Starting /dee2/code/volunteer_pipeline.sh SRR12690198 current disk space = 3057602551808 free memory = 1152760576 SRR12690198 SRAfilesize d0f19646e9fe7c1d154021bbf0abc26e SRR12690198.sra SRR12690198.sra file validated SRR12690198 is paired end SRR12690198 is conventional basespace SRR12690198 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690198_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6295 37.0 37.0 37.0 37.0 37.0 2 36.31625 37.0 37.0 37.0 37.0 37.0 3 36.6625 37.0 37.0 37.0 37.0 37.0 4 36.638 37.0 37.0 37.0 37.0 37.0 5 36.6325 37.0 37.0 37.0 37.0 37.0 6 36.6735 37.0 37.0 37.0 37.0 37.0 7 36.5685 37.0 37.0 37.0 37.0 37.0 8 36.633 37.0 37.0 37.0 37.0 37.0 9 36.5665 37.0 37.0 37.0 37.0 37.0 10-14 36.6305 37.0 37.0 37.0 37.0 37.0 15-19 36.604499999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.5672 37.0 37.0 37.0 37.0 37.0 25-29 36.5416 37.0 37.0 37.0 37.0 37.0 30-34 36.5218 37.0 37.0 37.0 37.0 37.0 35-39 36.516099999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.484300000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.415200000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.417899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.328599999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.370099999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.3046 37.0 37.0 37.0 37.0 37.0 70-74 36.2923 37.0 37.0 37.0 37.0 37.0 75-79 36.3089 37.0 37.0 37.0 37.0 37.0 80-84 36.2654 37.0 37.0 37.0 37.0 37.0 85-89 36.3232 37.0 37.0 37.0 37.0 37.0 90-94 36.285799999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.253099999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.188900000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.168 37.0 37.0 37.0 37.0 37.0 110-114 36.162099999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1258 37.0 37.0 37.0 37.0 37.0 120-124 36.1046 37.0 37.0 37.0 37.0 37.0 125-129 36.0249 37.0 37.0 37.0 37.0 37.0 130-134 35.9946 37.0 37.0 37.0 37.0 37.0 135-139 35.981399999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.7725 37.0 37.0 37.0 37.0 37.0 145-149 35.7424 37.0 37.0 37.0 37.0 37.0 150-151 35.49825 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 2.0 25 3.0 26 6.0 27 5.0 28 11.0 29 14.0 30 26.0 31 31.0 32 59.0 33 67.0 34 100.0 35 291.0 36 3020.0 37 363.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.775 12.15 8.05 38.025 2 20.859512440311637 12.214124151796934 34.58155315405881 32.34481025383262 3 17.075000000000003 15.325 27.474999999999998 40.125 4 20.674999999999997 21.2 25.974999999999998 32.15 5 23.7 27.075 24.25 24.975 6 22.575 31.424999999999997 23.474999999999998 22.525000000000002 7 17.299999999999997 28.749999999999996 38.800000000000004 15.15 8 18.525 27.05 31.175000000000004 23.25 9 18.625 24.575 32.550000000000004 24.25 10-14 20.855 28.405 27.575 23.165 15-19 20.580000000000002 26.875 27.865000000000002 24.68 20-24 20.810000000000002 27.07 28.03 24.09 25-29 20.705000000000002 27.125 27.77 24.4 30-34 20.09 27.555000000000003 27.839999999999996 24.515 35-39 21.035 26.790000000000003 28.15 24.025 40-44 20.855 27.515 26.765 24.865000000000002 45-49 20.380000000000003 27.87 27.884999999999998 23.865 50-54 21.345 26.784999999999997 27.905 23.965 55-59 21.275 27.084999999999997 27.150000000000002 24.490000000000002 60-64 20.875 27.115000000000002 27.88 24.13 65-69 21.13 26.85 27.47 24.55 70-74 22.045 27.73 26.075 