Starting /dee2/code/volunteer_pipeline.sh SRR12690197 current disk space = 3057495404544 free memory = 1574439660 SRR12690197 SRAfilesize aa47d3aacba671726ff6d1d21965f3a5 SRR12690197.sra SRR12690197.sra file validated SRR12690197 is paired end SRR12690197 is conventional basespace SRR12690197 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690197_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.628 37.0 37.0 37.0 37.0 37.0 2 36.35225 37.0 37.0 37.0 37.0 37.0 3 36.6555 37.0 37.0 37.0 37.0 37.0 4 36.6085 37.0 37.0 37.0 37.0 37.0 5 36.6305 37.0 37.0 37.0 37.0 37.0 6 36.6095 37.0 37.0 37.0 37.0 37.0 7 36.5295 37.0 37.0 37.0 37.0 37.0 8 36.549 37.0 37.0 37.0 37.0 37.0 9 36.618 37.0 37.0 37.0 37.0 37.0 10-14 36.5733 37.0 37.0 37.0 37.0 37.0 15-19 36.631299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.589800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.543899999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4917 37.0 37.0 37.0 37.0 37.0 35-39 36.5093 37.0 37.0 37.0 37.0 37.0 40-44 36.482099999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.449799999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4298 37.0 37.0 37.0 37.0 37.0 55-59 36.3909 37.0 37.0 37.0 37.0 37.0 60-64 36.4154 37.0 37.0 37.0 37.0 37.0 65-69 36.3778 37.0 37.0 37.0 37.0 37.0 70-74 36.379 37.0 37.0 37.0 37.0 37.0 75-79 36.33710000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.282900000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.231 37.0 37.0 37.0 37.0 37.0 90-94 36.2477 37.0 37.0 37.0 37.0 37.0 95-99 36.1694 37.0 37.0 37.0 37.0 37.0 100-104 36.2068 37.0 37.0 37.0 37.0 37.0 105-109 36.1577 37.0 37.0 37.0 37.0 37.0 110-114 36.10620000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.1243 37.0 37.0 37.0 37.0 37.0 120-124 36.05200000000001 37.0 37.0 37.0 37.0 37.0 125-129 36.066500000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.03959999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.9781 37.0 37.0 37.0 37.0 37.0 140-144 35.7846 37.0 37.0 37.0 37.0 37.0 145-149 35.804 37.0 37.0 37.0 37.0 37.0 150-151 35.5115 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 1.0 25 2.0 26 6.0 27 5.0 28 7.0 29 11.0 30 26.0 31 43.0 32 44.0 33 67.0 34 118.0 35 278.0 36 3010.0 37 379.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.475 12.85 7.55 39.125 2 20.246169304194925 12.710374277819644 36.222054760110524 30.821401657874908 3 17.65 16.025 27.525 38.800000000000004 4 21.25 24.425 24.975 29.349999999999998 5 23.575 30.4 23.875 22.15 6 21.8 33.675 22.8 21.725 7 15.049999999999999 28.799999999999997 39.300000000000004 16.85 8 17.7 25.474999999999998 32.425 24.4 9 18.4 24.85 33.675 23.075000000000003 10-14 19.215 29.86 28.275 22.650000000000002 15-19 20.04 27.965 27.79 24.205 20-24 20.04 28.09 28.17 23.7 25-29 19.580000000000002 28.435 27.96 24.025 30-34 20.125 28.58 27.450000000000003 23.845 35-39 20.195 28.494999999999997 27.88 23.43 40-44 20.080000000000002 28.645 27.55 23.724999999999998 45-49 20.36 28.449999999999996 27.16 24.03 50-54 20.150000000000002 28.315 28.02 23.515 55-59 19.97 28.335 28.084999999999997 23.61 60-64 21.05 27.935 27.67 23.345 65-69 19.945 28.305000000000003 27.855 23.895 70-74 20.41 28.139999999999997 27.834999999999997 23.615 75-79 20.7 27.485 27.560000000000002 24.255 80-84 20.47 28.82 27.169999999999998 23.54 85-89 20.885 28.465 27.145000000000003 