0 120-124 35.509 37.0 37.0 37.0 37.0 37.0 125-129 35.4683 37.0 37.0 37.0 37.0 37.0 130-134 35.396100000000004 37.0 37.0 37.0 34.6 37.0 135-139 35.333200000000005 37.0 37.0 37.0 34.6 37.0 140-144 35.2889 37.0 37.0 37.0 32.2 37.0 145-149 35.15689999999999 37.0 37.0 37.0 29.8 37.0 150-151 34.7005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 1.0 15 1.0 16 4.0 17 1.0 18 0.0 19 2.0 20 2.0 21 3.0 22 3.0 23 7.0 24 7.0 25 5.0 26 9.0 27 17.0 28 17.0 29 20.0 30 42.0 31 49.0 32 73.0 33 104.0 34 231.0 35 576.0 36 2591.0 37 228.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.625 24.4 9.525 24.45 2 29.299999999999997 27.175 27.875 15.65 3 20.549999999999997 30.25 30.975 18.224999999999998 4 23.925 33.650000000000006 22.575 19.85 5 25.6 34.975 20.95 18.475 6 22.25 39.074999999999996 22.425 16.25 7 21.099999999999998 23.25 36.95 18.7 8 20.575 26.650000000000002 28.000000000000004 24.775 9 22.400000000000002 25.2 29.75 22.650000000000002 10-14 23.305 29.404999999999998 26.22 21.07 15-19 22.925 28.52 27.165 21.39 20-24 23.43 28.365000000000002 27.095000000000002 21.11 25-29 23.035 28.449999999999996 27.045 21.47 30-34 22.45 28.65 27.35 21.55 35-39 22.865 27.815 27.71 21.61 40-44 23.585 27.83 27.095000000000002 21.490000000000002 45-49 22.564999999999998 28.585 27.675 21.175 50-54 23.785 28.605000000000004 26.525 21.085 55-59 23.255 27.725 27.79 21.23 60-64 23.44 27.685 27.134999999999998 21.740000000000002 65-69 23.064999999999998 28.015 26.950000000000003 21.97 70-74 23.544999999999998 28.155 27.255000000000003 21.044999999999998 75-79 23.585 27.389999999999997 27.250000000000004 21.775 80-84 23.06 28.335 26.919999999999998 21.685 85-89 23.52 27.825 26.8 21.855 90-94 23.615 28.365000000000002 27.63 20.39 95-99 23.65 28.02 27.01 21.32 100-104 23.875 27.765 26.995 21.365000000000002 105-109 23.68 26.825 28.17 21.325 110-114 23.535 28.15 27.694999999999997 20.62 115-119 25.130000000000003 28.139999999999997 26.415 20.315 120-124 24.645 28.625 26.395000000000003 20.335 125-129 24.85 27.715 26.735 20.7 130-134 24.565 27.71 27.1 20.625 135-139 24.610000000000003 27.91 26.674999999999997 20.805 140-144 25.415 28.075 26.305 20.205000000000002 145-149 25.16 27.955000000000002 26.545 20.34 150-151 25.112499999999997 27.187499999999996 27.725 19.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 1.0 13 1.0 14 1.5 15 2.0 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 2.0 22 2.0 23 1.5 24 2.0 25 3.0 26 3.0 27 3.0 28 4.5 29 9.5 30 11.5 31 12.5 32 17.5 33 28.0 34 38.0 35 49.0 36 73.0 37 107.5 38 137.0 39 150.0 40 173.0 41 237.5 42 276.0 43 261.5 44 269.5 45 256.5 46 250.0 47 263.5 48 236.5 49 210.5 50 171.5 51 141.0 52 119.5 53 92.5 54 84.5 55 71.5 56 49.5 57 33.0 58 28.5 59 27.0 60 21.0 61 15.0 62 11.5 63 7.0 64 4.0 65 3.0 66 1.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 2.0 77 2.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 1.0 90 1.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 92.01312910284464 84.1 2 7.084245076586433 12.950000000000001 3 0.6564551422319475 1.7999999999999998 4 0.13676148796498905 0.5 5 0.05470459518599562 0.25 6 0.02735229759299781 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02735229759299781 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.7249999999999996 0.0 0.0 0.0 0.0 126-127 3.8625 0.0 0.0 0.0 0.0 128-129 4.1125 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.2875 0.0 0.0 0.0 0.0 134-135 5.762499999999999 0.0 0.0 0.0 0.0 136-137 6.2125 0.0 0.0 0.0 0.0 138-139 6.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919206 spots for SRR12690196.sra Written 919206 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra Read 919202 spots for SRR12690196.sra Written 919202 spots for SRR12690196.sra SRR ids: ['SRR12690196.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mih7v1hb SRR12690196.sra spots: 18384044 blocks: [[1, 919202], [919203, 1838404], [1838405, 2757606], [2757607, 3676808], [3676809, 4596010], [4596011, 5515212], [5515213, 6434414], [6434415, 7353616], [7353617, 8272818], [8272819, 9192020], [9192021, 10111222], [10111223, 11030424], [11030425, 11949626], [11949627, 12868828], [12868829, 13788030], [13788031, 14707232], [14707233, 15626434], [15626435, 16545636], [16545637, 17464838], [17464839, 18384044]] SRR12690196 file size 6226002 SRR12690196 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690196 SRR12690196_1.fastq SRR12690196_2.fastq Input file: SRR12690196_1.fastq Paired file: SRR12690196_2.fastq trimmed: SRR12690196-trimmed-pair1.fastq, SRR12690196-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:36:19 2025 >> started Mon Feb 10 22:36:49 2025 >> done (30.202s) 18384044 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 8957 ( 0.05%) empty read pairs filtered out after trimming by size control 18375055 (99.95%) read pairs available; of these: 1822153 ( 9.92%) trimmed read pairs available after processing 16552902 (90.