24.15 75-79 21.515 26.965 27.305 24.215 80-84 21.36 27.36 26.97 24.310000000000002 85-89 21.205 27.315 26.87 24.610000000000003 90-94 21.895 27.339999999999996 26.465 24.3 95-99 21.995 26.665 27.71 23.630000000000003 100-104 21.195 26.695 27.605 24.505 105-109 21.9 26.595000000000002 27.48 24.025 110-114 21.59 27.38 27.145000000000003 23.885 115-119 21.91 27.084999999999997 27.08 23.925 120-124 21.285 27.195000000000004 27.175 24.345 125-129 21.945 27.005000000000003 26.939999999999998 24.11 130-134 22.14 27.165 26.525 24.169999999999998 135-139 21.805 27.505000000000003 26.5 24.19 140-144 22.400000000000002 26.669999999999998 26.865 24.065 145-149 22.88 27.025 26.35 23.745 150-151 22.7125 27.075 25.424999999999997 24.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.5 25 2.0 26 2.5 27 2.0 28 6.5 29 8.5 30 10.5 31 13.5 32 17.0 33 29.0 34 39.5 35 45.0 36 55.0 37 69.0 38 97.5 39 131.5 40 153.0 41 182.0 42 215.0 43 219.0 44 214.0 45 245.5 46 255.0 47 265.0 48 278.0 49 250.5 50 225.5 51 193.5 52 158.5 53 129.5 54 107.5 55 92.0 56 76.5 57 54.5 58 38.5 59 31.5 60 22.0 61 13.0 62 7.0 63 6.5 64 7.5 65 5.0 66 3.0 67 3.5 68 1.5 69 0.0 70 0.5 71 1.5 72 2.5 73 2.5 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.2 #Duplication Level Percentage of deduplicated Percentage of total 1 90.79822616407982 81.89999999999999 2 7.87139689578714 14.2 3 1.02549889135255 2.775 4 0.2771618625277162 1.0 5 0.02771618625277162 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTGTGTTGCCTTCTGTGGCTTTAGGTGACCATATGTCATCAAAAATAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.025 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.025 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.75 0.0 0.0 0.0 0.0 124-125 4.1125 0.0 0.0 0.0 0.0 126-127 4.625 0.0 0.0 0.0 0.0 128-129 5.175000000000001 0.0 0.0 0.0 0.0 130-131 5.625 0.0 0.0 0.0 0.0 132-133 5.9375 0.0 0.0 0.0 0.0 134-135 6.475 0.0 0.0 0.0 0.0 136-137 7.1 0.0 0.0 0.0 0.0 138-139 7.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTCC 10 0.006830828 145.0 6 ATCTCTA 10 0.006830828 145.0 7 TCTCTAC 10 0.006830828 145.0 8 >>END_MODULE SRR12690198 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690198_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43 37.0 37.0 37.0 37.0 37.0 2 36.2605 37.0 37.0 37.0 37.0 37.0 3 36.3315 37.0 37.0 37.0 37.0 37.0 4 36.3335 37.0 37.0 37.0 37.0 37.0 5 36.357 37.0 37.0 37.0 37.0 37.0 6 36.4345 37.0 37.0 37.0 37.0 37.0 7 36.4155 37.0 37.0 37.0 37.0 37.0 8 36.413 37.0 37.0 37.0 37.0 37.0 9 36.4285 37.0 37.0 37.0 37.0 37.0 10-14 36.3608 37.0 37.0 37.0 37.0 37.0 15-19 36.377 37.0 37.0 37.0 37.0 37.0 20-24 36.322799999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.2583 37.0 37.0 37.0 37.0 37.0 30-34 36.210899999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.1485 37.0 37.0 37.0 37.0 37.0 40-44 36.1088 37.0 37.0 37.0 37.0 37.0 45-49 36.1099 37.0 37.0 37.0 37.0 37.0 50-54 36.1144 37.0 37.0 37.0 37.0 37.0 55-59 36.116499999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.0594 37.0 37.0 37.0 37.0 37.0 65-69 36.0724 37.0 37.0 37.0 37.0 37.0 70-74 35.981300000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0181 37.0 37.0 37.0 37.0 37.0 80-84 36.017700000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0752 37.0 37.0 37.0 37.0 37.0 90-94 35.913700000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.017 37.0 37.0 37.0 37.0 37.0 