23.505000000000003 90-94 20.735 28.12 27.865000000000002 23.28 95-99 20.845 28.060000000000002 27.565 23.53 100-104 20.345 28.515 27.229999999999997 23.91 105-109 20.945 28.299999999999997 27.255000000000003 23.5 110-114 20.995 28.494999999999997 27.755000000000003 22.755 115-119 20.990000000000002 28.815 27.060000000000002 23.135 120-124 21.240000000000002 28.025 27.48 23.255 125-129 21.475 27.975 27.62 22.93 130-134 21.035 27.865000000000002 27.435 23.665 135-139 21.735 28.375 26.919999999999998 22.97 140-144 21.8 28.294999999999998 26.57 23.335 145-149 21.55 27.944999999999997 26.195 24.310000000000002 150-151 21.2 28.4375 26.924999999999997 23.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 1.0 23 0.0 24 0.5 25 2.0 26 4.5 27 8.0 28 8.5 29 6.0 30 11.0 31 23.5 32 32.0 33 40.5 34 50.0 35 70.0 36 80.0 37 93.0 38 138.5 39 170.5 40 195.0 41 207.5 42 221.5 43 246.5 44 259.0 45 258.0 46 265.5 47 256.5 48 243.0 49 228.0 50 178.0 51 147.0 52 124.5 53 104.5 54 82.5 55 56.5 56 45.5 57 37.0 58 26.0 59 24.0 60 19.0 61 8.5 62 5.5 63 4.0 64 3.5 65 2.5 66 2.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.06945975744212 82.6 2 7.772877618522601 14.099999999999998 3 1.0198456449834619 2.775 4 0.11025358324145534 0.4 5 0.027563395810363836 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGAGTAGCTGTTGCCGGTTCGATCGCTCACTCCTACTGAAGATTGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.225 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.8625 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.825 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.387499999999999 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.762499999999999 0.0 0.0 0.0 0.0 132-133 6.4625 0.0 0.0 0.0 0.0 134-135 7.0 0.0 0.0 0.0 0.0 136-137 7.425 0.0 0.0 0.0 0.0 138-139 8.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTAG 10 0.006830828 145.0 5 TGTTAGC 10 0.006830828 145.0 6 >>END_MODULE SRR12690197 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690197_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0965 37.0 37.0 37.0 37.0 37.0 2 35.8625 37.0 37.0 37.0 37.0 37.0 3 35.8345 37.0 37.0 37.0 37.0 37.0 4 35.974 37.0 37.0 37.0 37.0 37.0 5 36.1755 37.0 37.0 37.0 37.0 37.0 6 35.9625 37.0 37.0 37.0 37.0 37.0 7 36.174 37.0 37.0 37.0 37.0 37.0 8 36.1555 37.0 37.0 37.0 37.0 37.0 9 36.2335 37.0 37.0 37.0 37.0 37.0 10-14 36.1546 37.0 37.0 37.0 37.0 37.0 15-19 36.147999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.117399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.035399999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.9643 37.0 37.0 37.0 37.0 37.0 35-39 35.976699999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.9664 37.0 37.0 37.0 37.0 37.0 45-49 35.9892 37.0 37.0 37.0 37.0 37.0 50-54 35.934999999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.876999999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.81179999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.7673 37.0 37.0 37.0 37.0 37.0 70-74 35.701299999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.7529 37.0 37.0 37.0 37.0 37.0 80-84 35.716300000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.653299999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.649300000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.6311 37.0 37.0 37.0 37.0 37.0 100-104 35.6761 37.0 37.0 37.0 37.0 37.0 105-109 