Starting /dee2/code/volunteer_pipeline.sh SRR12690199 current disk space = 3057558450176 free memory = 1242649204 SRR12690199 SRAfilesize 1c56fa70ca5bb35ef12ad0c834eec731 SRR12690199.sra SRR12690199.sra file validated SRR12690199 is paired end SRR12690199 is conventional basespace SRR12690199 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690199_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.59 37.0 37.0 37.0 37.0 37.0 2 36.3295 37.0 37.0 37.0 37.0 37.0 3 36.626 37.0 37.0 37.0 37.0 37.0 4 36.618 37.0 37.0 37.0 37.0 37.0 5 36.6845 37.0 37.0 37.0 37.0 37.0 6 36.631 37.0 37.0 37.0 37.0 37.0 7 36.515 37.0 37.0 37.0 37.0 37.0 8 36.622 37.0 37.0 37.0 37.0 37.0 9 36.5435 37.0 37.0 37.0 37.0 37.0 10-14 36.6301 37.0 37.0 37.0 37.0 37.0 15-19 36.5923 37.0 37.0 37.0 37.0 37.0 20-24 36.5729 37.0 37.0 37.0 37.0 37.0 25-29 36.5586 37.0 37.0 37.0 37.0 37.0 30-34 36.53 37.0 37.0 37.0 37.0 37.0 35-39 36.503 37.0 37.0 37.0 37.0 37.0 40-44 36.5313 37.0 37.0 37.0 37.0 37.0 45-49 36.5043 37.0 37.0 37.0 37.0 37.0 50-54 36.443400000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.4172 37.0 37.0 37.0 37.0 37.0 60-64 36.39139999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3762 37.0 37.0 37.0 37.0 37.0 70-74 36.3722 37.0 37.0 37.0 37.0 37.0 75-79 36.3738 37.0 37.0 37.0 37.0 37.0 80-84 36.272800000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2838 37.0 37.0 37.0 37.0 37.0 90-94 36.2039 37.0 37.0 37.0 37.0 37.0 95-99 36.2125 37.0 37.0 37.0 37.0 37.0 100-104 36.1893 37.0 37.0 37.0 37.0 37.0 105-109 36.185199999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.158100000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.1286 37.0 37.0 37.0 37.0 37.0 120-124 36.0351 37.0 37.0 37.0 37.0 37.0 125-129 35.987100000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.9868 37.0 37.0 37.0 37.0 37.0 135-139 35.970800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.775 37.0 37.0 37.0 37.0 37.0 145-149 35.7873 37.0 37.0 37.0 37.0 37.0 150-151 35.6395 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 5.0 26 4.0 27 3.0 28 9.0 29 22.0 30 23.0 31 23.0 32 45.0 33 66.0 34 114.0 35 316.0 36 2984.0 37 386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.0 12.75 7.625 41.625 2 20.180722891566266 11.92269076305221 35.567269076305216 32.329317269076306 3 16.725 14.625 26.85 41.8 4 21.025 20.974999999999998 25.874999999999996 32.125 5 23.974999999999998 27.55 25.174999999999997 23.3 6 21.475 31.874999999999996 23.974999999999998 22.675 7 17.150000000000002 25.85 40.125 16.875 8 18.025 27.125 31.125000000000004 23.724999999999998 9 16.3 25.324999999999996 35.199999999999996 23.175 10-14 19.775000000000002 29.54 27.72 22.965 15-19 19.8 27.950000000000003 27.345000000000002 24.905 20-24 20.18 27.715 28.62 23.485 25-29 19.75 27.855 28.26 24.135 30-34 20.75 27.22 27.395000000000003 24.635 35-39 21.01 27.71 27.495000000000005 23.785 40-44 20.265 28.38 27.375 23.98 45-49 20.45 27.755000000000003 27.38 24.415 50-54 20.69 27.084999999999997 27.99 24.235 55-59 20.41 27.805000000000003 28.075 23.71 60-64 20.599999999999998 27.825 27.525 24.05 65-69 20.05 27.18 28.68 24.09 70-74 19.85 27.589999999999996 28.155 24.404999999999998 75-79 20.89 27.38 27.639999999999997 24.09 80-84 20.66 27.694999999999997 27.439999999999998 24.205 85-89 20.255000000000003 27.92 27.900000000000002 23.925 90-94 20.45 28.754999999999995 26.8 23.995 95-99 20.330000000000002 27.72 28.285 23.665 100-104 20.810000000000002 27.725 27.365000000000002 24.099999999999998 105-109 20.585 27.825 27.534999999999997 24.055 110-114 20.69 28.01 27.675 23.625 115-119 21.015 27.565 27.560000000000002 23.86 120-124 21.38 27.779999999999998 27.384999999999998 23.455000000000002 125-129 21.025 28.4 27.060000000000002 23.515 130-134 20.7 27.76 27.425 24.115000000000002 135-139 20.805 27.61 27.67 23.915 140-144 21.065 28.18 27.27 23.485 145-149 21.715 27.87 27.279999999999998 23.135 150-151 21.075 27.8125 27.6125 23.