100-104 36.02460000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.9769 37.0 37.0 37.0 37.0 37.0 110-114 35.933899999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.8495 37.0 37.0 37.0 37.0 37.0 120-124 35.8039 37.0 37.0 37.0 37.0 37.0 125-129 35.7132 37.0 37.0 37.0 37.0 37.0 130-134 35.63290000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.593599999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.5926 37.0 37.0 37.0 37.0 37.0 145-149 35.358900000000006 37.0 37.0 37.0 34.6 37.0 150-151 35.0195 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 4.0 15 4.0 16 1.0 17 2.0 18 1.0 19 0.0 20 1.0 21 2.0 22 7.0 23 3.0 24 5.0 25 7.0 26 6.0 27 9.0 28 11.0 29 14.0 30 18.0 31 44.0 32 54.0 33 81.0 34 141.0 35 440.0 36 2814.0 37 325.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.724999999999994 25.1 11.075 26.1 2 27.250000000000004 29.475 26.224999999999998 17.05 3 21.0 29.799999999999997 29.325000000000003 19.875 4 23.075000000000003 36.875 23.0 17.05 5 25.75 35.675000000000004 21.925 16.650000000000002 6 22.425 37.65 22.425 17.5 7 21.85 23.5 34.925 19.725 8 22.975 27.500000000000004 25.174999999999997 24.349999999999998 9 21.95 24.224999999999998 29.625 24.2 10-14 24.59 29.585 24.735 21.09 15-19 23.89 28.294999999999998 26.185000000000002 21.63 20-24 23.71 28.749999999999996 26.009999999999998 21.529999999999998 25-29 23.105 28.23 26.68 21.985 30-34 23.87 27.589999999999996 26.945000000000004 21.595 35-39 23.74 27.555000000000003 26.840000000000003 21.865000000000002 40-44 22.97 27.875 26.765 22.39 45-49 23.18 27.529999999999998 26.979999999999997 22.31 50-54 23.425 27.93 26.76 21.884999999999998 55-59 23.799999999999997 27.02 27.229999999999997 21.95 60-64 24.19 27.11 26.875 21.825 65-69 24.82 27.185 26.205000000000002 21.790000000000003 70-74 23.599999999999998 28.095 26.015 22.29 75-79 24.060000000000002 27.644999999999996 26.51 21.785 80-84 23.885 27.575 26.405 22.134999999999998 85-89 24.325 27.315 25.814999999999998 22.545 90-94 23.965 27.565 26.465 22.005 95-99 24.515 27.715 26.25 21.52 100-104 25.22 27.465 25.895000000000003 21.42 105-109 24.195 27.310000000000002 26.645000000000003 21.85 110-114 24.2 28.055000000000003 26.135 21.61 115-119 24.81 27.465 26.445 21.279999999999998 120-124 25.09 27.83 25.75 21.33 125-129 24.955 27.529999999999998 25.955000000000002 21.560000000000002 130-134 25.83 27.534999999999997 25.929999999999996 20.705000000000002 135-139 25.759999999999998 27.83 25.805 20.605 140-144 26.77 26.995 25.535000000000004 20.7 145-149 26.415 27.905 25.119999999999997 20.560000000000002 150-151 26.937499999999996 27.500000000000004 25.4 20.1625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 1.5 25 0.5 26 1.0 27 3.0 28 2.5 29 1.0 30 5.0 31 7.5 32 9.5 33 14.5 34 19.5 35 35.0 36 61.5 37 90.5 38 115.5 39 125.5 40 153.5 41 208.0 42 234.0 43 245.5 44 270.5 45 281.5 46 271.0 47 282.0 48 259.5 49 220.5 50 211.5 51 181.0 52 146.5 53 110.5 54 89.0 55 77.5 56 56.5 57 40.5 58 37.0 59 37.0 60 24.5 61 8.5 62 5.5 63 5.5 64 3.5 65 3.0 66 1.5 67 1.0 68 1.5 69 3.5 70 3.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 1.0 83 1.0 84 1.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 0.5 96 1.0 97 1.0 98 0.5 99 1.