35.6667 37.0 37.0 37.0 37.0 37.0 110-114 35.5193 37.0 37.0 37.0 37.0 37.0 115-119 35.463300000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.440999999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.3877 37.0 37.0 37.0 37.0 37.0 130-134 35.2388 37.0 37.0 37.0 29.8 37.0 135-139 35.170100000000005 37.0 37.0 37.0 29.8 37.0 140-144 35.141999999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.978 37.0 37.0 37.0 27.4 37.0 150-151 34.50675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 3.0 15 0.0 16 2.0 17 0.0 18 3.0 19 0.0 20 3.0 21 2.0 22 7.0 23 6.0 24 5.0 25 8.0 26 10.0 27 13.0 28 15.0 29 25.0 30 39.0 31 30.0 32 71.0 33 127.0 34 235.0 35 731.0 36 2478.0 37 180.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.4 23.7 11.575000000000001 28.325 2 26.900000000000002 28.299999999999997 27.975 16.825000000000003 3 21.275 27.450000000000003 31.900000000000002 19.375 4 21.425 35.25 24.15 19.175 5 24.2 36.65 21.725 17.424999999999997 6 19.875 39.925 21.975 18.224999999999998 7 20.125 23.0 38.025 18.85 8 21.2 27.05 28.249999999999996 23.5 9 22.0 25.0 29.7 23.3 10-14 23.335 30.5 25.180000000000003 20.985 15-19 23.75 27.92 27.01 21.32 20-24 23.189999999999998 28.475 27.375 20.96 25-29 23.155 28.775000000000002 27.125 20.945 30-34 22.675 28.68 27.41 21.235 35-39 23.244999999999997 27.87 27.675 21.21 40-44 22.95 27.955000000000002 27.58 21.515 45-49 23.095 27.200000000000003 27.55 22.155 50-54 22.689999999999998 27.985 27.205000000000002 22.12 55-59 23.48 28.015 27.245 21.26 60-64 23.474999999999998 27.715 28.26 20.549999999999997 65-69 23.150000000000002 27.27 28.12 21.46 70-74 23.7 27.08 27.595 21.625 75-79 22.575 28.435 27.61 21.38 80-84 23.235 28.15 27.625 20.990000000000002 85-89 23.565 28.405 27.02 21.01 90-94 23.265 28.04 27.3 21.395 95-99 23.765 27.99 27.57 20.674999999999997 100-104 23.855 28.055000000000003 27.315 20.775 105-109 23.375 28.175 27.38 21.07 110-114 23.625 27.85 27.37 21.154999999999998 115-119 23.625 28.12 26.889999999999997 21.365000000000002 120-124 24.63 28.785 26.63 19.955000000000002 125-129 24.82 27.185 27.345000000000002 20.65 130-134 25.069999999999997 27.11 27.305 20.515 135-139 24.86 28.09 26.905 20.145 140-144 25.740000000000002 28.13 26.685 19.445 145-149 25.855 27.500000000000004 26.919999999999998 19.725 150-151 26.1625 27.425 26.950000000000003 19.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 1.5 24 2.0 25 2.5 26 3.5 27 6.0 28 4.5 29 8.0 30 16.0 31 19.5 32 23.0 33 34.5 34 56.0 35 67.0 36 82.0 37 108.0 38 125.0 39 147.0 40 187.5 41 238.0 42 243.0 43 256.0 44 274.5 45 268.0 46 269.0 47 267.0 48 254.5 49 220.5 50 183.0 51 137.5 52 93.0 53 69.0 54 64.5 55 55.0 56 44.5 57 37.0 58 27.0 59 24.0 60 18.5 61 12.5 62 8.5 63 4.5 64 4.0 65 2.5 66 2.0 67 1.5 68 0.5 69 1.0 70 1.5 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 1.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 1.0 93 1.0 94 0.5 95 0.5 96 1.0 97 1.5 98 0.5 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.41678129298487 83.075 2 7.455295735900963 13.55 3 0.9078404401650619 2.475 4 0.16506189821182946 0.6 5 0.027510316368638238 0.125 6 0.0 0.0 7 0.027510316368638238 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GAGAAACGACAAAAAGAATCCATGGACCTTATCATTTCAAGCCACTCCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.825 0.0 0.0 0.0 0.0 122-123 4.125 0.0 0.0 0.0 0.0 124-125 4.35 0.0 0.0 0.0 0.0 126-127 4.6875 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.737500000000001 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 6.975 0.0 0.0 0.0 0.0 136-137 7.4375 0.0 0.0 0.0 0.0 138-139 8.