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 4.0 27 6.0 28 7.0 29 10.0 30 16.0 31 20.0 32 23.5 33 32.0 34 38.0 35 46.5 36 56.5 37 93.5 38 128.0 39 142.5 40 180.0 41 211.5 42 233.5 43 257.5 44 264.5 45 259.0 46 259.0 47 258.5 48 247.5 49 228.5 50 205.0 51 162.0 52 125.5 53 103.5 54 88.0 55 80.5 56 62.0 57 40.5 58 27.0 59 24.0 60 18.0 61 10.5 62 9.5 63 7.0 64 3.0 65 2.5 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.2 #Duplication Level Percentage of deduplicated Percentage of total 1 90.77050997782705 81.875 2 7.843680709534367 14.149999999999999 3 1.164079822616408 3.15 4 0.19401330376940135 0.7000000000000001 5 0.02771618625277162 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCTATACATGACATCAATCTTCAAACCTTCCCAGTCAGACCTCACCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.1124999999999998 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 2.9625 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.5875000000000004 0.0 0.0 0.0 0.0 134-135 3.8875 0.0 0.0 0.0 0.0 136-137 4.325 0.0 0.0 0.0 0.0 138-139 4.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690199 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690199_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.202 37.0 37.0 37.0 37.0 37.0 2 35.934 37.0 37.0 37.0 37.0 37.0 3 36.1 37.0 37.0 37.0 37.0 37.0 4 36.066 37.0 37.0 37.0 37.0 37.0 5 36.2045 37.0 37.0 37.0 37.0 37.0 6 36.2515 37.0 37.0 37.0 37.0 37.0 7 36.1665 37.0 37.0 37.0 37.0 37.0 8 36.2165 37.0 37.0 37.0 37.0 37.0 9 36.32 37.0 37.0 37.0 37.0 37.0 10-14 36.288399999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.231500000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.257 37.0 37.0 37.0 37.0 37.0 25-29 36.170399999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.202799999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1922 37.0 37.0 37.0 37.0 37.0 40-44 36.1134 37.0 37.0 37.0 37.0 37.0 45-49 36.130100000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.04459999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.0394 37.0 37.0 37.0 37.0 37.0 60-64 36.0125 37.0 37.0 37.0 37.0 37.0 65-69 36.0207 37.0 37.0 37.0 37.0 37.0 70-74 35.9308 37.0 37.0 37.0 37.0 37.0 75-79 35.9781 37.0 37.0 37.0 37.0 37.0 80-84 35.9324 37.0 37.0 37.0 37.0 37.0 85-89 35.97100000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.793600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.785399999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8627 37.0 37.0 37.0 37.0 37.0 105-109 35.8778 37.0 37.0 37.0 37.0 37.0 110-114 35.769099999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.7593 37.0 37.0 37.0 37.0 37.0 120-124 35.62089999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.640699999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.5187 37.0 37.0 37.0 37.0 37.0 135-139 35.4527 37.0 37.0 37.0 37.0 37.0 140-144 35.480599999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.405499999999996 37.0 37.0 37.0 34.6 37.0 150-151 34.957750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 3.0 20 2.0 21 0.0 22 1.0 23 1.0 24 6.0 25 4.0 26 6.0 27 10.0 28 18.0 29 21.0 30 28.0 31 47.0 32 60.0 33 102.0 34 202.0 35 608.0 36 2654.0 37 222.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.9 24.9 11.425 28.775000000000002 2 27.05 27.375 28.999999999999996 16.575 3 19.650000000000002 28.625 31.025000000000002 20.7 4 22.55 34.1 23.9 19.45 5 25.5 36.225 21.95 16.325 6 19.425 40.300000000000004 23.025000000000002 17.25 7 20.05 24.7 36.25 19.0 8 21.349999999999998 26.950000000000003 26.525 25.174999999999997 9 22.975 25.374999999999996 28.95 22.7 10-14 22.745 29.904999999999998 26.515 20.835 15-19 22.915 28.335 27.67 21.08 20-24 22.81 28.78 26.834999999999997 21.575 25-29 22.09 28.415000000000003 27.93 21.565 30-34 22.225 28.060000000000002 27.810000000000002 21.905 35-39 22.720000000000002 27.950000000000003 27.3 22.03 40-44 23.04 27.91 27.66 21.39 45-49 23.150000000000002 27.805000000000003 27.775 21.27 50-54 22.650000000000002 