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.574456218628 81.2 2 7.919687674288902 14.2 3 1.1154489682097044 3.0 4 0.2509760178471835 0.8999999999999999 5 0.11154489682097045 0.5 6 0.0 0.0 7 0.0 0.0 8 0.027886224205242612 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit TATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTG 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.025 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.7750000000000004 0.0 0.0 0.0 0.0 118-119 3.025 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.75 0.0 0.0 0.0 0.0 124-125 4.1125 0.0 0.0 0.0 0.0 126-127 4.625 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.625 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.4875 0.0 0.0 0.0 0.0 136-137 7.1 0.0 0.0 0.0 0.0 138-139 7.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAATCC 10 0.006830828 145.0 9 >>END_MODULE Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742891 spots for SRR12690198.sra Written 742891 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra Read 742889 spots for SRR12690198.sra Written 742889 spots for SRR12690198.sra SRR ids: ['SRR12690198.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i8xzp_qz SRR12690198.sra spots: 14857782 blocks: [[1, 742889], [742890, 1485778], [1485779, 2228667], [2228668, 2971556], [2971557, 3714445], [3714446, 4457334], [4457335, 5200223], [5200224, 5943112], [5943113, 6686001], [6686002, 7428890], [7428891, 8171779], [8171780, 8914668], [8914669, 9657557], [9657558, 10400446], [10400447, 11143335], [11143336, 11886224], [11886225, 12629113], [12629114, 13372002], [13372003, 14114891], [14114892, 14857782]] SRR12690198 file size 5027623 SRR12690198 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690198 SRR12690198_1.fastq SRR12690198_2.fastq Input file: SRR12690198_1.fastq Paired file: SRR12690198_2.fastq trimmed: SRR12690198-trimmed-pair1.fastq, SRR12690198-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:41:12 2025 >> started Mon Feb 10 22:41:33 2025 >> done (20.676s) 14857782 read pairs processed; of these: 90 ( 0.00%) short read pairs filtered out after trimming by size control 63993 ( 0.43%) empty read pairs filtered out after trimming by size control 14793699 (99.57%) read pairs available; of these: 1801895 (12.18%) trimmed read pairs available after processing 12991804 (87.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 5 0.00% 21 5 0.00% 22 10 0.00% 23 13 0.00% 24 17 0.00% 25 16 0.00% 26 19 0.00% 27 21 0.00% 28 24 0.00% 29 20 0.00% 30 27 0.00% 31 20 0.00% 32 27 0.00% 33 30 0.00% 34 28 0.00% 35 31 0.00% 36 32 0.00% 37 38 0.00% 38 39 0.00% 39 37 0.00% 40 41 0.00% 41 63 0.00% 42 57 0.00% 43 37 0.00% 44 52 0.00% 45 46 0.00% 46 68 0.00% 47 55 0.00% 48 78 0.00% 49 55 0.00% 50 102 0.00% 51 128 0.00% 52 114 0.00% 53 115 0.00% 54 111 0.00% 55 115 0.00% 56 112 0.00% 57 114 0.00% 58 211 0.00% 59 195 0.00% 60 231 0.00% 61 306 0.00% 62 294 0.00% 63 320 0.00% 64 416 0.00% 65 359 0.00% 66 457 0.00% 67 498 0.00% 68 553 0.00% 69 603 0.00% 70 730 0.00% 71 756 0.01% 72 885 0.01% 73 1007 0.01% 74 1139 0.01% 75 1230 0.01% 76 1357 0.01% 77 1534 0.01% 78 1609 0.01% 79 1921 0.01% 80 1885 0.01% 81 2382 0.02% 82 2601 0.02% 83 2871 0.02% 84 3162 0.02% 85 3504 0.02% 86 3755 0.03% 87 4252 0.03% 88 4525 0.03% 89 5048 0.03% 90 5409 0.04% 91 5849 0.04% 92 6608 0.04% 93 6878 0.05% 94 7578 0.05% 95 8464 0.06% 96 8934 0.06% 97 9422 0.06% 98 10012 0.07% 99 10502 0.07% 100 11412 0.08% 101 11913 0.08% 102 12707 0.09% 103 13505 0.09% 104 13809 0.09% 105 15078 0.10% 106 15767 0.11% 