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033216 spots for SRR12690197.sra Written 1033216 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra Read 1033209 spots for SRR12690197.sra Written 1033209 spots for SRR12690197.sra SRR ids: ['SRR12690197.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ajo9jv1u SRR12690197.sra spots: 20664187 blocks: [[1, 1033209], [1033210, 2066418], [2066419, 3099627], [3099628, 4132836], [4132837, 5166045], [5166046, 6199254], [6199255, 7232463], [7232464, 8265672], [8265673, 9298881], [9298882, 10332090], [10332091, 11365299], [11365300, 12398508], [12398509, 13431717], [13431718, 14464926], [14464927, 15498135], [15498136, 16531344], [16531345, 17564553], [17564554, 18597762], [18597763, 19630971], [19630972, 20664187]] SRR12690197 file size 7000894 SRR12690197 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690197 SRR12690197_1.fastq SRR12690197_2.fastq Input file: SRR12690197_1.fastq Paired file: SRR12690197_2.fastq trimmed: SRR12690197-trimmed-pair1.fastq, SRR12690197-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:42:50 2025 >> started Mon Feb 10 23:43:23 2025 >> done (32.300s) 20664187 read pairs processed; of these: 50 ( 0.00%) short read pairs filtered out after trimming by size control 10710 ( 0.05%) empty read pairs filtered out after trimming by size control 20653427 (99.95%) read pairs available; of these: 2390598 (11.57%) trimmed read pairs available after processing 18262829 (88.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 3 0.00% 21 5 0.00% 22 12 0.00% 23 14 0.00% 24 21 0.00% 25 10 0.00% 26 12 0.00% 27 18 0.00% 28 21 0.00% 29 30 0.00% 30 24 0.00% 31 29 0.00% 32 29 0.00% 33 30 0.00% 34 27 0.00% 35 30 0.00% 36 29 0.00% 37 40 0.00% 38 39 0.00% 39 39 0.00% 40 37 0.00% 41 46 0.00% 42 44 0.00% 43 58 0.00% 44 35 0.00% 45 71 0.00% 46 57 0.00% 47 53 0.00% 48 68 0.00% 49 77 0.00% 50 118 0.00% 51 133 0.00% 52 142 0.00% 53 129 0.00% 54 139 0.00% 55 141 0.00% 56 154 0.00% 57 181 0.00% 58 233 0.00% 59 258 0.00% 60 304 0.00% 61 326 0.00% 62 379 0.00% 63 390 0.00% 64 477 0.00% 65 562 0.00% 66 539 0.00% 67 625 0.00% 68 672 0.00% 69 850 0.00% 70 975 0.00% 71 1028 0.00% 72 1203 0.01% 73 1333 0.01% 74 1511 0.01% 75 1658 0.01% 76 1922 0.01% 77 2013 0.01% 78 2353 0.01% 79 2551 0.01% 80 2968 0.01% 81 3182 0.02% 82 3761 0.02% 83 4114 0.02% 84 4546 0.02% 85 4993 0.02% 86 5572 0.03% 87 5936 0.03% 88 6498 0.03% 89 6873 0.03% 90 7487 0.04% 91 8245 0.04% 92 8838 0.04% 93 9788 0.05% 94 10492 0.05% 95 11418 0.06% 96 12006 0.06% 97 12563 0.06% 98 13382 0.06% 99 14092 0.07% 100 15003 0.07% 101 15718 0.08% 102 16623 0.08% 103 17704 0.09% 104 18719 0.09% 105 20054 0.10% 106 21062 0.10% 107 21446 0.10% 108 22890 0.11% 109 23456 0.11% 110 24585 0.12% 111 25717 0.12% 112 26660 0.13% 113 27507 0.13% 114 28862 0.14% 115 30356 0.15% 116 31552 0.15% 117 32914 0.16% 118 33876 0.16% 119 34685 0.17% 120 35899 0.17% 121 36993 0.18% 122 38686 0.19% 123 39686 0.19% 124 41701 0.20% 125 42326 0.20% 126 44253 0.21% 127 45663 0.22% 128 46529 0.23% 129 47595 0.23% 130 49104 0.24% 131 50017 0.24% 132 51472 0.25% 133 53553 0.26% 134 