28.105000000000004 27.46 21.785 55-59 22.73 28.199999999999996 27.96 21.11 60-64 22.945 27.875 27.57 21.61 65-69 23.125 27.99 27.82 21.065 70-74 22.74 28.09 27.060000000000002 22.11 75-79 22.665 28.185 27.735 21.415 80-84 22.93 27.445000000000004 27.744999999999997 21.88 85-89 23.105 28.515 26.700000000000003 21.68 90-94 23.49 27.810000000000002 26.995 21.705 95-99 23.849999999999998 27.779999999999998 27.365000000000002 21.005 100-104 24.099999999999998 27.275 27.500000000000004 21.125 105-109 23.36 28.1 27.07 21.47 110-114 24.310000000000002 27.965 27.125 20.599999999999998 115-119 24.21 27.900000000000002 26.735 21.154999999999998 120-124 23.96 28.975 26.674999999999997 20.39 125-129 23.78 27.41 27.555000000000003 21.255 130-134 24.29 27.83 27.41 20.47 135-139 25.045 27.615000000000002 27.465 19.875 140-144 25.330000000000002 28.035 26.625 20.01 145-149 25.355 27.97 26.145000000000003 20.53 150-151 26.937499999999996 28.000000000000004 25.6125 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 3.0 26 6.0 27 6.0 28 4.5 29 4.5 30 10.5 31 20.0 32 25.0 33 31.5 34 43.5 35 58.5 36 78.0 37 110.0 38 140.5 39 151.5 40 182.0 41 224.5 42 260.5 43 293.0 44 285.5 45 265.0 46 266.0 47 251.5 48 223.0 49 207.5 50 174.0 51 138.0 52 127.5 53 106.0 54 73.5 55 57.0 56 45.0 57 29.0 58 28.0 59 24.0 60 14.0 61 9.5 62 5.5 63 4.5 64 2.0 65 0.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 91.05510938798118 82.19999999999999 2 7.532539462752701 13.600000000000001 3 1.1631127111603434 3.15 4 0.16615895873719191 0.6 5 0.027693159789531983 0.125 6 0.027693159789531983 0.15 7 0.027693159789531983 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit GACCAGACATGCTTATCAGTGGATTTTTACAGCCTGTACCGGACTTGGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.1124999999999998 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.2125000000000004 0.0 0.0 0.0 0.0 122-123 2.3125 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.7249999999999996 0.0 0.0 0.0 0.0 128-129 2.9875 0.0 0.0 0.0 0.0 130-131 3.3125 0.0 0.0 0.0 0.0 132-133 3.6375 0.0 0.0 0.0 0.0 134-135 3.9375 0.0 0.0 0.0 0.0 136-137 4.375 0.0 0.0 0.0 0.0 138-139 4.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642242 spots for SRR12690199.sra Written 642242 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra Read 642236 spots for SRR12690199.sra Written 642236 spots for SRR12690199.sra SRR ids: ['SRR12690199.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rrzhjrqj SRR12690199.sra spots: 12844726 blocks: [[1, 642236], [642237, 1284472], [1284473, 1926708], [1926709, 2568944], [2568945, 3211180], [3211181, 3853416], [3853417, 4495652], [4495653, 5137888], [5137889, 5780124], [5780125, 6422360], [6422361, 7064596], [7064597, 7706832], [7706833, 8349068], [8349069, 8991304], [8991305, 9633540], [9633541, 10275776], [10275777, 10918012], [10918013, 11560248], [11560249, 12202484], [12202485, 12844726]] SRR12690199 file size 4343499 SRR12690199 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690199 SRR12690199_1.fastq SRR12690199_2.fastq Input file: SRR12690199_1.fastq Paired file: SRR12690199_2.fastq trimmed: SRR12690199-trimmed-pair1.fastq, SRR12690199-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:39:05 2025 >> started Mon Feb 10 22:39:20 2025 >> done (15.025s) 12844726 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 1996 ( 0.02%) empty read pairs filtered out after trimming by size control 12842713 (99.98%) read pairs available; of these: 1049929 ( 8.18%) trimmed read pairs available after processing 11792784 (91.