107 16877 0.11% 108 17356 0.12% 109 17914 0.12% 110 18564 0.13% 111 19451 0.13% 112 20083 0.14% 113 21052 0.14% 114 21859 0.15% 115 23060 0.16% 116 23976 0.16% 117 24970 0.17% 118 25997 0.18% 119 26564 0.18% 120 27123 0.18% 121 28449 0.19% 122 29099 0.20% 123 30438 0.21% 124 31140 0.21% 125 31801 0.21% 126 33316 0.23% 127 34189 0.23% 128 35680 0.24% 129 36160 0.24% 130 37240 0.25% 131 37912 0.26% 132 39224 0.27% 133 40320 0.27% 134 41164 0.28% 135 42011 0.28% 136 42478 0.29% 137 43787 0.30% 138 44666 0.30% 139 45959 0.31% 140 46643 0.32% 141 48046 0.32% 142 48991 0.33% 143 49950 0.34% 144 51077 0.35% 145 51491 0.35% 146 52492 0.35% 147 52780 0.36% 148 54214 0.37% 149 54207 0.37% 150 55752 0.38% 151 12991804 87.82% 14793699 reads passed initial QC criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=1.19 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=12.71 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=3.9 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=1.60 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=22 prefix-density=1.60 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=83.86 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=2.2 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCT SRR12690198 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:42:18 Started mapping on | Feb 10 22:42:18 Finished on | Feb 10 22:44:00 Mapping speed, Million of reads per hour | 522.13 Number of input reads | 14793699 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13887843 Uniquely mapped reads % | 93.88% Average mapped length | 295.42 Number of splices: Total | 14070296 Number of splices: Annotated (sjdb) | 13813288 Number of splices: GT/AG | 13775881 Number of splices: GC/AG | 252503 Number of splices: AT/AC | 9954 Number of splices: Non-canonical | 31958 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442059 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 112397 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.16% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463797 463797 463797 N_multimapping 442059 442059 442059 N_noFeature 300994 13721478 344566 N_ambiguous 230391 700 107179 UnstrandedReadsAssigned:13356458 PositiveStrandReadsAssigned:165665 NegativeStrandReadsAssigned:13436098 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690198 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690198-trimmed-pair1.fastq SRR12690198-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,793,699 reads, 13,543,307 reads pseudoaligned [quant] estimated average fragment length: 239.642 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR12690198.ke.tsv 34699 SRR12690198.se.tsv 87100 total ==> SRR12690198.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.36 208 7.16714 Potri.005G024800.1.v4.1 1035 796.358 47 3.61856 Potri.004G059700.1.v4.1 961 722.396 58 4.92265 Potri.007G009000.2.v4.1 1416 1177.36 0 0 Potri.003G141000.2.v4.1 2943 2704.36 346 7.84437 Potri.016G087400.1.v4.1 270 84.877 660.456 477.09 Potri.015G069301.1.v4.1 564 332.155 0 0 Potri.010G195200.1.v4.1 1773 1534.36 2 0.0799189 Potri.012G127500.1.v4.1 977 738.375 523 43.4281 ==> SRR12690198.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 64 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 126 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12690198 completed mapping pipeline successfully