54078 0.26% 135 55367 0.27% 136 57336 0.28% 137 58202 0.28% 138 59319 0.29% 139 61068 0.30% 140 61683 0.30% 141 63206 0.31% 142 64968 0.31% 143 65487 0.32% 144 67581 0.33% 145 68376 0.33% 146 69665 0.34% 147 70331 0.34% 148 72419 0.35% 149 73094 0.35% 150 74484 0.36% 151 18262829 88.43% 20653427 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=11 prefix-density=0.66 prefix-fanout=2.4 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=27.62 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=TCACGAAGAACCAGAATATTAAATAAGCCAGGCAATATATAGTACAACACAGATTTTTTTAGATGCACATAATTAATGCCTACAATATCGTACTGTAAACACAAGCTCATAAGAAAGAAGAGACTGATCCAAGTCCGTCGACGGGAACTAGCTCAAACATGCTCGAGCACCCCTTTTATTCTAGCACTAGCTTATTATCATACTTCATAATCTGCTTCGATTCTTCACTTCACGCTTTTGCAATCTGTGGAAGGACTGATTTTGTAGGAGATGGATACACCACACTTTGAAGGGAGGCCAGCAGCCACGCCATAGTTGATGCCAGAGATCTTACCAGCCAAGGATTTCAAACAGTTGCAGACCCCTTGGCGGTCGGCGGTGGTCGTGGCTGCAGAATTAAGTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGGAGGTAGGTTATACATTGTGCCAAGCTGCTTGACACCTGGCCACATGAGATGGCAGCTTCTG criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.77 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=49.48 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.3 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12690197 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:44:09 Started mapping on | Feb 10 23:44:10 Finished on | Feb 10 23:46:12 Mapping speed, Million of reads per hour | 609.45 Number of input reads | 20653427 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19464775 Uniquely mapped reads % | 94.24% Average mapped length | 295.59 Number of splices: Total | 19002574 Number of splices: Annotated (sjdb) | 18608916 Number of splices: GT/AG | 18631602 Number of splices: GC/AG | 306873 Number of splices: AT/AC | 15143 Number of splices: Non-canonical | 48956 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 576277 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 128461 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.18% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 612375 612375 612375 N_multimapping 576277 576277 576277 N_noFeature 599252 19271522 665934 N_ambiguous 241944 1302 114489 UnstrandedReadsAssigned:18623579 PositiveStrandReadsAssigned:191951 NegativeStrandReadsAssigned:18684352 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690197 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690197-trimmed-pair1.fastq SRR12690197-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,653,427 reads, 18,893,220 reads pseudoaligned [quant] estimated average fragment length: 240.762 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,226 rounds 52401 SRR12690197.ke.tsv 34699 SRR12690197.se.tsv 87100 total ==> SRR12690197.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.24 413 12.0382 Potri.005G024800.1.v4.1 1035 795.238 99 6.45265 Potri.004G059700.1.v4.1 961 721.301 64 4.599 Potri.007G009000.2.v4.1 1416 1176.24 0 0 Potri.003G141000.2.v4.1 2943 2703.24 482 9.24193 Potri.016G087400.1.v4.1 270 84.5274 1197.05 734.033 Potri.015G069301.1.v4.1 564 331.353 0 0 Potri.010G195200.1.v4.1 1773 1533.24 12.41 0.419528 Potri.012G127500.1.v4.1 977 737.29 1972 138.634 ==> SRR12690197.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 34 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR12690197 completed mapping pipeline successfully