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 8 0.00% 24 6 0.00% 25 9 0.00% 26 9 0.00% 27 10 0.00% 28 7 0.00% 29 15 0.00% 30 15 0.00% 31 11 0.00% 32 5 0.00% 33 10 0.00% 34 15 0.00% 35 15 0.00% 36 12 0.00% 37 10 0.00% 38 24 0.00% 39 8 0.00% 40 16 0.00% 41 27 0.00% 42 14 0.00% 43 25 0.00% 44 20 0.00% 45 21 0.00% 46 20 0.00% 47 24 0.00% 48 33 0.00% 49 40 0.00% 50 42 0.00% 51 49 0.00% 52 48 0.00% 53 65 0.00% 54 51 0.00% 55 49 0.00% 56 90 0.00% 57 62 0.00% 58 78 0.00% 59 103 0.00% 60 109 0.00% 61 122 0.00% 62 147 0.00% 63 133 0.00% 64 198 0.00% 65 171 0.00% 66 206 0.00% 67 194 0.00% 68 233 0.00% 69 267 0.00% 70 324 0.00% 71 354 0.00% 72 446 0.00% 73 452 0.00% 74 529 0.00% 75 538 0.00% 76 586 0.00% 77 668 0.01% 78 771 0.01% 79 905 0.01% 80 984 0.01% 81 1062 0.01% 82 1135 0.01% 83 1322 0.01% 84 1479 0.01% 85 1648 0.01% 86 1827 0.01% 87 1971 0.02% 88 2229 0.02% 89 2360 0.02% 90 2592 0.02% 91 2802 0.02% 92 3037 0.02% 93 3346 0.03% 94 3747 0.03% 95 3875 0.03% 96 4243 0.03% 97 4572 0.04% 98 4924 0.04% 99 5211 0.04% 100 5577 0.04% 101 5987 0.05% 102 6355 0.05% 103 6647 0.05% 104 6958 0.05% 105 7511 0.06% 106 8117 0.06% 107 8622 0.07% 108 8859 0.07% 109 9236 0.07% 110 9789 0.08% 111 10079 0.08% 112 10743 0.08% 113 10974 0.09% 114 11566 0.09% 115 12262 0.10% 116 13069 0.10% 117 13457 0.10% 118 14066 0.11% 119 14629 0.11% 120 15244 0.12% 121 15808 0.12% 122 16491 0.13% 123 17067 0.13% 124 17713 0.14% 125 18142 0.14% 126 19020 0.15% 127 19491 0.15% 128 20382 0.16% 129 20953 0.16% 130 21717 0.17% 131 22326 0.17% 132 23299 0.18% 133 23899 0.19% 134 24525 0.19% 135 25257 0.20% 136 26111 0.20% 137 26658 0.21% 138 27083 0.21% 139 28455 0.22% 140 29318 0.23% 141 29823 0.23% 142 30840 0.24% 143 31124 0.24% 144 32791 0.26% 145 33200 0.26% 146 33356 0.26% 147 34481 0.27% 148 35596 0.28% 149 35631 0.28% 150 36825 0.29% 151 11792784 91.82% 12842713 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.49 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=33.61 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=11.0 sequence=ACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=26 prefix-density=0.65 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=28 fanout-score=28.17 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=6.9 sequence=GCAATGGCAGCCTCAGTTATGGCTTCA SRR12690199 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:40:05 Started mapping on | Feb 10 22:40:05 Finished on | Feb 10 22:41:35 Mapping speed, Million of reads per hour | 513.71 Number of input reads | 12842713 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12213004 Uniquely mapped reads % | 95.10% Average mapped length | 297.44 Number of splices: Total | 12616326 Number of splices: Annotated (sjdb) | 12359425 Number of splices: GT/AG | 12377090 Number of splices: GC/AG | 196560 Number of splices: AT/AC | 10095 Number of splices: Non-canonical | 32581 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291500 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 54829 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 338209 338209 338209 N_multimapping 291500 291500 291500 N_noFeature 378562 12061185 430772 N_ambiguous 171972 882 71795 UnstrandedReadsAssigned:11662470 PositiveStrandReadsAssigned:150937 NegativeStrandReadsAssigned:11710437 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690199 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690199-trimmed-pair1.fastq SRR12690199-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,842,713 reads, 11,756,434 reads pseudoaligned [quant] estimated average fragment length: 259.428 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,012 rounds 52401 SRR12690199.ke.tsv 34699 SRR12690199.se.tsv 87100 total ==> SRR12690199.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.57 414 18.0185 Potri.005G024800.1.v4.1 1035 776.572 299 29.4859 Potri.004G059700.1.v4.1 961 702.721 17 1.85264 Potri.007G009000.2.v4.1 1416 1157.57 0 0 Potri.003G141000.2.v4.1 2943 2684.57 491.904 14.0324 Potri.016G087400.1.v4.1 270 77.4247 578 571.707 Potri.015G069301.1.v4.1 564 318.387 0 0 Potri.010G195200.1.v4.1 1773 1514.57 42 2.12366 Potri.012G127500.1.v4.1 977 718.679 118 12.574 ==> SRR12690199.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 122 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 34 SRR12690199 completed mapping pipeline successfully