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 8 0.00% 21 12 0.00% 22 13 0.00% 23 18 0.00% 24 15 0.00% 25 18 0.00% 26 19 0.00% 27 18 0.00% 28 16 0.00% 29 15 0.00% 30 22 0.00% 31 24 0.00% 32 32 0.00% 33 33 0.00% 34 33 0.00% 35 25 0.00% 36 18 0.00% 37 29 0.00% 38 26 0.00% 39 40 0.00% 40 20 0.00% 41 34 0.00% 42 31 0.00% 43 31 0.00% 44 34 0.00% 45 36 0.00% 46 37 0.00% 47 51 0.00% 48 63 0.00% 49 55 0.00% 50 77 0.00% 51 72 0.00% 52 82 0.00% 53 98 0.00% 54 101 0.00% 55 104 0.00% 56 96 0.00% 57 139 0.00% 58 174 0.00% 59 178 0.00% 60 232 0.00% 61 230 0.00% 62 263 0.00% 63 325 0.00% 64 331 0.00% 65 313 0.00% 66 383 0.00% 67 411 0.00% 68 444 0.00% 69 570 0.00% 70 656 0.00% 71 736 0.00% 72 890 0.00% 73 959 0.01% 74 1091 0.01% 75 1148 0.01% 76 1321 0.01% 77 1477 0.01% 78 1605 0.01% 79 1766 0.01% 80 2140 0.01% 81 2327 0.01% 82 2574 0.01% 83 2906 0.02% 84 3228 0.02% 85 3492 0.02% 86 3784 0.02% 87 4199 0.02% 88 4574 0.02% 89 4978 0.03% 90 5305 0.03% 91 5820 0.03% 92 6387 0.03% 93 7126 0.04% 94 7741 0.04% 95 8099 0.04% 96 8680 0.05% 97 9444 0.05% 98 9809 0.05% 99 10620 0.06% 100 11147 0.06% 101 11864 0.06% 102 12642 0.07% 103 13218 0.07% 104 14008 0.08% 105 14859 0.08% 106 15376 0.08% 107 15911 0.09% 108 16980 0.09% 109 17765 0.10% 110 18600 0.10% 111 18951 0.10% 112 20273 0.11% 113 20928 0.11% 114 21934 0.12% 115 23046 0.13% 116 23802 0.13% 117 24943 0.14% 118 25518 0.14% 119 26135 0.14% 120 26914 0.15% 121 28328 0.15% 122 29174 0.16% 123 30292 0.16% 124 31854 0.17% 125 32073 0.17% 126 33548 0.18% 127 34876 0.19% 128 34998 0.19% 129 36609 0.20% 130 37199 0.20% 131 37967 0.21% 132 39236 0.21% 133 40974 0.22% 134 41912 0.23% 135 42697 0.23% 136 44072 0.24% 137 44756 0.24% 138 45315 0.25% 139 46948 0.26% 140 47611 0.26% 141 48852 0.27% 142 49871 0.27% 143 50641 0.28% 144 52452 0.29% 145 53287 0.29% 146 55103 0.30% 147 54952 0.30% 148 55984 0.30% 149 56696 0.31% 150 58724 0.32% 151 16552902 90.08% 18375055 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=17 prefix-density=0.55 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=23.73 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.3 sequence=GAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=25 prefix-density=0.45 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=45.47 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12690196 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:37:35 Started mapping on | Feb 10 22:37:35 Finished on | Feb 10 22:39:37 Mapping speed, Million of reads per hour | 542.21 Number of input reads | 18375055 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17270666 Uniquely mapped reads % | 93.99% Average mapped length | 296.28 Number of splices: Total | 17475957 Number of splices: Annotated (sjdb) | 17078217 Number of splices: GT/AG | 17120240 Number of splices: GC/AG | 282030 Number of splices: AT/AC | 12717 Number of splices: Non-canonical | 60970 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 439552 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 93504 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.93% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 664837 664837 664837 N_multimapping 439552 439552 439552 N_noFeature 607676 17033892 667398 N_ambiguous 298171 1136 120407 UnstrandedReadsAssigned:16364819 PositiveStrandReadsAssigned:235638 NegativeStrandReadsAssigned:16482861 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690196 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690196-trimmed-pair1.fastq SRR12690196-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,375,055 reads, 16,489,732 reads pseudoaligned [quant] estimated average fragment length: 255.445 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR12690196.ke.tsv 34699 SRR12690196.se.tsv 87100 total ==> SRR12690196.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.56 646 18.0958 Potri.005G024800.1.v4.1 1035 780.555 427 27.0245 Potri.004G059700.1.v4.1 961 706.712 12 0.838828 Potri.007G009000.2.v4.1 1416 1161.56 0 0 Potri.003G141000.2.v4.1 2943 2688.56 877 16.1144 Potri.016G087400.1.v4.1 270 82.4633 712.63 426.911 Potri.015G069301.1.v4.1 564 322.697 0 0 Potri.010G195200.1.v4.1 1773 1518.56 35 1.1386 Potri.012G127500.1.v4.1 977 722.656 112 7.65633 ==> SRR12690196.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 70 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 172 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12690196 completed mapping pipeline successfully